The integrins

The EC Matrix facilitates intercellular communication and serves as a substrate during migration. Cell adhesion to the matrix is mediated by specialized adhesion receptors such as integrins, Discoidin Domain Receptors (DDRs) and syndecans (Frantz (Frantz et al., 2010) et al., 2010).

Integrins are heterodimers consisting of an α-subunit and a β-subunit which are non-covalently linked (Campbell & Humphries, 2011; Hynes, 2002). In vertebrates, the integrin family includes eighteen α-subunits and eight β-subunits that can be assembled to form twenty-four different heterodimers (Takada et al., 2007). The integrins may be sub-grouped according to the ligand binding properties or the arrangement of the subunits ( Figure 11).

The three largest groups are β1, β2 and αν integrins (Barczyk et al., 2010). Several cytosolic proteins interact with the β subunit (Legate & Fassler, 2009). Talin and kindlin act

synergistically to activate integrins by binding to the cytoplasmic C-terminus of the β-subunits (Larjava et al., 2008; Tadokoro et al., 2003). Filamin A negatively regulates the activation of integrins (Kiema et al., 2006) while migfilin block filamin binding to integrin (Ithychanda et al., 2009). Integrin-Linked-Kinase (ILK) (Honda et al., 2009) and Focal Adhesion Kinase (FAK) are also involved in integrin activation (Yoon et al., 2015).

Figure 11. The integrin receptor family is composed of 24 heterodimers. The figure depicts the association of the eight alphas (a) and 18 beta (b) integrin subunits. Grouped in blue are those that bind to ligands containing an RGD motif. In yellow are leukocyte-specific receptors.

The activation of integrins depends both on the interaction with their extracellular ligand, cytoplasmic partners and their response to the mechanical forces exerted on it. Integrins transmit signals from the extracellular to the intracellular part of the cell (outside-in, ECM proteins bind first) but also in the opposite direction (inside-out, cytoplasmic proteins bind first) (Hytonen & Wehrle-Haller, 2014). Integrins sense and regulates the ECM mechanics through their interactions with the matrix proteins, the actin cytoskeleton, and signaling

proteins. Binding to the ECM molecules leads first to the formation of adhesive structures called focal adhesions (FA) (Campbell & Humphries, 2011; Y. Zhang & Wang, 2012). In subsequent steps, the FA are reinforced by the recruitment of diverse molecules to the cytoplasmic region of integrins (Anthis & Campbell, 2011; Zaidel-Bar et al., 2007) (Figure 12).

Among these proteins, talin have a structural role by linking integrins to the actin cytoskeleton (X. Zhang et al., 2008). Adapter proteins, such as vinculin, will strengthen FAs by connecting talin to actinin. Kindlins also bind to and activate integrins, therefore, inducing cell spreading through direct interaction with paxillin. The main function of paxillin is the integration and propagation of integrin signal required for cell migration (Brown & Turner, 2004). Signaling molecules with enzymatic activity such as the Arp2/3 complex, Rho-GTPases will respectively allow actin polymerization (Pollard, 2007), cytoskeletal dynamics (Ridley 2015). FAK, besides its tyrosine kinase activity, is also involved in FA dynamics (Kanteti et al., 2016).

Figure 12. Integrin structure and the associated cytoplasmic activators. In the extracellular side, integrins to several matrix proteins, including fibronectin, containing a recognition motif (in this case an RGD motif). In the intracellular side, many cytoplasmic proteins bind to and activate integrins. Some have a structural role (talins and kindlins), others have signaling functions (paxillin). (This figure is a donation of Patricia Vazquez)

Integrins and growth factor receptors (GFR) collaborate in their functions (Legate et al., 2009).

Several mechanisms by which integrins regulate the function of growth factor receptors have been proposed. These include i) recruitment and clustering of adaptors to the plasma membrane in the proximity of GFR, ii) relocation of GFR into focal contacts, and iii) altered rate of internalization or degradation. It has been demonstrated that cell adhesion to the ECM is required for PDGFR-b phosphorylation and prevents proteasomal degradation. On the contrary, the PDGFR-b activation increases the migration of endothelial cells on vitronectin.

Cell adhesion is also necessary for EGFR expression which seems to be regulated by the b1 integrin. The EGFR phosphorylates the a6b4 integrins disrupting the hemidesmosomes and a decrease in metastasis (Reviewed in (Alam et al., 2007). Crosstalk between integrins and the c-Kit receptor has also been evidenced. For instance, it was shown that soluble-KitL, through

interaction with c-Kit, stimulates mast cells adhesion to fibronectin (Dastych & Metcalfe, 1994; Kinashi & Springer, 1994). Similarly, soluble-KitL stimulates adhesion and chemotaxis of melanoblasts on vitronectin and laminin. In contrast, immobilized-KitL but not soluble-KitL induced c-Kit-mediated and integrin-dependent adhesion of melanoblasts on poor-laminin surfaces (S. Tabone-Eglinger et al., 2012).

Integrins are implicated in many processes during embryogenesis but also during adult life, and their deregulation or mutation can lead diseases with different degrees of severity. The physiological importance of integrins has been highlighted thanks to the study of their gene inactivation effects in mice models and the associated pathologies. For instance, α5- and αV-null mice die by E10.5 due to angiogenic defects (van der Flier et al., 2010). Additional genetically modified animals are models of human diseases such as epidermolysis bullosa (β4 or α6), muscular dystrophies (α7), leukocyte adhesion-deficient type I (β2), impaired wound healing defects (α3,9, M or β2) (Winograd-Katz et al., 2014).

In spite the fact that cancer cells survive and proliferate in a less ECM-dependent way, they continue to use integrins during tumor initiation and progression. It seems to be induced by the increased expression of those integrins that promotes cell survival and proliferation and migration (W. Guo & Giancotti, 2004). Such changes allow transformed cells to change their migratory properties and survive within the tumoral environment. For example, β1 integrin seems to be required for metastatic events (Kren et al., 2007) and the overexpression of α5β1 integrin increases the invasiveness of cells by increasing their intrinsic contractility (Mierke et al., 2011). The αVβ3 integrin is upregulated in melanomas facilitating the invasion of the stroma and angiogenesis. Additional studies have also highlighted the pro-invasive functions α6β4 in carcinomas (W. Guo & Giancotti, 2004).

Cells integrate signals coming from the matrix and respond according to the properties of the microenvironment at a given place and time. Adherence and spreading are the processes by which cells attach to their support and provide the first signals of cell survival. During the evolution of cancer cells, the environment is crucial for their survival, growth, and progression. In this regard, the tumor microenvironment has become an interested target for new treatment approaches. Therefore, it is of great importance to study the different components of the tumoral environment and their implications in cancer.

Objectives

As described in the introduction, c-Kit is either overexpressed or constitutively active in several cancers. Nowadays, there are various types of drugs targeting c-Kit, which are used in oncology for the management of patients suffering cancer. TKIs, for example, have been used successfully but with some limitations as primary and acquired resistances appear during long-term treatment. Indeed, some types of c-Kit mutants are resistant to most TKIs. For example, this includes the D816V mutation, which is characteristic of systemic mastocytosis.

Why some cancer cells are resistant to therapies is a matter of intense research.

One explanation for TKIs resistance is that tumor cells persist within the environmental niche thanks to adhesive interactions with the stroma and the ECM (Hirata et al., 2015). Within the niche, cell-matrix adhesion can be mediated by integrins in collaboration with growth factor receptors. Therefore, it is possible that both axes KitL/c-Kit and ECM/integrins appear to function in a delicate signaling balance, shifting rapidly to cell-matrix adhesion-mediated survival, in the presence of kinase inhibitors.

This work intended to analyze how the KitL/c-kit as well as ECM/integrins adhesive systems contribute to the anchorage and signaling of normal and malignant cells to their niche. Insight into this problem will help to find new therapeutics targets to overcome drug resistance due to TKI. For this purpose, two main objectives will be addressed:

1. To study the adhesive properties of the KitL/c-Kit pair and how it is functioning in the presence of kinase inhibitors.

• Differential roles of soluble- and immobilized-KitL in c-Kit-mediated spreading on ECM proteins.

• Differential sensitivity of soluble- and immobilized-KitL to tyrosine kinase inhibitors

2. To investigate how KitL/c-Kit signaling interfaces with integrin to regulate cell adhesion and spreading on ECM proteins.

3. To evaluate the effects of c-Kit activating mutations in cell adhesion and spreading on ECM proteins.

Materials and methods Plasmids and mutagenesis

The mouse c-Kit cDNA encoding the full-length c-Kit [isoform 2, GNNK(-)] in pcDNA3 under the control of a cytomegalovirus promoter was already described (S. Tabone-Eglinger et al., 2014). In this study, a C-terminal tagged c-Kit protein, c-Kit_tagRFP, was generated by exchanging the cherry tag by a tagRFP sequence in a pcDNA3 expression vector. Mutagenesis of the mouse c-Kit DNA sequence was done by PCR overlap extension using specific primers containing single or multiple substitutions or deletions. All c-Kit are listed in Table 4 and were verified by automated sequencing.

Table 4. List of c-Kit mutations used in this study.

c-Kit mutant Forward primer Reverse primer

W556A GAAGTACAAGCGAAGGTTGTCGAGGAG CAACCTTCGCTTGTACTTCATACATGGG

Y567F AACAATTTCGTTTACATAGACCCGACGCAAC GTCTATGTAAACGAAATTGTTTCCATTTATCTCC

YY567/569FF AACAATTTCGTTTTCATAGACCCGACGCAAC GTCTATGAAAACGAAATTGTTTCCATTTATCTCC

Y719F AACAATTATGTTTTCATAGACCCGACGCAAC GTCTATGAAAACATAATTGTTTCCATTTATCTCC

D790N ATTCACAGAAATTTGGCAGCCAGGAATATC GGCTGCCAAATTTCTGTGAATACAATTCTTGGA

D814V GCCAGAGTCATCAGGAATGATTCGAATTAC CATTCCTGATGACTCTGGCTAGCCCGAAATC

D814H GCCAGACACATCAGGAATGATTCGAATTAC CATTCCTGATGTGTCTGGCTAGCCCGAAATCG

S819A GGAATGATGCGAATTACGTGGTCAAAGG CACGTAATTCGCATCATTCCTGATGTCTCTGG

S819D GGAATGATGACAATTACGTGGTCAAAGGAAATG CACGTAATTGTCATCATTCCTGATGTCTCTGG

Y821D GATTCGAATGACGTGGTCAAAGGAAATGCAC CTTTGACCACGTCATTCGAATCATTCCTGATG

Y821F GATTCGAATTTCGTGGTCAAAGGAAATGCAC CTTTGACCACGAAATTCGAATCATTCCTGATG

Y934A CAAGCACATTGCCTCCAACTTGGCAAACTG CAAGTTGGAGGCAATGTGCTTGGTGCTGTC

Y934D CAAGCACATTGACTCCAACTTGGCAAACTG CAAGTTGGAGTCAATGTGCTTGGTGCTGTC

Y934F CAAGCACATTTTCTCCAACTTGGCAAACTG CAAGTTGGAGAAAATGTGCTTGGTGCTGTC

d949-975 GAACCCCGTGGAATTCATGGTGTCTAA CATGAATTCCACGGGGTTCTCTGG

d938-975 CATGAATTCCAAGTTGGAGTAAATGTG

d929-975 GATCTCGGACGAATTCATGGTGTCTAAG CATGAATTCGTCCGAGATCTGCTTCTC

d941-948 GCAAACTGCGTGGTGGACCATTCCGTG GTCCACCACGCAGTTTGCCAAGTTGGAG

Note: Aminoacid position are based on the mouse protein isoform 2[P05532-2, GNNK(-)]which lack amino acids 512-515.

The KitL-GFP-IgG and SP-GFP-IgG were generated in our laboratory by fusing the extracellular domain of KitL or the KitL signal peptide (SP) with the constant Fc fragment of human IgG (S.

Tabone-Eglinger et al., 2012). The KitL-GFP plasmid encoding the membrane-bound (hereafter m-KitL-GFP) was previously documented Haller & Imhof, 2001) (Wehrle-Haller & Imhof, 2001)

Reagents, antibodies and inhibitors

Tyrosine kinase inhibitors and other drugs used in this study were used dissolved in DMSO.

Imatinib and dasatinib were kindly provided by Novartis and Bristol-Myers Squibb, respectively. Sunitinib (Pfizer), Nilotinib (Novartis), Bosutinib (Pfizer), Saracatinib (AstraZeneca), PF-562271, PF-573228, Tofacitinib citrate (Pfizer) and Staurosporine were acquired at Selleckchem.com

Cell culture and transfection

COS-7 and MC/9 cells are the main cell lines used in this study, both obtained from American type Culture Collection (ATCC®). COS-7 cells (ATCC® CRL-1651™) are fibroblast-like cells from monkey kidney that growth in adherence. These cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM 4,5 g/L glucose; Sigma), supplemented with 10% fetal calf serum (FCS), 2mM glutamine and antibiotics to make the complete growth medium. MC/9 cells (ATCC® CRL-1651™) are mast cells from mouse liver that growth in suspension and naturally express c-Kit. MC/9 cells were grown in complete DMEM medium supplemented with soluble-Kit ligand- and IL3-containing supernatants and 10 mM of β-mercaptoethanol.

Soluble-KitL- and IgG fusion proteins-containing supernatants were obtained as described in (S. e. a. Tabone-Eglinger, 2012). IL3-containg supernatant was collected from WEHI-3 cells provided by Beat Imhof.

COS-7 cells were transiently transfected with jetPEI® DNA transfection reagent (Polyplus transfection®) following the manufacturer’s instructions (Polyplus-transfection, 2017). In brief, per 100000 cells 1,5µg of DNA and 3µl of jetPEI were diluted separately in 150mM of NaCl to a final volume of 100µl. After gently vortex, the jetPEI solution was added to the DNA solution. The final DNA/jetPEI mix was incubated for 30 minutes at room temperature and added (drop-wise) to cells. The jetPEI-containing transfection medium was replaced by fresh complete medium 6 hours after transfection and cells were cultured 48 hours for further

For clustering and spreading assays cells were cultured for 1h in RPMI-1640 medium (Sigma) with glutamine/antibiotics and supplemented with 0.5% of human serum albumin (HSA) in the absence of cytokines, hereafter RPMI-0.5% HSA.

Coating procedure

96-well plates or Ibidie VI^0.4 μslides were coated for 1 hour with various concentrations of fibronectin (FN, Biopur) and protein A (PA, Sigma) mixtures diluted in PBS 1X, hereafter FN/PA. The range of concentration (μg/ml) used for the mixtures of FN and PA used was:

FN (μg/ml) 0 2.2 6.6 13.3 20 PA (μg/ml) 20 17.8 13.3 6.6 0

After 3 washes with PBS 1X, coated slides were blocked (30 minutes) with PBS containing 0.5%

of human serum albumin (HSA). Then covered 30 minutes with supernatants containing KL-GFP-IgG or KL-GFP-IgG (control) which bind to protein A. Subsequently, free protein A binding sites were blocked for 30 minutes with 10 μg/ml human IgG (Jackson ImmnunoResearch Labs), washed again and stored until use in PBS-0.5% HSA. All steps were done at room temperature.

FN/PA mixtures were adapted to the cell type: COS (FN2.2/PA17.8) and MC9 (FN6.6/PA13.3).

It was also optimized for the mode of KitL presentation: s-KitL (FN20/PA0) and i-KitL (FN6.6/PA13.3).

Spreading assays

COS cells were collected by treatment with non-enzymatic cell dissociation solution (Sigma) and washed with complete DMEM. MC/9 cells were washed with complete DMEM. MC9 or COS cells were starved in RPMI-0.5% HSA for 1 hour. Starved cells were then plated on surfaces previously coated with FN/PA in the presence of soluble-KitL (FN/PA/GFP-IgG_sKitL), immobilized-KitL (FN/PA/KitL-GFP-IgG), or a control condition (FN/PA/GFP-IgG). In the case of soluble KitL stimulus, 100 ng/ml of mouse recombinant KitL (R&D system) was added to the cell suspension after one hour of starvation just before plating in coated-surfaces.

To analyze the effects of tyrosine kinase inhibitors in cell spreading, cells were pre-treated with different drug concentrations during the starvation time, 1 hour in RPMI-0.5% HSA.

DMSO was used as a control at 1/10000 in RPMI-0.5% HSA.

Cell spreading was assessed either at a fixed time or followed for 1 hour at 37 °C and 5% CO2. For end-point spreading tests cells were spread for 30 minutes. Then samples were fixed with 4% PFA and mounted in PBS for analysis. For spreading kinetics assays cells were seed for 60 minutes and the spreading response followed under a microscope. Brightfield and fluorescent images were taken every 15 minutes for 9 fields (96-well plates) or 12 fields (Ibidi VI^0.4 μslides).

Then samples were fixed with 4% PFA and mounted in PBS for analysis. The number of spread (round, flat, dark cytoplasm) and non-spread cells (round, bright) was determined manually for each condition/time point, using the ImageJ Cell Counter plugin. The percentage of spread cells was calculated in respect to the total within the same region for each condition.

Image acquisition and analysis

Live of fixed cells were observed with a 10X Plan Fluor PH1 0.50 objective with the ImageXpress XL microscope system. Brightfield or fluorescent images were acquired with a CoolSnap HQ camera (Photometrics) controlled by the MetaXpress 2.0 software.

Fluorescence was detected with the appropriated filter sets: CY3-4040B and GFP-3035B illumination filter sets (Semrock) for tag-RFP and GFP, respectively. All images were processed using ImageJ.

Fluorescence-Activated Cell Sorting (FACS)

COS cells expressing different variants of c-Kit-tagRFP were collected by treatment with non-enzymatic cell dissociation solution (Sigma), washed with complete DMEM and centrifuged.

Cells were incubated with an anti-c-Kit antibody on ice for 1 hour. After being washed with PBS 1X, cells were incubated with anti-rat AF488 (Jackson ImmunoResearch Laboratories) on ice for 30 min. Non-transfected cells were used as a negative control. For the analysis of c-Kit cell surface expression we used C6 Flow Cytometer (Accuri Cytometers Inc, Ann Arbor, MI USA) and Accury C6 Flow software (Accury).

Quantifications and Statistical Analysis

Data analysis was done with Excel and Prism. The results are representatives of at least three independent experiments and were presented by the mean ± the Standard Error of the Mean (SEM). Analysis of Variance (ANOVA, Bonferroni test) was used to determine the statistical significance of the means.

Results

Activation of c-Kit by s-KitL or m-KitL induces different signaling mechanisms. While s-KitL induces mast cell attraction to the dermis (Tajima et al., 1998), MMP-9-mediated shedding of m-KitL releases HSCs from the bone marrow niche (Heissig et al., 2002). Our group previously demonstrated that KitL dimerization and presentation at the cell surface might be crucial for the formation of KitL/c-Kit complexes (Paulhe et al., 2009). Based on these data it was proposed that m-KitL might function as an adhesive platform that can anchor stem cells to their respective niches.

In a study published in 2012, we showed that m-KitL and c-Kit form complexes (m-KitL/c-Kit clusters) at sites of contact between melb-a and MDCK cells, suggesting that m-KitL could serves as an anchor melanocytes within intra-epithelial niches (S. e. a. Tabone-Eglinger, 2012).

More recently, we reproduced KitL/c-Kit clustering by co-culturing c-Kit expressing MC/9 cells and COS cells transfected with m-KitL. We also showed that KitL/c-Kit clusters are resistant to shear stress forces, induces F-actin polymerization and contain tyrosine phosphorylated proteins. Moreover, imatinib treatment of c-Kit expressing cells and the use of c-Kit mutants revealed that the cell-cell adhesion and clustering responses mediated by m-KitL/c-Kit are kinase-independent functions (S. Tabone-Eglinger et al., 2014). These results suggest a role of m-KitL in anchoring c-Kit expressing cells to their niches.

It is well-known that growth factor receptors and integrins collaborate with each other in leading to diverse biological responses, for example cell adhesion and spreading (Ivaska &

Heino, 2011). In agreement with this, we showed that an immobilized form of KitL (hereafter i-KitL) enhances integrin-dependent spreading of melanoblasts on low concentrations of laminin. Moreover, it induced melanoblast proliferation, survival and adhesion to epithelial cells (S. Tabone-Eglinger et al., 2012;).

Based on all these observations, we have established two main experimental models to explore the role of different KitL in c-Kit expressing cells. These models were developed and improved to reproduce in vitro cell-cell and cell-matrix interactions taking place within cell niches and are described in the materials and method section. In using these two models we have expanded the niche analysis to c-Kit expressing mast cells lines and c-Kit transfected COS cells.

I. Effects of KitL presentation to c-Kit in cell-matrix adhesion and spreading. Differential roles of soluble- and immobilized-KitL in cell-matrix adhesion and spreading (S. Tabone-Eglinger et al., 2014).

As exposed in the introduction, KitL exist in a soluble and a membrane-bound form. To study the differential roles of these KitL isoforms in cell-matrix adhesion we used a 2D experimental model. In brief, glass coverslips are coated with various combinations of fibronectin and protein A (FN/PA). An immobilized form of KitL (i-KitL) fused to the constant chain of IgG and GFP-tagged (KitL-GFP-IgG) is immobilized on FN/PA coated surfaces through protein A. As a control, we used a fusion protein which has the signal peptide but lacks the c-Kit binding domain of KitL (GFP-IgG). To note that KitL becomes more diluted at increased concentrations of fibronectin, with zero levels at 20 μg/ml of fibronectin (FN20/PA0).

We first evaluated the ability of a mouse mastocyte (MC/9) cell line to spread on coated-coverslips. MC/9 cells naturally express c-Kit and integrin a5b1 (Fehlner-Gardiner et al., 1996) but are poorly adherent. Regarding the temporal course of spreading (Figure 13-A), MC/9 cells spread maximally 30 minutes after plating. At this time point, few cells spread in the absence of fibronectin (FN0/PA20) or KitL (FN20/PA0) while approximately 60% of cells spread rapidly in response to soluble-KitL on high fibronectin concentrations (FN20/PA0_GFP-IgG + s-KitL). On the other hand, 40-60% of cells respond on mixtures of FN and i-KitL (FN6.6/PA13.3/KitL). A reduced but detectable spreading was observed on FN and GFP-IgG, suggesting that additional interactions (e.g. between IgG and Fc-receptors of MC/9 cells) might also mediate this response. Overall these results indicate that MC9 cells, although not being considered as adherent cells, spread rapidly but transiently on fibronectin. Cell spreading decreased slowly after 30 minutes and after 240 min the quasi totality of cells adopted a round morphology and detach from the coated surface.

These results confirm that c-Kit and integrins collaborate to promote adhesion and spreading of MC9 cells on fibronectin. Moreover, it also validates the idea that the immobilization of KitL might provide an anchor to c-Kit expressing cells to attach to the extracellular matrix. In Considering that KitL/c-Kit interactions induced cell-cell and cell-matrix adhesion we wonder whether the c-Kit kinase activity is required for these cellular responses.

To answer this question, we first determined the optimal fibronectin and protein A concentrations at which KitL induces an efficient spreading response. As shown in Figure

13-B, in the presence of FN alone mastocytes spread only at very high concentrations of FN. This FN-mediated response is stimulated with s-KitL. In contrast, i- KitL induced cell spreading even at low FN concentrations while only a small fraction of cells spread in the absence of fibronectin. Therefore, i-KitL induced synergistic spreading at very low FN concentrations,

13-B, in the presence of FN alone mastocytes spread only at very high concentrations of FN. This FN-mediated response is stimulated with s-KitL. In contrast, i- KitL induced cell spreading even at low FN concentrations while only a small fraction of cells spread in the absence of fibronectin. Therefore, i-KitL induced synergistic spreading at very low FN concentrations,