Connexin40 controls endothelial activation by dampening NFκB activation
GRANT SUPPORT
4.4. Concluding remarks
Compared to mice, the optical transparency of zebrafish embryos and larvae, the availability of effective tools for genetic manipulation, the relatively small generation time, large clutch size at every crossing and easy access to all developmental stages make zebrafish an ideal tool for investigating endothelium dysfunction and early atherogenesis.
Connexins include 20 members in mice and 21 in humans [25]. In zebrafish, around 36 different connexins are predicted to exist [18]. This gene number may be due to a genome duplication event in fish evolution [26]. With respect to the subject of my thesis, two zebrafish connexins, Cx41.8 (gja5b gene) and Cx45.6 (gja5a gene), have been identified as orthologues of mammalian Cx40 [18].
Cx41.8 was found to be involved in the stripe pattern formation in zebrafish [19, 27]. Indeed, mutations inside the Cx41.8 gene (known as leopard), leot1, leotq270 and leotw28 have been associated with spot pattern in zebrafish [19]. Cx45.6 mRNA is primarily expressed in zebrafish adult heart, and low levels were
specifically detected in ECs from adult zebrafish (Figure 1B-‐C). Furthermore, using WISH we were able to detect Cx41.8 mRNA in the heart of 48hpf zebrafish larvae. In addition, Cx45.6 mRNA was detected using WISH in the major vasculature of zebrafish larvae confirming the data of Christies et al. [20].
All genotyping and maintenance of the zebrafish lines are now routinely performed in the lab. This opens new perspectives for future investigations of the role of Cx40 in atherogenesis using the zebrafish model. To further investigate the role of Cx40 orthologues in zebrafish ECs we will use the leot1, leotq270 and leot1 Cx45.6-‐/-‐ mutants. It was originally expected that the leot1 and leotq270 would have the same phenotype [19]. In fact, the leotq270 appeared to have a more severe phenotype in terms of spotted skin pattern. The authors postulated that this more severe phenotype could be explained by the formation of heterotypic gap junction channels composed of Cx43, Cx45.6 and Cx41.8tq270 [19]. Indeed, Cx26 and Cx32 have been found to form heterohexamer connexons with different signaling molecule selectivity compared to homohexamer connexons of Cx26 or Cx32 [28]. In addition, it was found that the voltage sensitivity of Cx41.8 was similar to Cx45.6 [20]. This suggests a similar role for Cx45.6 in zebrafish spot pattern formation. The Cx41.8t1/t1 mutation phenotype might be less severe due to compensatory mechanisms of other connexins. In contrast, the mutation Cx41.8tq270/tq270 where the connexin is expressed but with decreased channel function no compensatory mechanism may be active, resulting in a more severe phenotype. This suggests the involvement of direct or
of great interest concerning further experimentation in zebrafish ECs compartmentalization.
Interestingly, the Cx41.8t1/t1 phenotype was rescued by introducing the rat Cx40 [29], indicating that the functional activities of Cx40 are well conserved between the two species. Furthermore, the residues E9 and E13 located in the amino terminal domain of the rat Cx40 that are conserved in the zebrafish Cx41.8 are predicted to be residues that are sensitive to polyamine and affecting channel permeability [29, 30]. Indeed, when mutating the rat Cx40 polyamine sensitive residues the mutant did not rescue the leopard phenotype. Knowing that the N-‐
terminal sequence of the connexins related to Cx41.8 (Cx40) is well conserved between species, we suggest an important role for the ExxxE motif in the functional activity of connexins. In line, this mechanism could be of interest in the physiology of ECs.
1. Getz GS and Reardon CA. Animal models of atherosclerosis. Arterioscler
Vascular lipid accumulation, lipoprotein oxidation, and macrophage lipid uptake in hypercholesterolemic zebrafish. Circ Res. 2009; 104(8):952-‐960.
7. Clifton JD, Lucumi E, Myers MC, Napper A, Hama K, Farber SA, Smith AB,
atherosclerosis and angiogenesis. Transl Res. 2014; 163(2):99-‐108. lineage-‐specific duplications and highly supported gene classes. Genomics. 2006;
87(2):265-‐274. cardiovascular connexin. Am J Physiol Heart Circ Physiol. 2004; 286(5):H1623-‐
1632. mutant embryos. Development. 1993; 119(4):1203-‐1215.
24. Jin SW, Beis D, Mitchell T, Chen JN and Stainier DY. Cellular and molecular of vertebrate chromosomes. Genome Res. 2000; 10(12):1890-‐1902.
27. Maderspacher F and Nusslein-‐Volhard C. Formation of the adult pigment
Table 1: Genotyping primers
Primer Forward Reverse
Cx41.8 TQ TGCTGCAAACATACGTCCTC TTTGCAGAGTTCTGCTGGTG
Cx41.8 T1 AGATCAGAGAAGGTGTAGAC AGGTTAATTGGGCAAATTAGG
Cx45.6 GGTGAGGAGTATGGGGGACT AGGGTGTCGATACGAAGACG
DyNAzyme II DNA polymerase (ThermoScientific) 0.62
25mM MgCl2 (Roche) 3
Primer Forward Reverse
Cx41.8 ACCGAGGTTGAATGCTCC TGGTTTCAATCAGGCTCC
Cx45.6 CTAAGCCTGCGCTTGTCTCT GGCTCGGGTTCGAAGTGAAA
Ef1α GGTAGTATTTGCTGGTCTCG GAGAAGTTCGAGAAGGAAGC
Table 6: In situ probe primers
Primer Forward Reverse
Cx41.8 GATCCGCCTGGTCATGGAAG AAGGCTTCCAGCTTCTTTTCCT
Cx45.6 TGTTACGACCGAGCCTTTCC AAGGTGAGGCACAGGAGTTG
Figure 1: Cx41.8 and Cx45.6 are expressed in zebrafish endothelial cells.
(A) Experimental protocol of tail eGFP+ ECs sorting. (B, C) Cx41.8 and Cx45.6 expression in eGFP+ cells was assessed by qPCR. (B) Cx41.8 is expressed in zebrafish ECs. (C) Cx45.6 is expressed in zebrafish ECs.
Figure 2: Whole mount in situ hybridization analysis: embryonic expression of Cx41.8 and Cx45.6. (A) Agarose gel electrophoresis of transfected MACH1 bacteria containing the TOPO-‐TA vector with Cx41.8 and Cx45.6 inserts. (B) DNA sequence blasting of wild type Cx41.8 and Cx45.6 against the sequences inserted in TOPO-‐TA vector. (C) Purified Cx41.8 and Cx45.6 WISH probes. (D, E) WISH detection of Cx41.8 and Cx45.6 in 48 hpf zebrafish. (D) Cx41.8 mRNA is detected in the heart. (E) Cx45.6 is detected in the heart, lateral dorsal aorta (LDA), dorsal midline junction (DMJ) and pectoral fin buds (PFB). Scale bar represents 100 µm
Figure 3: mutant zebrafish genotyping. (A) 5 day flk1:eGFP zebrafish. Scale bar represents 500 µm (B) Agarose gel electrophoresis for zebrafish Cx45.6 (C) BsrD10 restriction digestion of Cx45.6 fragment. The Cx45.6-‐/-‐ fragment is not digested due to absence of BsrD10 restriction site (lane 1 & 2). In Cx45.6+/-‐ only one DNA strand is digested resulting in 2 bands (lane 3,4 &5). Cx45.6+/+ is digested due to presence of BsrD10 restriction site on both DNA strands (lane 6) (D) Genotyped DNA sequences of Cx41.8t1/t1 introducing a C>T change resulting in a TGA stop codon (E) Genotyped DNA sequences of Cx41.8tq270/tq270
(phenylalanine).
The focus of this thesis was to investigate the regulation and function of Cx40 in healthy and diseased vascular endothelium. The 3 main connexins expressed in the arterial ECs are Cx37, Cx40 and Cx43 and the expression levels and distribution pattern varies with disease state [1]. From studies on knockout mice, it has become increasingly clear that these proteins play a crucial role in vascular physiology and disease. Indeed, it is generally accepted that Cx37 and Cx40 are atheroprotective and Cx43 is atheroprone in ECs of large arteries [2].
Cx37 affects the atherogenesis through an ATP-‐dependent regulation of monocyte adhesion and it also regulates platelet aggregation [3]. Furthermore, binding of eNOS to Cx37 modulates not only its channel function but also eNOS enzyme activity, linking Cx37 to endothelial physiology [4]. Cx43 was shown to affect plaque stability through VSMC migration and proliferation [5].
Furthermore, Cx43 expression levels in macrophages might determine their secretion of chemo-‐attractants [6]. Finally, Cx40 was found to enhance the CD73-‐
dependent anti-‐inflammatory pathway in ECs [7]. In addition, Cx40 in human platelets was linked to platelet aggregation and clot retraction [8].
The expression of these 3 connexins is differently regulated in ECs by arterial shear stress patterns. Cx43 is highly expressed in aortic ECs localized downstream of ostia of branching vessels, at bifurcations and in curved arteries exposed to low and/or disturbed blood flow [9]. In contrast, Cx37 is highly expressed in ECs of straight regions of the common carotid artery exposed to HLSS but its expression is lost at arterial bifurcations [10]. Although various
The aim of this thesis was to investigate the shear stress dependent regulation of endothelial Cx40 expression in ECs, identify its potential protein partners within the context of atherosclerosis, and recognize downstream effects of the induction of endothelial Cx40 by HLSS. In Chapter 1 we describe the expression pattern of Cx40 in relation to shear stress and its gap junction-‐mediated intracellular communication (GJIC) independent functions. Chapter 2 focuses on the shear stress-‐dependent regulation of Cx40 and downstream consequences of HLSS-‐
induces Cx40 expression. Finally, Chapter 3 describes the set-‐up of a new zebrafish model, which might be of help to investigate the role of Cx40 in relation to early atherogenesis.