Connexin40 controls endothelial activation by dampening NFκB activation
GRANT SUPPORT
3.3.5 Cx40 and cell cycle control
3.3.5 Cx40 and cell cycle control.
The role of connexins in tumor growth in vitro and in vivo has long been recognized [31]. Interestingly, HLSS maintains ECs in a quiescent state [1]. To investigate whether EC proliferation under HLSS was affected by the Cx40 expression level, we treated bEnd.3 cells with siCx40 and siNT for 24 hours and subsequently exposed them to 24 hours of HLSS. A 50% knock-‐down of Cx40 mRNA was confirmed (Figure 5B). In addition, bEnd.3 cells treated with siCx40 displayed an almost doubled proportion of Proliferating Cell Nuclear Antigen (PCNA) positive cells (Figure 5C-‐D), indicating an increased proliferation rate. In agreement, the proportion of cells in the resting G0 or G1 phase appeared decreased by 9% as revealed by FACS-‐based cell cycle analysis (Figure 5E).
Together, these results suggest that Cx40 regulation by HLSS may be involved in the maintenance of a quiescent endothelium.
Using in vitro and a large-‐scale functional analysis, we show here that Cx40 expression is regulated by shear stress, being up-‐regulated by athero-‐protective HLSS. Furthermore, we found that Cx40 expression is directly regulated by the flow-‐responsive athero-‐protective transcription factor KLF4. Finally, using RNAseq and GSEA we identified cell cycle progression as a downstream target of Cx40 under HLSS. Taken together, we conclude that KLF4 by inducing Cx40 expression contributes to the quiescent non-‐proliferative state of the arterial endothelium under HLSS.
KLF2 and KLF4 have been identified as central regulators of physiological anti-‐
inflammatory responses to HLSS. We have previously shown that Cx40 and Cx37 have anti-‐atherogenic properties and are highly expressed under HLSS in vivo and in vitro. [17-‐19, 32] Furthermore, the KLF2 was found to directly bind the Cx37 promoter and to induce its expression under HLSS [17]. Remarkably, reduction of KLF2 did not affect the expression of Cx40. In this study, KLF4 was found to directly bind to the Cx40 promoter and was shown to dynamically regulate its expression in response to LSS. Of note, KLF4 silencing did not affect the expression of Cx37. Thus, two important endothelial KLF’s specifically regulate the HLSS response of the two main endothelial connexins, i.e. Cx37 or Cx40. This specific regulation seems reflected in the responses of these connexins to vascular casting, imposing specific shear stresses in vivo. Whereas Cx37 was down-‐regulated in both the LLSS and OSS regions of the carotid artery 1 week after casting, Cx40 expression was only altered in the OSS region [17, 18].
levels of shear stress (Figure 1), this suggest that the threshold for KLF4 (and thus Cx40) expression might be lower under laminar shear stress when compared to the threshold of KLF2 (and Cx37) induction. The reasons for this apparent differential “set-‐point” of KLF2 and KLF4 induction by laminar shear stress remain to be investigated. Of interest is that recent ChIP-‐on-‐chip experiments revealed that KLF2, KLF4 and KLF5 regulate each other [33]. In addition, it was found that these KLFs regulated themselves as well, thus creating a complex regulatory loop [33].
Although siKLF2 did not affect the Cx40 expression [17], other members of the KLF family may affect Cx40 expression. Indeed, several members of the KLF family have are known to display redundant and complementary functions [33], which may be due to their highly similar DNA-‐binding domains [33]. It can thus not be excluded that endothelial KLF proteins with similar DNA-‐binding domains could possibly bind to the same regulatory element in the Cx40 promoter region.
Analyzing the mouse Cx40 promoter with MatInspector (http://www.genomatix.de/) identified potential KLF2, KLF3 and KLF12 binding sites. This far, KLF12 expression has not been described for the endothelium, however, KLF3 expression in the endothelium is known to be shear stress-‐
sensitive, i.e. down-‐regulated by OSS, a process that involves the methylation status of cAMP response elements in its promoter [34]. Interestingly, other KLFs (KLF1 and KLF2) have been shown to interact in common with cAMP response element-‐binding proteins (CBP/P300), and binding to the cofactor is required for transcription of reporter (target) genes [9, 35]. Similarly, one might hypothesize that KLF2 and KLF4 may interact with a common cofactor (that remains to be
and KLF4 are absent, the target gene would not be expressed. Therefore, it might be interesting to investigate silencing of both KLFs and assess the effect on Cx37 and Cx40 expression under HLSS.
Finally, epigenetic mechanisms regulating EC gene expression are gaining attention. DNA methylation is known to confer persisting changes in gene expression [36] and DNA methylation has been found to play a key role in vascular disease development and maintaining EC homeostasis [37-‐39].
Interestingly, the promoter of KLF4 has been found to be hypermethylated by disturbed blood flow [40]. Whether, the levels of promoter methylation might explain the gradual induction of KLF4 expression by LSS in vitro remains to be investigated.
A harmonized interplay between extracellular, intracellular and intercellular signaling is essential for the maintenance of tissue homeostasis. Alteration of endothelial signaling induced by OSS plays an important role in the development of atherosclerotic disease [6, 41]. ECs are exposed to various shear stresses in the vasculature with different effects on EC survival, proliferation and migration [42, 43]. Static EC cultures have higher turnover rates than ECs that are exposed to laminar shear stress [44]. In line, DNA synthesis in HUVECs was inhibited by steady laminar shear stress, an effect that was associated with a suppression of cell cycle transition from the G1 phase to S phase [45]. Mechanistically, shear stress increased the levels of cyclin-‐dependent kinase inhibitor 1 (p21), which faded after withdrawal of shear stress concomitant with a recovery of DNA
laminar shear stress-‐dependent inhibition of EC proliferation, it remains unclear whether other molecular players in cell cycle transition may be involved as well.
Small metabolites conveyed through gap junctions but also non channel-‐related effector functions of the C-‐terminal domain of connexins control important physiological processes, including cell proliferation and death [18, 46-‐53].
Interestingly, tissue ischemia induced by obstruction of a large irrigating blood vessel induces a complex cascade of vasodilatory, remodeling and inflammatory pathways and endothelial connexins may play a role in the growth of (new) blood vessels. In a first study, the group of Janis Burt elegantly demonstrated that both Cx37 and Cx40 seem to regulate post-‐ischemic limb perfusion, altering the severity of ischemic insult and post-‐ischemic survival [54]. Subsequently, they showed in Cx37-‐/-‐ animals that improved recovery of the ischemic hindlimb involved enhanced vasculogenesis, resulting in increased numbers of collaterals in the hindlimb, and increased angiogenesis [55]. Moreover, a compromised regulation of normal tissue perfusion and arteriogenesis limited recovery of ischemic tissue in Cx40-‐/-‐ mice [56]. Similarly, targeting endothelial Cx40 inhibited tumor growth by reducing angiogenesis and improving vessel perfusion [57]. Although Cx40 expression levels are not affected in Cx37 knock-‐
out mice [32], Cx37 expression levels are severely down-‐regulated in Cx40-‐
deficient mice [19, 58]. In consequence, the above-‐described effects in Cx40-‐
deficient animals may have been caused, or at least supported, by the reduction in endothelial Cx37.
In this study, we used a RNA silencing approach to down-‐regulate Cx40 expression and this procedure did not affect the expression levels of Cx37 as
approach revealed a significant up-‐regulation of pathways related to cell cycle control in ECs with knock-‐down of Cx40 under HLSS (Table 11). Moreover, the proliferation rate was increased in ECs treated with siCx40 (Figure 5C-‐D).
Furthermore, we showed a decrease of the amount in ECs in the G0/G1 resting cell cycle phase after effective knock-‐down of Cx40 (Figure 5E). Remarkably, this decrease in G0/G1 was associated by an increase in the subG1 population in the siCx40 cells, which might point to an increase in the proportion of apoptotic cells. Interestingly, increased apoptosis has also been observed in regions exposed to OSS in vivo where Cx40 is absent [59, 60]. Taken together, we conclude that Cx40 regulates EC proliferation via effects on cell cycle control.
Whether the regulation of EC proliferation depends on the synchronization of endothelial responses via gap junctions or channel-‐independent effects of Cx40 remains to be investigated.
This work was supported by grants from the Swiss National Science Foundation
(310030_143343 and 310030_162579 to B.R. Kwak).
1. Kwak BR, Back M, Bochaton-‐Piallat ML, Caligiuri G, Daemen MJ, Davies PF, Hoefer IE, Holvoet P, Jo H, Krams R, Lehoux S, Monaco C, Steffens S, Virmani R, Weber C, Wentzel JJ, et al. Biomechanical factors in atherosclerosis: mechanisms and clinical implications. Eur Heart J. 2014; 35(43):3013-‐3020, 3020a-‐3020d.
2. Davies PF, Civelek M, Fang Y and Fleming I. The atherosusceptible
Atherosclerosis at arterial bifurcations: evidence for the role of haemodynamics and geometry. Thromb Haemost. 2016; 115(3):484-‐492.
5. Bryan MT, Duckles H, Feng S, Hsiao ST, Kim HR, Serbanovic-‐Canic J and Evans PC. Mechanoresponsive networks controlling vascular inflammation.
Arterioscler Thromb Vasc Biol. 2014; 34(10):2199-‐2205.
6. Tabas I, Garcia-‐Cardena G and Owens GK. Recent insights into the cellular biology of atherosclerosis. J Cell Biol. 2015; 209(1):13-‐22.
7. Nayak L, Lin Z and Jain MK. "Go with the flow": how Kruppel-‐like factor 2 regulates the vasoprotective effects of shear stress. Antioxid Redox Signal. 2011;
15(5):1449-‐1461.
8. Boon RA and Horrevoets AJ. Key transcriptional regulators of the vasoprotective effects of shear stress. Hamostaseologie. 2009; 29(1):39-‐40, 41-‐
33.
9. SenBanerjee S, Lin Z, Atkins GB, Greif DM, Rao RM, Kumar A, Feinberg MW, Chen Z, Simon DI, Luscinskas FW, Michel TM, Gimbrone MA, Jr., Garcia-‐
Cardena G and Jain MK. KLF2 Is a novel transcriptional regulator of endothelial proinflammatory activation. J Exp Med. 2004; 199(10):1305-‐1315.
10. Huang TY, Chu TF, Chen HI and Jen CJ. Heterogeneity of [Ca(2+)](i) signaling in intact rat aortic endothelium. FASEB J. 2000; 14(5):797-‐804.
11. Molica F, Meens MJ, Morel S and Kwak BR. Mutations in cardiovascular connexin genes. Biol Cell. 2014; 106(9):269-‐293.
12. Bai D, Yue B and Aoyama H. Crucial motifs and residues in the extracellular loops influence the formation and specificity of connexin docking.
Biochim Biophys Acta. 2017.
Cardiol. 2012; 53(2):299-‐309.
18. Denis J-‐F, Scheckenbach L, Pfenniger A, Meens M, Krams R, Miquerol L, Taffet S, Chanson M, Delmar M and Kwak B. Connexin40 controls endothelial activation by dampening NFkB activation. Oncotarget. 2017.
19. Chadjichristos CE, Scheckenbach KE, van Veen TA, Richani Sarieddine MZ, de Wit C, Yang Z, Roth I, Bacchetta M, Viswambharan H, Foglia B, Dudez T, van Kempen MJ, Coenjaerts FE, Miquerol L, Deutsch U, Jongsma HJ, et al. Endothelial-‐
specific deletion of connexin40 promotes atherosclerosis by increasing CD73-‐
dependent leukocyte adhesion. Circulation. 2010; 121(1):123-‐131.
20. Vorderwulbecke BJ, Maroski J, Fiedorowicz K, Da Silva-‐Azevedo L, Marki comparing genomic features. Bioinformatics. 2010; 26(6):841-‐842.
24. Robinson MD, McCarthy DJ and Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data.
Bioinformatics. 2010; 26(1):139-‐140.
25. Team RDC. (2008). R: A Language and Environment for Statistical Computing. (Vienna, Austria: R Foundation for Statistical Computing).
26. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, et al. PGC-‐1alpha-‐responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes.
Nat Genet. 2003; 34(3):267-‐273.
27. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES and Mesirov JP. Gene set enrichment analysis: a knowledge-‐based approach for interpreting genome-‐wide expression profiles. Proc Natl Acad Sci U S A. 2005; 102(43):15545-‐15550.
Chanson M, Goodenough DA and Kwak BR. Connexin37 protects against flow-‐dependent regulation of gene expression. Circ Res. 2003; 93(2):155-‐161.
38. Illi B, Scopece A, Nanni S, Farsetti A, Morgante L, Biglioli P, Capogrossi MC to Flow in Vascular Dysfunction and Atherosclerosis. Circ Res. 2016; 119(3):450-‐
462.
44. Levesque MJ, Nerem RM and Sprague EA. Vascular endothelial cell proliferation in culture and the influence of flow. Biomaterials. 1990; 11(9):702-‐
707.
45. Akimoto S, Mitsumata M, Sasaguri T and Yoshida Y. Laminar shear stress inhibits vascular endothelial cell proliferation by inducing cyclin-‐dependent kinase inhibitor p21(Sdi1/Cip1/Waf1). Circ Res. 2000; 86(2):185-‐190.
necessary for growth suppression by Cx37. J Cell Sci. 2011; 124(Pt 14):2448-‐ and chemotherapy. Biochim Biophys Acta. 2005; 1719(1-‐2):146-‐160.
49. Kardami E, Dang X, Iacobas DA, Nickel BE, Jeyaraman M, Srisakuldee W, Makazan J, Tanguy S and Spray DC. The role of connexins in controlling cell growth and gene expression. Prog Biophys Mol Biol. 2007; 94(1-‐2):245-‐264.
50. Kapovic M and Rukavina D. Kinetics of lymphoproliferative responses of lymphocytes harvested from the uterine draining lymph nodes during pregnancy in rats. J Reprod Immunol. 1991; 20(1):93-‐101. endothelial cells. Arterioscler Thromb Vasc Biol. 2010; 30(4):827-‐834.
54. Fang JS, Angelov SN, Simon AM and Burt JM. Cx40 is required for, and Nardelli-‐Haefliger D and Haefliger JA. Targeting endothelial connexin40 inhibits tumor growth by reducing angiogenesis and improving vessel perfusion. vascular endothelium. Hypertension. 2013; 61(3):615-‐621.
Table 1: Primer sequences potentially recognizing KLF4 sites in the Cx40 and FSP1 promoter region
Gene
promoter Location
to TSS Forward Reverse
-‐2477 bp AGCTTCTTTGCAGTGCCATT TGCCATGCTCTCTCCTTCTT
-‐2599 bp CCATCTCACCAGCCCTAAAG TGGGCACACTTCACAATGTT
-‐4196 bp TCTCAACCAGCAGAAACGTG ATGGCAACACGTGCAAGTAA
FSP1 +700 bp GCAGGCATTCGTGTTTGTAG AAAAACCCCAGCTGCCTAAT
ENSMUSG00000024210 Ip6k3 -‐1.57 1.46E-‐07 8.59E-‐01
Gene_id Gene_name logFC PValue logCPM
ENSMUSG00000041193 Pla2g5 -‐1.63 8.99E-‐20 1.72
ENSMUSG00000053626 Tll1 1.66 4.88E-‐135 7.21
Pathway_1065 Cell adhesion molecules (CAMs)
(Ref=mmusculus_KEGG) 1.67 9.71E-‐03
Pathway_1147 Morphine addiction (Ref=mmusculus_KEGG) 1.62 8.05E-‐03 Pathway_948
Pathway_1119 Renin secretion (Ref=mmusculus_KEGG) 1.55 2.81E-‐02 Pathway_1196 Allograft rejection (Ref=mmusculus_KEGG) 1.53 4.13E-‐02 Pathway_1046 Peroxisome (Ref=mmusculus_KEGG) 1.51 3.53E-‐02 Pathway_1041 Regulation of autophagy
(Ref=mmusculus_KEGG) 1.51 3.56E-‐02
Pathway_1043 Lysosome (Ref=mmusculus_KEGG) 1.46 1.14E-‐02 Pathway_719 Calcium Regulation in the Cardiac Cell
(Ref=rnorvegicus) 1.42 3.93E-‐02
Pathway_1053 Vascular smooth muscle contraction
(Ref=mmusculus_KEGG) 1.39 4.49E-‐02
Table 9: Down-‐regulated Pathways siNT HLSS vs siCx40 HLSS, i.e. enriched in siCx40 HLSS
internal_ID Pathway_name NES FDR
Pathway_505 DNA Replication (Ref=mmusculus) -‐2.46 0.00 Pathway_775 DNA Replication (Ref=rnorvegicus) -‐2.38 0.00 Pathway_1009 DNA replication (Ref=mmusculus_KEGG) -‐2.33 0.00 Pathway_1016 Mismatch repair (Ref=mmusculus_KEGG) -‐2.15 0.00 Pathway_1004 RNA transport (Ref=mmusculus_KEGG) -‐2.08 0.00 Pathway_927 Pyrimidine metabolism
(Ref=mmusculus_KEGG) -‐2.03 0.00
Pathway_1010 Spliceosome (Ref=mmusculus_KEGG) -‐1.95 0.00 Pathway_1015 Nucleotide excision repair Pathway_502 Retinol metabolism (Ref=mmusculus) -‐1.83 1.97E-‐03 Pathway_1035 Cell cycle (Ref=mmusculus_KEGG) -‐1.80 0.00 Pathway_624 Homologous recombination (Ref=mmusculus) -‐1.77 6.36E-‐03 Pathway_740 G1 to S cell cycle control (Ref=rnorvegicus) -‐1.77 2.10E-‐03 Pathway_1002 Ribosome biogenesis in eukaryotes
(Ref=mmusculus_KEGG) -‐1.75 0.00
Pathway_779 Homologous recombination (Ref=rnorvegicus) -‐1.74 6.10E-‐03 Pathway_535 Hypertrophy Model (Ref=mmusculus) -‐1.73 2.05E-‐03 Pathway_720 Cell cycle (Ref=rnorvegicus) -‐1.73 1.94E-‐03 Pathway_767 Hypertrophy Model (Ref=rnorvegicus) -‐1.72 1.24E-‐02 Pathway_633 Nucleotide Metabolism (Ref=mmusculus) -‐1.70 1.60E-‐02 Pathway_675 Retinol metabolism (Ref=rnorvegicus) -‐1.68 1.41E-‐02 Pathway_1175 Colorectal cancer (Ref=mmusculus_KEGG) -‐1.64 8.28E-‐03 Pathway_513 ErbB signaling pathway (Ref=mmusculus) -‐1.60 2.37E-‐02 Pathway_1003 Ribosome (Ref=mmusculus_KEGG) -‐1.59 4.50E-‐03 Pathway_727 TGF Beta Signaling Pathway (Ref=rnorvegicus) -‐1.58 1.71E-‐02 Pathway_702 ErbB signaling pathway (Ref=rnorvegicus) -‐1.58 1.81E-‐02 Pathway_787 Adipogenesis (Ref=rnorvegicus) -‐1.55 1.32E-‐02 Pathway_713 Translation Factors (Ref=rnorvegicus) -‐1.55 2.03E-‐02 Pathway_506 TGF Beta Signaling Pathway (Ref=mmusculus) -‐1.51 2.86E-‐02 Pathway_736 Nucleotide Metabolism (Ref=rnorvegicus) -‐1.51 4.81E-‐02 Pathway_975 One carbon pool by folate
(Ref=mmusculus_KEGG) -‐1.51 4.89E-‐02
Pathway_937 Tyrosine metabolism (Ref=mmusculus_KEGG) -‐1.50 4.92E-‐02 Pathway_574 Adipogenesis genes (Ref=mmusculus) -‐1.50 1.04E-‐02 Pathway_689 Spinal Cord Injury (Ref=rnorvegicus) -‐1.48 2.56E-‐02 Pathway_995 Biosynthesis of antibiotics
(Ref=mmusculus_KEGG) -‐1.48 4.31E-‐03
Pathway_1064 ECM-‐receptor interaction -‐1.47 3.87E-‐02
Pathway_1019 (Ref=mmusculus_KEGG) -‐1.46 2.72E-‐02 Pathway_579 Translation Factors (Ref=mmusculus) -‐1.45 4.97E-‐02 Pathway_1061
Osteoclast differentiation
(Ref=mmusculus_KEGG) -‐1.44 2.08E-‐02
Pathway_1141 Parkinson's disease (Ref=mmusculus_KEGG) -‐1.43 3.63E-‐02 Pathway_1123 Non-‐alcoholic fatty liver disease (NAFLD)
(Ref=mmusculus_KEGG) -‐1.40 1.03E-‐02
Pathway_461 Cytoplasmic Ribosomal Proteins
(Ref=mmusculus) -‐1.39 3.22E-‐02
Pathway_756 mRNA processing (Ref=rnorvegicus) -‐1.39 3.48E-‐02 Pathway_1166 HTLV-‐I infection (Ref=mmusculus_KEGG) -‐1.39 4.18E-‐03 Pathway_1085 TNF signaling pathway (Ref=mmusculus_KEGG) -‐1.37 4.62E-‐02 Pathway_1187 Small cell lung cancer (Ref=mmusculus_KEGG) -‐1.35 4.61E-‐02 Pathway_1143 Huntington's disease (Ref=mmusculus_KEGG) -‐1.35 2.76E-‐02
Table 10: CACCC and FSP1 Primer sequences ChIP
Gene promotor
Location to TSS
# Forward Reverse
Cx40
+78 bp 1 AACTCCAGGGAGGAGGAAAG GGGTAGGGAGTCCCCTCATA
+1229 bp 2 GGGGGTAGGGTGTCTTTCTC CCTCCCACTTCTTCCTCCTC
+1391 bp 3 TGGGCAGGAAGCATCTTAAC TCTGGGAACAAAGGGTATCG
+3031 bp 4 CGATACCCTTTGTTCCCAGA GCCAGCTATGGGTTACAAGC
-‐108 bp 5 ACCAACTTGGGACTGTCAGG AAGGAGGCTTTTTCCAGCTC
-‐1106 bp 6 GTGGAACAAGAGGCAGACCT ATGCCAGCTGAGGAAGAGAA
-‐2477 bp 7 AGCTTCTTTGCAGTGCCATT TGCCATGCTCTCTCCTTCTT
-‐2599 bp 8 CCATCTCACCAGCCCTAAAG TGGGCACACTTCACAATGTT
-‐4196 bp 9 TCTCAACCAGCAGAAACGTG ATGGCAACACGTGCAAGTAA
-‐7095 bp 10 AGGGCAGGAAAACCGTAGTT GCCTCTTCTGGTTTTCTCCA
FSP1 +700 bp 1 GCAGGCATTCGTGTTTGTAG AAAAACCCCAGCTGCCTAAT
Figure 1: Expression of Cx40 is regulated by shear stress. (A) Representative immunofluorescent images of Cx40, Cx37 and Cx43 expression (green) in highly confluent bEnd.3 cultures. Cx40 and Cx37 are highly expressed but Cx43 is absent. Nuclei were stained with DAPI (blue) (B) Cx40 expression in bEnd.3 cells exposed to STATIC, LLSS and HLSS conditions for 24 hours was assessed by qPCR. Cx40 is highly expressed under LLSS and HLSS. N=3. (C) KLF4 expression in bEnd.3 cells exposed to STATIC, LLSS and HLSS conditions for 24 hours was assessed by qPCR. KLF4 increases gradually under increasing shear stress conditions. N=3. (D) Representative immunofluorescent images of Cx40 expression (green) in bEnd.3 cells exposed to STATIC, LLSS and HLSS for 24 hours. Shear stress gradually induces Cx40 expression. Arrow indicates the direction of the flow. Nuclei were stained with DAPI (blue). Scale bar represents 10µm.
Figure 2: In vitro silencing of KLF4 reduces Cx40 expression. (A) KLF4 and (B) Cx40 expression in highly confluent bEnd.3 cells exposed to NT siRNA or KLF4 siRNA was assessed by qPCR. N=3. KLF4 siRNA effectively reduces KLF4 and Cx40 expression in static cultures (C) Experimental protocol of KLF4 silencing in bEnd.3 cells under HLSS. (D, E, F, G, H) qPCR for Cx40, KLF4, Cx37, KLF2 and Cx43 expression, respectively, in bEnd.3 cells transfected with KLF4 siRNA or NT siRNA and subsequently exposed to 48 hours of HLSS. Data were normalized to the NT siRNA -‐ static condition. N=6. Effective KLF4 silencing (E) impairs flow-‐dependent induction of Cx40 (D), but not of Cx37 (F) or KLF2 (G).
representation of the promoter region of Cx40 indicating (in bp) the position of 3 KLF CACCC-‐consensus binding sites. (B) Representative Western blot for KLF4 and Cx40 (top) and GAPDH (loading control, bottom) of bEnd.3 cells treated (lane 2) or not (lane 1) with 5µM simvastatin. Exposure to simvastatin increases KLF4 and Cx40 expression in ECs. (C) ChIP of histone H3 interaction with the RPL50 sequence in bEnd.3 cells in control condition (left) or after treatment with 5µM simvastatin (right) compared to control ChIP. (D) ChIP of KLF4 interaction with the FSP1 promoter in bEnd.3 cells in control condition (left) or after treatment with 5µM simvastatin (right) compared to control ChIP. (E, F) ChIP of KLF4 interactions with the Cx40 promoter in bEnd.3 cells in control condition (E) or after treatment with 5µM simvastatin (F). Analyzed KLF4 binding sites are indicated in bp. Levels of DNA are normalized to input. Results of a representative experiment out of two is shown.
Figure 4: Cx40-‐dependent shear stress induced differential gene expression. (A) Multi-‐Dimensional Scaling (MDS) plot representing the similarity of the samples. Dots in same color represent samples of each condition. (B, C, D, F) Vulcano plots showing relationship between degree of gene expression change [log2 of fold-‐change; x-‐axis] and statistical significance of this change [-‐log10 of p-‐value; y-‐axis]. Colored dots represent differentially expressed genes (cut-‐off p-‐value<0,01) with fold change >2 that are down-‐
regulated (red) or up-‐regulated (blue). (B, C) Differential gene expression in bEnd.3 cells exposed to HLSS (B) and OSS (C) after treatment with siNT or Cx40
HLSS without (D) or with (F) effective Cx40 silencing. (E, G) Pie chart representation for differentially expressed genes organized for 7 atherosclerosis-‐related processes. (E) Differential expressed genes between control cells exposed to OSS and HLSS. (G) Differential expressed genes between Cx40 siRNA treated cells exposed to OSS and HLSS. The inflammation genes increased by 12% and genes involved in endothelial permeability disappeared after silencing of Cx40. (H) Venn diagram representing gene overlap in OSS (as compared to HLSS) with or without Cx40 silencing. Highlighted are 47 genes that are commonly down-‐regulated and 4 genes that are commonly up-‐regulated.
Figure 5: Cx40 controls EC proliferation. (A) NES vs. FDR representing GSEA differentially expressed pathways in bEnd.3 cells exposed to HLSS with or without silencing of Cx40. Colored dots represent differentially regulated pathways (FDR<0.05) with NES>1 that are down-‐regulated (red) or up-‐regulated (blue). (B) Cx40 expression in bEnd.3 cells exposed to NT or Cx40 siRNA assessed by qPCR after applying 24 hours of HLSS. N=4. (C) Representative immunofluorescent images of PCNA expression (green) in bEnd.3 cells exposed to HLSS silenced for Cx40 (siCx40) or not (siNT). Silencing of Cx40 increases PCNA positive cells. Nuclei were stained with DAPI (blue). Scale bar represents 50 µm (D) Quantification of (C). N=4. (E) Stained DNA content with Hoechst 33342 was measured by flow cytometry and Cell cycle distribution (G0/G1, S, G2) analyzed by FACS after Hoechst staining revealed a 9% decrease of cells in G0/G1 phase after effective Cx40 silencing (B). N=4.
Denis JF1, Linnerz T1, Watanabe M2, Bertrand JY1, Kwak BR1,2
1Department of Pathology and Immunology and 2Department of Medical Specializations -‐ Cardiology, University of Geneva, Geneva, Switzerland
2Graduate School of Frontier Biosciences, Osaka University, 1-‐3 Yamadaoka, Osaka 565-‐0871, Japan
Keywords: Cx41.8 – Cx45.6 – Cx40 – zebrafish – endothelium
Manuscript contains: 3 Figures and 6 tables
Corresponding author:
Brenda R. Kwak, PhD
Department of Pathology and Immunology, University of Geneva,
CMU -‐ Rue Michel-‐Servet 1 1211 Geneva/Switzerland Phone: +41 22 379 57 37 Fax: +41 22 379 57 40
Email: Brenda.KwakChanson@unige.ch
Contribution of Jean-François Denis.
Figure 1: - RNA extraction, primer optimization and qPCR (B, C).
Figure 2: - Optimizations and whole-mount in situ hybridization (A, B, C, D, Figure 3: E). - Design of all primers, optimization, PCR, agarose gel
electrophoresis and sequencing analysis (A, B, C, D, E).
Experiments, redaction, layout, figures and tables, bibliography were performed under supervision of prof. Brenda R. Kwak. For experiments on zebrafish the advices and help of prof. Julien Bertrand and his group were greatly appreciated.
Zebrafish and human share a high similarity in their lipid and lipoprotein metabolism. Indeed, feeding zebrafish with HCD resulted in hypercholesterolemia, robust lipoprotein oxidation and lipid accumulation in the vasculature. In addition, two zebrafish connexins, i.e. Cx41.8 and Cx45.6, have been identified as orthologues of mammalian Cx40. Here, we were able to detect these two connexins in endothelial cells of the zebrafish vasculature.
Furthermore, protocol optimization for genotyping and maintenance of the zebrafish lines mutated for Cx41.8 and Cx45.6 are now routinely performed in the lab.
Rodent models are widely used to uncover causes of dyslipidemia and elucidate mechanisms of diseases linked to altered lipid metabolism [1, 2]. Zebrafish models have only been introduced recently; they are used to study
Rodent models are widely used to uncover causes of dyslipidemia and elucidate mechanisms of diseases linked to altered lipid metabolism [1, 2]. Zebrafish models have only been introduced recently; they are used to study