The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated by Phosphorylation

HAL Id: hal-02282907

https://hal.archives-ouvertes.fr/hal-02282907

Submitted on 27 May 2021

HAL is a multi-disciplinary open access

archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Distributed under a Creative Commons Attribution| 4.0 International License

tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated by Phosphorylation

Virginie Molle, Alistair Brown, Gurdyal Besra, Alain Cozzone, Laurent Kremer

To cite this version:

Virginie Molle, Alistair Brown, Gurdyal Besra, Alain Cozzone, Laurent Kremer. The Condensing

Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regu-

lated by Phosphorylation. Journal of Biological Chemistry, American Society for Biochemistry and

Molecular Biology, 2006, 281 (40), pp.30094-30103. �10.1074/jbc.M601691200�. �hal-02282907�

The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated

by Phosphorylation ^*

Received for publication, February 22, 2006, and in revised form, July 5, 2006Published, JBC Papers in Press, July 27, 2006, DOI 10.1074/jbc.M601691200

Virginie Molle^‡, Alistair K. Brown^§, Gurdyal S. Besra^§1, Alain J. Cozzone^‡, and Laurent Kremer^¶2

From the^‡Institut de Biologie et Chimie des Prote´ines (IBCP UMR 5086), CNRS, Universite´ Lyon1, IFR128 BioSciences, Lyon-Gerland, 7 Passage du Vercors, 69367 Lyon Cedex 07, France, the^§School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdom, and the^¶Laboratoire de Dynamique Mole´culaire des Interactions Membranaires,

CNRS UMR 5539, Universite´ de Montpellier II, case 107, Place Euge`ne Bataillon, 34095 Montpellier Cedex 05, France

Phosphorylation of proteins by Ser/Thr protein kinases (STPKs) has recently become of major physiological importance because of its possible involvement in virulence of bacterial pathogens. Although Mycobacterium tuberculosis has eleven STPKs, the nature and function of the substrates of these enzymes remain largely unknown. In this work, we have identi- fied for the first time STPK substrates in M. tuberculosis form- ing part of the type II fatty acid synthase (FAS-II) system involved in mycolic acid biosynthesis: the malonyl-CoA::AcpM transacylase mtFabD, and the␤-ketoacyl AcpM synthases KasA and KasB. All three enzymes were phosphorylated in vitro by different kinases, suggesting a complex network of interactions between STPKs and these substrates. In addition, both KasA and KasB were efficiently phosphorylated in M. bovis BCG each at different sites and could be dephosphorylated by the M. tuberculosis Ser/Thr phosphatase PstP. Enzymatic studies revealed that, whereas phosphorylation decreases the activity of KasA in the elongation process of long chain fatty acids synthesis, this modification enhances that of KasB. Such a differential effect of phosphorylation may represent an unusual mechanism of FAS-II system regulation, allowing pathogenic mycobacteria to produce full-length mycolates, which are required for adaptation and intracellular survival in macrophages.

Mycobacterium tuberculosishas a unique cell wall structure that accounts for the ability of the bacterium to grow in several contrasting environments and which is responsible for its low membrane permeability, contributing to its resistance to com- mon chemotherapeutic agents (1). The cell wall has been impli- cated as a direct modulator of interactions between mycobac- teria and the environment (2). This envelope, characterized by its high lipid content, comprises an inner membrane barrier composed of mycolic acids anchored to arabinogalactan, linked to peptidoglycan. Mycolic acids are a hallmark of the mycobac-

terial waxy coat: they represent key virulence factors required for intracellular survival (3, 4) and contribute to the physiopa- thology of tuberculosis. They consist of very long chains of

␣-branched ␤-hydroxy fatty acids (C60-C₉₀), whose biosynthe- sis is controlled by two elongation systems, the eukaryotic-type fatty acid synthase (FAS-I)³and the prokaryotic-like FAS-II (5, 6). FAS-I consists of a single multifunctional polypeptide, cata- lyzing de novo synthesis of medium length acyl-CoA chains (C₁₆-C₂₆), whereas FAS-II comprises several distinct enzymes.

It catalyzes similar types of reactions to FAS-I, but functions on acyl carrier protein (AcpM)-bound chains and is incapable of de novosynthesis. The initial substrates of FAS-II are␤-ketoacyl- AcpM resulting from the condensation by mtFabH of the acyl- CoA products of FAS-I with malonyl-AcpM (7, 8). Following reduction by MabA, elimination of water by a yet unidentified dehydratase, and reduction by the enoyl-AcpM reductase InhA, the␤-ketoacyl-AcpM synthases KasA and KasB catalyze further condensations with malonyl-AcpM in the FAS-II cycle (9, 10). Although changes in the mycolic acid profile seem to be regulated by various environmental stimuli, such as those encountered within the infected macrophage, very little is known at a molecular basis about how pathogenic mycobacte- ria modulate mycolate composition in response to these changes. Whether regulation of FAS-II enzymes occurs at the transcriptional and/or the translational level is not known. Elu- cidation of mechanisms modulating mycolic acid biosynthesis would shed some light on the capacity of M. tuberculosis to adapt and survive within the infected host.

Reversible protein phosphorylation is a key mechanism by which environmental signals are transmitted to cause changes in protein expression or activity in both eukaryotes and prokaryotes. Genes encoding functional serine/threo- nine protein kinases (STPKs) are ubiquitous in prokaryotic genomes, but little is known regarding their physiological substrates and their participation in bacterial signal trans- duction pathways (11). Understanding prokaryotic kinase biology has been seriously hampered by the failure to iden- tify relevant kinase substrates. Signaling through Ser/Thr

*The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertise- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1A Lister-Jenner Research Fellow supported by a grant from the Medical Research Council (MRC).

2Supported by a grant from the CNRS (ATIP Microbiologie Fondamentale). To whom correspondence should be addressed. Tel.: 33-4-67-14-33-81; Fax:

33-4-67-14-42-86; E-mail: [email protected].

3The abbreviations used are: FAS-I, eukaryotic-type fatty acid synthase;

AcpM, mycobacterial acyl carrier protein; FAS-II, prokaryotic type II fatty acid synthase; FHA, forkhead-associated domain; STPK, Ser/Thr protein kinase; NTA, nitrilotriacetic acid; PVDF, polyvinylidene difluoride; IPTG, isopropyl-1-thio-␤-^D-galactopyranoside; GST, glutathione S-transferase.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 40, pp. 30094 –30103, October 6, 2006

© 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

30094 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 40 • OCTOBER 6, 2006 This is an Open Access article under the CC BY license.

phosphorylation has emerged as a critical regulatory mech- anism in various bacteria, including pathogenic mycobacte- ria. The genome of M. tuberculosis contains eleven coding regions with significant similarity to eukaryotic STPKs (11, 12). Nine of these gene products are predicted to be mem- brane proteins, presenting a sensor domain to the extracel- lular face and a kinase catalytic domain to the cytoplasm (11). All mycobacterial Ser/Thr kinases described to date display autophosphorylation activity, and several exogenous substrates have been reported to be phosphorylated by these enzymes (13–21). Our understanding of STPKs/substrate interactions in mycobacteria remains limited, because only a few endogenous substrates have been reported, most of them being recognized by virtue of being encoded by genes close to their cognate STPK genes (22–26).

A recent proteomic study with Corynebacterium glutami- cumrevealed that the vast majority of the phosphorylated pro- teins are metabolic enzymes rather than regulatory proteins, suggesting that protein phosphorylation plays a much broader function in the physiology of the bacteria than was previously expected (27). This observation, along with several pieces of data brought us to suspect that activity of the tightly intercon- nected FAS-II components (28) might depend on post-transla- tional modifications, such as phosphorylation. Therefore, as a first step toward the identification of regulatory mechanisms governing mycolic acid biosynthesis, we investigated whether metabolic FAS-II components from M. tuberculosis may repre- sent substrates of STPKs. In this study, we show for the first time that several FAS-II components, including KasA and KasB, are phosphorylated in vitro and in vivo by STPKs and provide evidence that phosphorylation differentially affects their condensing activity.

EXPERIMENTAL PROCEDURES

Bacterial Strains and Growth Conditions—Strains used for cloning and expression of recombinant proteins were Esche- richia coli DH5␣ (Clontech Laboratories), E. coli TOP-10 (Invitrogen), E. coli BL21(DE3)pLysS (Novagen) and E. coli strain C41(DE3) (29). All strains were grown and maintained in LB medium at 37 °C. When required, media were supple- mented with 100␮g/ml ampicillin, and/or 50 ␮g/ml chloram- phenicol, and/or kanamycin 25 ␮g/ml. M. bovis BCG strain Pasteur 1173P2 was grown on Middlebrokk 7H10 agar plates supplemented with OADC enrichment (Difco) or in Sauton medium.

Cloning, Expression, and Purification of the Eleven Recombi- nant GST-tagged STPKs of M. tuberculosis—PCR fragments encoding the intracellular region corresponding to the kinase core and the juxtamembrane linker of PknA (residues 1–338), PknB (residues 1–331), PknD (residues 1–378), PknE (residues 1–337), PknF (1–300), PknG (residues 1–360), PknH (residues 1–399), PknI (residues 1–351), PknJ (residues 1–340), PknK (residues 1–300), and PknL (residues 1–369) were amplified by using M. tuberculosis H37Rv genomic DNA as template. Site- directed mutagenesis based on PCR amplification was carried out for the cloning of PknG, PknI, and PknJ. This strategy, as already described by Molle et al. (22), consisted of creating sub- stitutions in the BamHI restriction site naturally present in those genes to create a mismatch in the specific restriction sequence without changing the coding sequence. Therefore, PknG, PknI, and PknJ could be digested and cloned as BamHI/

HindIII DNA fragments. DNA fragments corresponding to the 11 intracellular regions of the different kinases were amplified with their specific primers (Table 1), digested by BamHI and HindIII, and ligated into vector pGEX(M).

TABLE 1

Primers used in this study

Kinase Primer^a 5ⴕ to 3ⴕ sequence^b,c Primers pair

PknA-(1–338) 132 (⫹) TATGGATCCATGAGCCCCCGAGTTGGCGTGACGC 132/184

184 (⫺) TATAAGCTTCAACGCTGACCGGACGAAAACGTGCG

PknB-(1–331) 133 (⫹) TATGGATCCATGACCACCCCTTCCCACCTGTCCG 133/86

86 (⫺) TATAAGCTTCAACGGCCCACCGAACCGATGCTGCG

PknD-(1–378) 206 (⫹) TATGGATCCGTGAGCGATGCCGTTCCGCAG 206/207

207 (⫺) TATAAGCTTTTACCGTTTGTTGCCGGCCGGCGG

PknE-(1–337) 220 (⫹) TATGGATCCATGGATGGCACCGCGGAATCG 220/222

222 (⫺) TATAAGCTTTTACCAGGGCTGGCGGGCTGA

PknF-(1–300) 212 (⫹) TATGGATCCATGCCGCTCGCGGAAGGTTCGACGTTCGCCGGC 212/141

TTCACCATCGTCCGGCAGTTGGGGTCC 141 (⫺) TATAAGCTTTTACGGTTGCGACACCCGCGT

PknG-(1–360) 200 (⫹) TATGGATCCATGGCCAAAGCGTCAGAGACC PCR1⫽ 200/201

201 (⫺) GTAGCCGACCGGGTCCCCGTGCCT PCR2⫽ PCR1/273

273 (⫺) TATAAGCTTTTACAGCACCGGGTCGTCTTC

PknH-(1–399) 187 (⫹) TATGGATCCATGAGCGACGCACAGGAC 187/88

88 (⫺) TATAAGCTTGAGTTGGTTTTGCGCGGGGTCTG

PknI-(1–351) 198 (⫹) TATGGATCCATGGCGTTGGCCAGCGGCGTG PCR1⫽ 198/199

199 (⫺) GGCCAACAGAATCCGTTGGTC PCR2⫽ PCR1/211

211 (⫺) TATAAGCTTTTAGCGTGGCCGGCGCCTGGTGGG

PknJ-(1–340) 208 (⫹) GCGATGGCCAAGGACCCCATGCGT PCR1⫽ 209/210

210 (⫺) TATAAGCTTTTAGTAGCGGCGCGGTCGTCTCGG PCR2⫽ PCR1/209 209 (⫹) TATGGATCCGTGGCCCACGAGTTGAGT

PknK-(1–300) 274 (⫹) TATGGATCCATGACCGACGTTGATCCGCAC 274/275

275 (⫺) TATAAGCTTTTAGACGGGCAGGGGCATCTCGTC

PknL-(1–369) 196 (⫹) TATGGATCCGTGGTCGAAGCTGGCACG 196/197

197 (⫺) TATAAGCTTTTATCGACGGGCGTGCTGTCG

aForward and reverse primers are represented by plus (⫹) or minus (⫺), respectively.

bRestriction sites are italicized.

cThe bases mutated from those present in the wild type are underlined.

30095

Recombinant strains harboring the kinase-expressing con- structs were used to inoculate 100 ml of LB medium supple- mented with ampicillin and were incubated at 37 °C with shak- ing until A₆₀₀ reached 0.5. IPTG was then added at a final concentration of 1 mM, and growth was continued for an addi- tional 3 h at 37 °C, with shaking. Purification of the GST-tagged recombinant proteins was performed with glutathione-Sepha- rose 4B matrix (Amersham Biosciences), as already described (22).

Construction and Purification of His₆-tagged mtFabD, KasA, KasB, Holo-AcpM, and OmpATb—Plasmids designed to express mtFabD and KasA (pET28a-mtFabD and pET28a- kasA) were described earlier (10, 30). The kasB gene (Rv2246) was amplified by PCR using M. tuberculosis H37Rv genomic DNA as a template and the following primers: kasB-up 5⬘-GGG TAC CAC CAC TTG CGG GGG CGA GT-3⬘ and kasB-lo 5⬘-GGG GGC CAA GCT TGT CAT CGC AGG TCT-3⬘. This 1361-bp DNA fragment was directly ligated into the pET28a (Novagen), which had been cut with NdeI and filled-in with the Klenow enzyme, thus giving rise to pET28a-kasB. E. coli C41(DE3) cells transformed with pET28a-kasB were used to inoculate 100 ml of Terrific Broth medium supplemented with 25␮g/ml kanamycin. Cultures were incubated at 37 °C with shaking until A₆₀₀reached 1. IPTG was then added at a final concentration of 1 mM, and growth was continued over- night at 16 °C with shaking. Purification of recombinant mtFabD, KasA, KasB was performed as described earlier (30). Expression and purification of holo-AcpM and OmpATb was done as reported previously (30, 31).

Analysis of the Phosphoamino Acid Content of Proteins—

Phosphoamino acid analysis of the labeled protein reaction products of the in vitro protein kinase reactions were per- formed as previously described (32).

Overexpression and Purification of the M. tuberculosis KasA and KasB Proteins in M. bovis BCG—Standard PCR strategies were used to amplify the M. tuberculosis H37Rv kasA or kasB genes, using the following primers: pVV16-kasA-up 5⬘-TGA GTC AGC CTT CCA CCG CTA-3⬘ and pVV16-kasA-lo 5⬘-TTT AAG CTT GTA ACG CCC GAA GGC AAG CG-3⬘

(containing a HindIII site underlined), pVV16-kasB-up 5⬘-TGG GGG TCC CCC CGC TTG CGG-3⬘ and pVV16- kasB-lo 5⬘-TTT AAG CTT GTA CCG TCC GAA GGC GAT TGC-3⬘ (containing a HindIII site underlined). The PCR prod- ucts were cut with HindIII, enabling direct cloning into the pVV16 expression vector cut with MscI/HindIII (33). This plas- mid is a derivative of pMV261 (34), containing both a kanamy- cin and a hygromycin resistance cassette, harboring the hsp60 promoter as well as a His tag for expression of C-terminal His- tagged fusion proteins. The resulting expression vectors, named pVV16-kasA and pVV16-kasB, were used to transform M. bovisBCG. Transformants were selected on Middlebrook 7H10 supplemented with OADC enrichment and 25␮g/ml kanamycin and grown in Sauton containing kanamycin. Purifi- cation of soluble KasA-(His)₆and KasB-(His)₆was performed on Ni-NTA agarose beads as described previously (23).

Cloning, Overexpression, and Purification of PstP—The PCR fragment encoding the cytoplasmic region of the PstP phospha- tase (residues 1–298), containing the phosphatase catalytic

core, was amplified by using M. tuberculosis genomic DNA as a template. The 894-bp pstP gene fragment with appropriate sites at both ends was synthesized by PCR amplification with the following primers: 5⬘-TAT GGA TCC GTG GCG CGC GTG ACC CTG GTC-3⬘; and 5⬘-TAT AAG CTT TCA GCC CGA CCA CCG TGG CCG ACT-3⬘. This DNA fragment was digested with BamHI and HindIII, and ligated into vector pETAmp, digested with the same enzymes, to yield pETAmp- pstP-(1–298). E. coli BL21(DE3)pLysS cells were transformed with pETAmp-pstP-(1–298) and the recombinant E. coli strain was used to inoculate 100 ml of LB medium supplemented with ampicillin and chloramphenicol, and was incubated at 37 °C with shaking until A₆₀₀reached 0.5. IPTG was then added at a final concentration of 1 mM, and growth was continued for an additional 3-h period at 37 °C, with shaking. Recombinant His- tagged PstP-(1–298) protein was purified on Ni-NTA beads (Qiagen) as described previously (23).

Two-dimensional Gel Electrophoresis—To detect the differ- ent phosphorylated isoforms of proteins that were phosphoryl- ated in vitro, 5␮g of KasA, KasB, or mtFabD (purified from E. coliand phosphorylated in the presence of [␥-³³P]ATP and PknA) were electrophoresed on immobilized 7-cm pH 5– 8 gra- dient strips on a Protean IEF Cell (Bio-Rad) in the first dimen- sion and on a 10% SDS-PAGE in the second dimension. The Coomassie Blue-stained gels were dried onto filter paper (Whatman), and radioactivity was revealed by autoradiogra- phy. For in vivo detection, wild-type M. bovis BCG was grown to early stationary phase. Cells were harvested, washed twice with 20 mMTris-HCl, pH 7.5, and resuspended in lysis buffer (20 mMTris-HCl pH 7.5, 10% glycerol, antiprotease mixture, Roche Applied Science), followed by sonication. The lysate was cleared by centrifugation at 14,000 rpm for 30 min at 4 °C.

Approximately 150␮g of total soluble proteins were loaded onto a 7-cm immobiline strip (Bio-Rad, pH 3– 6) and electro- phoresed in a Protean IEF Cell in the first dimension and on a 10% SDS-PAGE in the second dimension.

Immunoblotting—Two-dimensional gels of M. bovis BCG total soluble proteins were blotted on PVDF membrane, and probed with a rat anti-KasA antibody raised against the M. tu- berculosisKasA protein, which also strongly cross-reacts with KasB (1:1000 dilution) (35). Horseradish peroxidase-conju- gated anti-rat serum was used as a secondary antibody (1:5000 dilution), and detection was carried out using the Western Lightening Reagent (PerkinElmer Life Sciences) according to the manufacturer’s instructions. For immunoblotting of puri- fied KasA and KasB proteins from E. coli or M. bovis BCG resolved on 1D PAGE, 2␮g were loaded on a 10% polyacrylam- ide gel, electrophoresed, blotted on PVDF, and detected using either polyclonal rabbit anti-phosphothreonine or polyclonal rabbit anti-phosphoserine (Invitrogen Immunodetection) anti- bodies used at 1:200 dilution. Horseradish peroxidase-conju- gated anti-rabbit serum was used as a secondary antibody (1:5000 dilution), and detection was carried out using the Western Lightening Reagent according to the manufacturer’s instructions.

KasA and KasB Activity Assay—KasA and KasB enzymatic activities were assayed as described (10). Briefly, Holo-AcpM (40␮^M) was incubated at 37 °C for 30 min with 1 mM␤-mer-

Phosphorylation of M. tuberculosis Condensing Enzymes

30096 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 40 • OCTOBER 6, 2006

captoethanol in 100 mMpotassium phosphate buffer, pH 7.0 to a total volume of 25␮l. Kinetic analysis used varied concentra- tions of [2-¹⁴C]malonyl-CoA (specific activity 1.92 Gbq/mmol;

Amersham Biosciences) (0 – 40␮^M). mtFabD (40 ng) was pre- heated to 37 °C, added to the reaction mixture and held at 37 °C for 30 min to allow mtFabD-catalyzed transacylation of holo- AcpM (30) using [2-¹⁴C]malonyl-CoA to reach equilibrium.

C₁₆-AcpM (0 –35␮^M) (30) was added to obtain a final volume of 49 ␮l. Unphosphorylated/phosphorylated KasA (0.6 ␮g) or unphosphorylated/phosphorylated KasB (0.8␮g) were added to the reaction mixture to a final volume of 50␮l. The reaction was held at 37 °C for 40 min, after which it was quenched by adding 2 ml of a NaBH₄reducing solution (5 mg/ml NaBH₄in 0.1MK₂HPO₄, 0.4MKCl and 30% (v/v) tetrahydrofuran) fol- lowed by incubation at 37 °C for 1 h. The completely reduced product was extracted twice with 2 ml of water-saturated tolu- ene. The combined organic phases from both extractions were pooled and washed with 2 ml of toluene-saturated water. The organic layer was removed and dried under a stream of nitrogen in a scintillation vial. The ¹⁴C₁₈-1,3-diol product was then quantified by liquid scintillation counting using 10 ml of EcoScintA.

RESULTS AND DISCUSSION

STPK-mediated Phosphorylation of Mycobacterial FAS-II Enzymes—The main locus of the mycobacterial FAS-II system is an operon comprising five genes, all transcribed in the same orientation (6, 36). The third and fourth ORFs, kasA and kasB, encode the␤-ketoacyl-ACP synthases that elongate the grow- ing meromycolate precursor, whereas the first gene, mtfabD, encodes the malonyl-CoA:AcpM transacylase that provides them with the malonyl-AcpM substrate, the carbon donor during the elongation steps (6, 10, 30). AcpM, the mycobac- terial acyl carrier protein, is encoded by a gene located between mtfabD and kasA (10). A systematic approach was used to investigate whether the eleven STPKs of M. tuberculosis (PknA to PknL) phosphorylate these FAS-II components. All eleven STPKs were expressed as GST fusions and purified from E. coli.

The various FAS-II components investigated were expressed as His tag fusions and purified from E. coli. Interestingly, when STPKs were incubated in the presence of KasA and [␥-³³P]ATP (specific activity 3000 Ci/mmol; Amersham Biosciences), phos- phorylation of KasA was observed, although at different levels with regard to the kinase. Fig. 1A shows that PknA was the most efficient kinase to phosphorylate KasA, while PknB, E, F, and H were also found to efficiently phosphorylate KasA. However, PknK and PknL, which display strong autophosphorylation activity in vitro, did not phosphorylate KasA. PknG, PknI, and PknJ did not phosphorylate KasA but this might have been caused by their very low in vitro autokinase activity. To our knowledge, this is the first demonstration of phosphorylation of a FAS-II condensing enzyme. This unexpected result prompted us to explore whether KasB, which closely resembles KasA (67%

identity) and is encoded by the adjacent gene, may also be a substrate of M. tuberculosis STPKs. As shown in Fig. 1A (second panel), KasB was also phosphorylated in vitro, as evidenced by the incorporation of radiolabeled phosphate from [␥-³³P]ATP.

In addition, the STPK-mediated phosphorylation profile of

KasB was similar to that of KasA, with PknA being the most active kinase. It is, therefore, very likely that different kinases, such as PknA, recognize KasA and KasB equally well, and sug- gest that they present the same phosphorylation profile.

We next examined whether mtFabD may be phosphorylated in vitro, an enzyme that has previously been shown to be phos- phorylated in M. bovis BCG (37). The autoradiograph clearly shows [³³P]mtFabD in the presence of the different STPKs (Fig.

1A, third panel). More surprising was the finding that the phos- phorylation profile was comparable to those obtained for KasA and KasB. Altogether, these results suggest that the three FAS-II components can be phosphorylated by a specific set of M. tuberculosiskinases, and are preferred substrates for PknA in vitro, suggesting that PknA (and presumably the other STPKs) could phosphorylate all three enzymes using a similar mechanism.

Removal of the N-terminal His tag of KasA, KasB, or mtFabD by cleavage with thrombin did not alter the phosphorylation profile of the “mature” proteins, thus indicating that phospho- rylation did not occur on the additional His tag residues (data not shown).

AcpM is a crucial FAS-II component that carries on the growing fatty acyl chain during the elongation step. We there- fore investigated whether holo-AcpM may also be phosphoryl- ated. Fig. 1A (fourth panel) shows that all STPKs failed to phos- phorylate AcpM. We next addressed the question whether OmpATb, the major porin found in the cell wall of M. tubercu- losis(31, 38) and which is not related to FAS-II, could be a substrate of the kinases. Our results indicate that none of the FIGURE 1. A, in vitro phosphorylation of KasA, KasB, mtFabD, AcpM, and OmpATb by STPKs. The 11 recombinant STPKs (PknA to PknJ) encoded by the M. tuberculosis genome were expressed and purified as GST fusions in E. coli and incubated with the purified His-tagged mycobacterial FAS-II enzymes in the presence of [␥-³³P]ATP. The quantity between the 11 STPKs is varying from 0.6 to 4.2␮g to obtain for each specific kinase their optimal autophos- phorylation activity. Samples were separated by SDS-PAGE and visualized by autoradiography. Upper panel, KasA; second panel, KasB; third panel, mtFabD;

fourth panel, AcpM; and lower panel, OmpATb. The right lane in each panel corresponds to the Coomassie Blue-stained gel showing purity and migration of each substrate. The asterisks represent the autophosphorylated kinases. B, kinetic phosphorylation of the PknA-phosphorylated KasA, KasB, and mtFabD substrates. A kinetic analysis (0 –30 min) was performed with [␥-³³P]ATP. Pro- teins were analyzed by SDS-PAGE, and radioactive bands were revealed by autoradiography. Upper panel, KasA; middle panel, KasB; lower panel, mtFabD.

30097

kinases were able to phosphorylate OmpATb in vitro (Fig. 1A, fifth panel). Together, these results indicate that the kinases exhibit substrate specificity, although they present overlapping activities with regard to KasA, KasB, or mtFabD.

The results of kinetic analyses of PknA on the three FAS-II substrates, KasA, KasB, and mtFabD is summarized in Fig. 1B.

In all three cases, the phosphorylation activity reached a maxi- mum after 20 min. The “overlapping” substrate specificity of different kinases is consistent with previous studies showing that PknB, PknD, PknE, and PknF can all phosphorylate the FHA-containing protein GarA to some extent (24), as well as the FHA-containing proteins Rv0020c and Rv1747 (39). Most studies have reported interactions between FHA-containing proteins and STPKs belonging to either the same or different operons. This work shows that the same kinases can also phos- phorylate substrates that lack the FHA domain. Thus, in addi- tion to FHA-containing proteins, FHA-independent mecha- nisms involve direct binding to STPKs, emphasizing the complexity of STPKs signaling in M. tuberculosis. Another finding arising from these experiments is that KasA, KasB, and mtFabD can interact with multiple STPKs, suggesting that these enzymes may be regulated by multiple signals. However, it remains to be established whether this STPK cross-talk occurs in vivo, which would argue for a very complex signaling mechanism.

PknA Phosphorylates All Three FAS-II Enzymes on Multiple Threonine Residues—First, to investigate which amino acid res- idues were phosphorylated by PknA, we analyzed the phos- phoamino acid content of phosphorylated KasA, KasB, and mtFabD. The different proteins (1 ␮g) were labeled with [␥-³³P]ATP in vitro, separated by SDS-PAGE, excised, and sub- jected to acid hydrolysis as described in Molle et al. (22). Fig. 2 shows that all three substrates are preferentially phosphoryla- ted at threonine residues with minor amounts of phospho- serine being detected.

We have recently shown that PknH-mediated phosphoryla- tion of EmbR in vitro leads to five phosphorylation states in EmbR (40), whereas PknB phosphorylated GarA at a single phosphate acceptor residue (24). Therefore, to determine the in vitrophosphorylation profile of all three FAS-II enzymes, we performed two-dimensional gel electrophoresis. First, follow- ing in vitro phosphorylation by PknA, gel analysis indicated up to three phosphorylation states in KasA (Fig. 3A). The conclu- sion that the different phosphorylation states of KasA corre- spond to mono-, di-, or tri-phosphorylated forms of the protein relies on the fact that each spot on the two-dimensional gel is equidistant to the next one and can only correspond to a post- translational modification such as phosphorylation. In fact, each phosphate group changes the charge of the protein and makes it to migrate toward the acidic end of the two-dimen- sional strip (41). Spot intensities from autoradiographs indi- cated a dominant phosphorylated state (labeled 1), accounting for 88% of the total integrated spot intensity, with states 2 and 3 accounting for 10 and 2% each. Similarly, three phosphoryla- tion sites were observed following PknA-mediated phosphoryl- ation of KasB (Fig. 3B) and mtFabD (Fig. 3C).

In Vivo Phosphorylation of KasA and KasB in M. bovis BCG—

To investigate whether KasA and KasB phosphorylation occurs

in vivo, we have adopted a proteomic approach. Total soluble M. bovisBCG proteins were resolved on a two-dimensional gel, which were subsequently transferred to a membrane and probed with rat anti-KasA antibodies, which also cross-reacts with KasB. Western blot analysis shows the presence of 3 or 4 isoforms of KasA and KasB, presumably corresponding to var- ious phosphorylation states (Fig. 4). These results clearly dem- onstrate that both KasA and KasB are very efficiently phospho- rylated in vivo and that it is more significant in vivo than in vitro (following treatment with purified STPKs added individually, Fig. 3). The basis for the difference in the phosphorylation pro- files observed in vitro and in vivo is presently unknown but suggests that the intracellular environment plays a key role in the phosphorylation efficiency of KasA and KasB. Some myco- bacterial factors, which are absent from in vitro assays, may be required for better presentation of the substrate to the STPK(s).

Alternatively, some STPKs may act first in order to mono- phosphorylate the substrate, thus allowing other kinases to phosphorylate the enzymes in a sequential manner. More- over, this approach constitutes a powerful tool to look for phosphorylation of any mycobacterial protein. In addition, it may be useful to analyze how growth conditions can affect the phosphorylation profile. More importantly, these results FIGURE 2. Phosphoamino acid content of the PknA-phosphorylated FAS-II substrates. KasA, KasB, and mtFabD were phosphorylated in vitro in presence of GST-PknA and [␥-³³P]ATP, analyzed by SDS-PAGE, electroblotted onto an Immobilon PVDF membrane, excised, and hydrolyzed in acid. The phosphoamino acids thus liberated were separated by electrophoresis in the first dimension and ascending chromatography in the second dimension.

After migration, radioactive molecules were detected by autoradiography.

Authentic phosphoserine (P-Ser), phosphothreonine (P-Thr), and phosphoty- rosine (P-Tyr) were run in parallel as internal standard controls, and visualized by ninhydrin staining. Upper panel, KasA; middle panel, KasB; lower panel, mtFabD.

Phosphorylation of M. tuberculosis Condensing Enzymes

30098 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 40 • OCTOBER 6, 2006

suggest that M. bovis BCG represents an attractive source of phosphorylated material to exploit for further studies aimed to analyze the effect of phosphorylation on the activity of the condensing enzymes.

Overproduction and Purification of KasA and KasB Phospho- rylated in Vivo in M. bovis BCG—To overproduce and purify in vivophosphorylated KasA, a His tag was attached at the C ter- minus of the KasA polypeptide and the recombinant protein was expressed in M. bovis BCG. Cultures of M. bovis BCG/

pVV16-kasA were collected, lysed, and fractionated to separate the soluble cytosolic compartment from the cell envelope. Sol- uble KasA was then purified to homogeneity by affinity chro- matography on Ni-containing beads under native conditions (Fig. 5D, left panel). We reasoned that analysis of this purified KasA sample by two-dimensional gel electrophoresis would allow us to determine whether phosphorylation of KasA takes place in mycobacteria, and whether it corresponds to a consti- tutive or growth phase-dependent phenomenon. Samples were collected at various time points during M. bovis BCG growth, corresponding to early-log, mid-log, late-log, or early stationary phases and KasA was purified at each time point and subjected to two-dimensional gel electrophoresis. Three spots, the first one presumably corresponding to the unphosphorylated form of KasA followed in the acidic direction by mono- and di-phos- phorylated KasA, were clearly observed (Fig. 5A), demonstrat- ing that KasA is phosphorylated in vivo. Here, the vast majority of KasA was phosphorylated at either one or two sites (mono- phosphorylation being the more prominent spot), and only a small proportion of KasA remained unphosphorylated. This contrasts with our in vitro analyses in which the majority of KasA remained unphosphorylated (Fig. 3A). Furthermore, the phosphorylation state of KasA remained constant, regardless of the growth phase. However, it is noteworthy that the phospho- rylation profile was slightly different during stationary phase (Fig. 5A), where the mono-phosphorylated species was less pro- nounced than in actively replicating mycobacteria and charac- terized by the appearance of another spot, corresponding to the tri-phosphorylated form of KasA. This contrasts with recent findings using an anti-phosphothreonine antibody suggest- ing that mtFabD phosphorylation can only be detected in growing M. bovis BCG cultures (37). Like KasA, the vast majority of KasB was mono-phosphorylated (Fig. 5C) in M. bovisBCG. These results clearly confirm that both con- densing enzymes are phosphorylated in mycobacteria to a significant level.

To determine whether in vivo phosphorylation of KasA and KasB occurs on threonine and/or serine residues, Western blot analysis were performed using specific anti-phosphothreonine or anti-phosphoserine antibodies. It was found that KasA and KasB purified from their respective M. bovis BCG strains were only phosphorylated on threonine residues (Fig. 5E). This is consistent with the results obtained by phosphoaminoacid analysis when the proteins were phosphorylated in vitro using PknA (Fig. 2). It clearly establishes that both condensing enzymes are highly phosphorylated in vivo on threonines. In contrast, neither the anti-phosphothreonine nor the anti-phos- phoserine antibodies did react with recombinant KasA or KasB proteins purified from E. coli thus confirming that the phospho- rylation of the condensing enzymes is a specific phenomenon of M. bovis BCG (Fig. 5E).

M. tuberculosis Phosphatase PstP Dephosphorylates KasA—

M. tuberculosishas only one gene (pstP) encoding a transmem- FIGURE 3. Two-dimensional gel electrophoresis profiles of in vitro

PknA-phosphorylated FAS-II substrates. Two-dimensional gel electro- phoresis of KasA (A), KasB (B), or mtFabD (C) following in vitro phosphoryl- ation by PknA in the presence of [␥-³³P]ATP. Proteins were either stained with Coomassie Blue (upper panels) or visualized by autoradiography (lower panels). The arrowheads represent the different protein isoforms:

np, unphosphorylated; 1, mono-phosphorylated; 2, di-phosphorylated; 3, tri-phosphorylated.

FIGURE 4. In vivo phosphorylation of KasA and KasB in M. bovis BCG.

Approximately 150␮g of total soluble protein from M. bovis BCG lysate were loaded on a 7-cm immobiline strip (pH 3– 6) and electrophoresed in Protean IEF Cell for the first dimension and 10% SDS-PAGE as the second dimension.

Proteins were then transferred to a PVDF membrane and probed with rat antibodies raised against the M. tuberculosis KasA protein, which also strongly cross-reacts with KasB. Following incubation with horseradish peroxidase- conjugated anti-rat serum as secondary antibody, detection was carried out using the Western Lightening Reagent. Represented is a selected portion of the membrane that strongly reacted with the antibodies and consisting of KasA (43.3 kDa, pH_i4.9) and KasB (46.4 kDa, pH_i5.2). The arrowheads represent the different phosphorylated isoforms of KasA and KasB proteins.

30099

brane Ser/Thr phosphatase (12, 18). PstP efficiently dephospho- rylates a variety of phosphorylated proteins, including PknA and PknB (17, 18) as well as other M. tuberculosis STPK domains (42). Dephosphorylation of STPKs simultaneously abolishes binding sites for substrates containing FHA domains (22) and substantially reduces protein kinase activity (18). Here, we addressed the question whether PstP was active on in vivo- phosphorylated KasA, as might be expected if the phosphoryl- ation activity is regulated and dependent on a reversible phos- phorylation mechanism. Therefore, the cytoplasmic region of PstP (residues 1–298), containing the phosphatase catalytic core, was expressed as a His-tagged protein. The recombinant His-tagged PstP-(1–298) was produced as a soluble protein in E. coli, purified (Fig. 5D, right panel) and incubated with phos- phorylated KasA isolated from M. bovis BCG. Two-dimen- sional gel analysis revealed a single spot migrating toward the

basic pH and corresponding to an unphosphorylated state, sug- gestingthatPstP-(1–298)dephosphorylatedmono-anddi-phos- phorylated KasA (Fig. 5B). To our knowledge, this is the first time that PstP has been shown to dephosphorylate a mycobac- terial STPK-phosphorylated substrate, suggesting that PstP exerts its phosphatase activity not only on kinases but also on the kinase substrates. These results strongly suggest that phos- phorylation of KasA is reversible in vivo, where the phosphatase PstP may play a key regulatory role.

Phosphorylation Differentially Modulates KasA and KasB Condensing Activities—KasA and KasB have been previously shown to be␤-ketoacyl-AcpM synthases of the mycobacterial FAS-II system (6, 10). FAS-II is responsible for the production of the long-chain fatty acid that is subsequently modified to form the meromycolate chain of mycolic acids. To date, there is very little information as to whether mycolic acid biosynthesis FIGURE 5. Analysis of the phosphorylation profile of KasA and KasB purified from recombinant M. bovis BCG strains. A, phosphorylation profile of KasA at various time points during growth of M. bovis BCG carrying the pVV16-kasA construct in Sauton medium with gentle shaking (70 rpm). Cells were lysed, and the soluble fraction was incubated with Ni-NTA agarose beads to purify the His-tagged KasA protein. KasA was purified at the times indicated (early-, mid-, late-log, and early stationary phase), subjected to two-dimensional gel electrophoresis and stained with Coomassie Blue. The arrowheads represent the different KasA isoforms: np, unphosphorylated; 1, mono-; 2, di-; 3, tri-phosphorylated. B, dephosphorylation assay with purified PstP-(1–298) using in vivo phosphorylated KasA as substrate. In vivo purified-KasA (3␮g) was incubated with His-tagged purified PstP-(1–298) (3 ␮g) in a reaction mixture containing 50 mMTris-HCl buffer pH 7.5, 0.1 mMEDTA, 1 mMdithiothreitol, and 5 mMMnCl2for 1 h at 37 °C. The PstP-treated profile of KasA was obtained by two-dimensional gel electrophoresis. The arrowhead indicates the unique KasA isoform (unphosphorylated, np) observed following treatment with PstP. C, phosphorylation profile of KasB purified from M. bovis BCG carrying the pVV16-kasB harvested at mid-log phase. Analysis was performed as mentioned above. D, purity of the His-tagged KasA protein isolated from M. bovis BCG carrying the pVV16-kasA construct checked on a 12% SDS-PAGE (left panel) and purity of the cytoplasmic region of the PstP phosphatase (residues 1–298) comprising the phosphatase catalytic core isolated from E. coli BL21(DE3)pLysS cells carrying pETAmp-pstP- (1–298) (right panel). E, detection of phosphorylated amino acids in in vivo phosphorylated KasA and KasB. Recombinant KasA and KasB purified from either E. coli or from M. bovis BCG strains (2␮g) were analyzed on a 10% SDS-PAGE and detected by immunoblotting using antibodies against phosphoserine and phosphothreonine residues.

Phosphorylation of M. tuberculosis Condensing Enzymes

30100 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 40 • OCTOBER 6, 2006

can be regulated post-translationally. We therefore sought to investigate the regulatory implications of the phosphorylation of FAS-II condensing enzymes. Kinetic analysis was carried out to investigate the effect of phosphorylation on substrate affinity and turnover of KasA and KasB. The effect of phosphorylation on KasA activity was analyzed using the recombinant purified protein from E. coli or from M. bovis BCG as sources of non- phosphorylated or phosphorylated KasA, respectively, and by varying both C₁₆-AcpM and malonyl-AcpM substrate concen- trations (Fig. 6, A and B). The apparent K_mvalues for substrates C₁₆-AcpM and malonyl-AcpM were about 18␮^Mand 12␮^M, respectively, and did not change on phosphorylation, indicating that phosphorylation does not affect binding of these sub- strates. However, the apparent V_maxwas consistently reduced

by⬃3–4-fold on phosphorylation, leading to a reduction in the rate of the condensation reaction. We also compared these parameters for unphosphorylated versus phosphorylated KasB (Fig. 6, C and D). In contrast to KasA, we found that phospho- rylation consistently increased the condensation activity of KasB. Although the apparent K_m values for C₁₆-AcpM remained unchanged following phosphorylation (about 12␮^M), the apparent K_mof malonyl-AcpM was reduced by 3-fold to 10

␮^M. These unexpected results demonstrate that phosphoryla- tion affects KasA and KasB differently and suggests that they might be phosphorylated at different sites, despite their strong overall homology. Alternatively, structural variations around a conserved phosphorylation site might produce this differential effect.

FIGURE 6. Effect of KasA and KasB phosphorylation on condensation reaction kinetics. A, catalytic activities of KasA (A and B) and KasB (C and D) were determined as described under “Experimental Procedures,” by increasing C₁₆-AcpM (A and C) and malonyl-AcpM (B and D) concentrations. Catalytic param- eters were obtained on analysis of the data by Lineweaver-Burk plots (insets). Each graph compares the activities of unphosphorylated (F) versus phospho- rylated proteins (E). Unphosphorylated KasA and KasB were purified from E. coli C41(DE3) carrying pET28a-kasA or pET28a-kasB, respectively, whereas phosphorylated KasA and KasB were purified from recombinant M. bovis BCG carrying pVV16-kasA or pVV16-kasB, respectively. Three independent protein preparations were assayed in duplicate with similar results.

30101

Based on in vitro assays and drug inhibition studies, it has been proposed that KasA is involved in the initial elongation of meromycolic acid precursors that are further extended by KasB (6, 43). This hypothesis has recently been supported by in vivo studies in both kasA and kasB mutants. Null mutants of kasB, but not kasA, could be generated in Mycobacterium smegmatis, suggesting that, unlike kasB, kasA is essential (44). It was also found that conditional depletion of KasA in M. smegmatis leads to the loss of mycolic acid biosynthesis prior to cell lysis (44). A kasBmutant of Mycobacterium marinum showed an impaired growth within infected macrophages, although KasB was not required for normal growth in broth medium, indicating a crit- ical role of KasB in intracellular survival (4). Moreover, the meromycolates were shortened by 2– 4 carbon units in the kasB mutant and this defect was localized to the proximal portion of the meromycolate chain (4). Therefore, given the importance for pathogenic mycobacteria to produce full-length mycolates for intracellular survival and virulence, one can postulate that KasA and KasB activities are being differentially regulated.

Because kasA and kasB are adjacent genes and belong to the same operon, one would predict that differential regulation proceeds at a post-translational rather than a transcriptional level. Our results suggest that phosphorylation is the post- translational modification that reduces the activity of KasA and enhances that of KasB. The differential effect of phosphoryla- tion of KasA and KasB, two highly similar enzymes sharing the same enzymatic activity but with different substrates specifici- ties, is rather unexpected. This is even more surprising given

the fact that both enzymes share a similar phosphorylation profile in vivo, and are presumably phospho- rylated at the same conserved thre- onine residues. This may represent an unusual mechanism of regula- tion where damping KasA may allow time to produce immature mycolates. Conversely, boosting KasB activity may ensure that myco- bacteria produce only the full- length mycolates required for viru- lence and intracellular survival.

Among the few substrates of M. tuberculosis STPKs identified so far mtFabD, KasA and KasB are the only ones to which a clear enzy- matic function has been assigned.

Our work suggests that phosphoryl- ation of these enzymes plays a role in the control of the FAS-II pathway and paves the way for studies dedi- cated to the regulation of mycolic acid biosynthesis. The differential expression of the mycobacterial kinases in response to stress condi- tions may directly affect the phos- phorylation profile of these sub- strates, and as a consequence mod- ulate mycolic acid biosynthesis in order to promote adaptation to environmental changes. In an elegant study, Veyron-Churlet et al. (28) have proposed an attractive model based on the interaction between the various FAS-II components, in which different specialized FAS-II com- plexes are interconnected. In particular, this model predicts the occurrence of two FAS-II systems involved in the elongation step: the “elongation-1 FAS-II” (E1-FAS-II) formed by a core and KasA, capable of elongating acyl-AcpM originating from FAS-I (or an initiation-FAS-II complex); the longer chain of acyl-AcpM products would then be channeled into the “elon- gation-2 FAS-II” (E2-FAS-II), comprising the core and KasB that would complete meromycolate synthesis. Thus, our results support a model in which STPK-dependent phosphorylation can induce either positive or negative signaling to the E1-FAS-II and E2-FAS-II complexes (Fig. 7). Further work is needed to understand how environmental changes, including those encountered within the infected macrophages, affect this regulation mechanism. Moreover, it was recently demon- strated that GroEL1 modulates mycolates synthesis during bio- film formation and physically associates with KasA (45). A

⌬groEl1 mutant of M. smegmatis, that is defective in biofilm formation also showed a marked reduction in KasA and KasB levels. Therefore, whether GroEL1 interacts specifically with phosphorylated KasA or KasB rather than the non-phosphoryl- ated proteins deserves to be investigated. It may be reasonable to speculate that GroEL1 plays a regulatory role in phosphoryl- ation of these proteins by the kinases. Another perspective of this work is the opening of a new field of investigation for future FIGURE 7. Model for the regulation of the meromycolic acid elongation by phosphorylation of the con-

densing enzymes. Changes in cell wall and mycolic acid composition to various environmental stimuli are central to M. tuberculosis adaptation during infection. Many of these stimuli are transduced within the bacteria by sensor STPKs on the mycobacterial membrane. When sensing external stimuli, STPKs are phosphorylated and transfer the signal to KasA and KasB by transphosphorylation. Our results suggest a differential regulation mechanism of KasA and KasB activities, each enzyme being part of a specialized elongation FAS-II system, E1-FAS-II comprising KasA, and E2-FAS-II possessing KasB. E1-FAS-II elongates the acyl-AcpM chains from FAS-I to longer acyl chains, whereas E2-FAS-II terminates the elongation process by adding the last 2– 4 carbon units at the proximal site. Production of full-length mycolates is critical for pathogenic mycobacteria to survive in infected macrophages. We propose that, to ensure the biosynthesis of mature mycolates, mycobacteria dif- ferentially regulate their E1-FAS-II and E2-FAS-II systems through STPK-dependent phosphorylation.

Phosphorylation of M. tuberculosis Condensing Enzymes

30102 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 40 • OCTOBER 6, 2006

drug development against tuberculosis by interfering with these regulatory processes, such as by selective inhibition of FAS phosphorylation. This notion is supported by the fact that specific inhibitors of protein kinases have been successfully developed for therapeutic usage against a variety of diseases (46), and a specific inhibitor of PknG was capable to inhibit growth of M. tuberculosis inside macrophages (47). This work provides a new framework for future investigation of FAS-II regulation, not only in mycobacteria but also in apicomplexan parasites and in plants, which also possess a FAS-II system.

Acknowledgments—We thank Dr. V. D. Vissa (Colorado State Uni- versity) for the kind gift of the pVV16 cloning vector, Dr. L. G. Dover (University of Birmingham), Prof. M. J. Buttner (John Innes Centre), and Sir D. A. Hopwood (John Innes Centre) for their comments on the manuscript.

REFERENCES

1. Brennan, P. J., and Nikaido, H. (1995) Annu. Rev. Biochem. 64, 29 – 63 2. Daffe, M., and Draper, P. (1998) Adv. Microb. Physiol. 39, 131–203 3. Dubnau, E., Chan, J., Raynaud, C., Mohan, V. P., Laneelle, M. A., Yu, K.,

Quemard, A., Smith, I., and Daffe, M. (2000) Mol. Microbiol. 36, 630 – 637 4. Gao, L. Y., Laval, F., Lawson, E. H., Groger, R. K., Woodruff, A., Morisaki, J. H., Cox, J. S., Daffe, M., and Brown, E. J. (2003) Mol. Microbiol. 49, 1547–1563

5. Takayama, K., Wang, C., and Besra, G. S. (2005) Clin. Microbiol Rev. 18, 81–101

6. Kremer, L., Baulard, A. R., and Besra, G. S. (2000) in Molecular Genetics of Mycobacteria(Hatfull, G. F., a. W. R. J., Jr., ed) pp. 173–190, ASM Press, Washington, D. C.

7. Choi, K. H., Kremer, L., Besra, G. S., and Rock, C. O. (2000) J. Biol. Chem.

275,28201–28207

8. Brown, A. K., Sridharan, S., Kremer, L., Lindenberg, S., Dover, L. G., Sac- chettini, J. C., and Besra, G. S. (2005) J. Biol. Chem. 280, 32539 –32547 9. Schaeffer, M. L., Agnihotri, G., Volker, C., Kallender, H., Brennan, P. J., and

Lonsdale, J. T. (2001) J. Biol. Chem. 276, 47029 – 47037

10. Kremer, L., Dover, L. G., Carrere, S., Nampoothiri, K. M., Lesjean, S., Brown, A. K., Brennan, P. J., Minnikin, D. E., Locht, C., and Besra, G. S.

(2002) Biochem. J. 364, 423– 430

11. Av-Gay, Y., and Everett, M. (2000) Trends Microbiol 8, 238 –244 12. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D.,

Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., 3rd, Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R., Dev- lin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Krogh, A., McLean, J., Moule, S., Murphy, L., Oliver, K., Osborne, J., Quail, M. A., Rajandream, M. A., Rogers, J., Rutter, S., Seeger, K., Skelton, J., Squares, R., Squares, S., Sulston, J. E., Taylor, K., Whitehead, S., and Barrell, B. G. (1998) Nature 393, 537–544

13. Peirs, P., De Wit, L., Braibant, M., Huygen, K., and Content, J. (1997) Eur.

J. Biochem. 244,604 – 612

14. Av-Gay, Y., Jamil, S., and Drews, S. J. (1999) Infect. Immun. 67, 5676 –5682 15. Molle, V., Girard-Blanc, C., Kremer, L., Doublet, P., Cozzone, A. J., and

Prost, J. F. (2003) Biochem. Biophys. Res. Commun. 308, 820 – 825 16. Chaba, R., Raje, M., and Chakraborti, P. K. (2002) Eur. J. Biochem. 269,

1078 –1085

17. Chopra, P., Singh, B., Singh, R., Vohra, R., Koul, A., Meena, L. S., Koduri, H., Ghildiyal, M., Deol, P., Das, T. K., Tyagi, A. K., and Singh, Y. (2003) Biochem. Biophys. Res. Commun. 311,112–120

18. Boitel, B., Ortiz-Lombardia, M., Duran, R., Pompeo, F., Cole, S. T., Cerve- nansky, C., and Alzari, P. M. (2003) Mol. Microbiol 49, 1493–1508

19. Koul, A., Choidas, A., Tyagi, A. K., Drlica, K., Singh, Y., and Ullrich, A.

(2001) Microbiology 147, 2307–2314

20. Young, T. A., Delagoutte, B., Endrizzi, J. A., Falick, A. M., and Alber, T.

(2003) Nat. Struct. Biol. 10, 168 –174

21. Gopalaswamy, R., Narayanan, P. R., and Narayanan, S. (2004) Protein Expr. Purif. 36,82– 89

22. Molle, V., Kremer, L., Girard-Blanc, C., Besra, G. S., Cozzone, A. J., and Prost, J. F. (2003) Biochemistry 42, 15300 –15309

23. Molle, V., Soulat, D., Jault, J. M., Grangeasse, C., Cozzone, A. J., and Prost, J. F. (2004) FEMS Microbiol Lett. 234, 215–223

24. Villarino, A., Duran, R., Wehenkel, A., Fernandez, P., England, P., Brodin, P., Cole, S. T., Zimny-Arndt, U., Jungblut, P. R., Cervenansky, C., and Alzari, P. M. (2005) J. Mol. Biol. 350, 953–963

25. Kang, C. M., Abbott, D. W., Park, S. T., Dascher, C. C., Cantley, L. C., and Husson, R. N. (2005) Genes Dev. 19, 1692–1704

26. Dasgupta, A., Datta, P., Kundu, M., and Basu, J. (2006) Microbiology 152, 493–504

27. Bendt, A. K., Burkovski, A., Schaffer, S., Bott, M., Farwick, M., and Hermann, T. (2003) Proteomics 3, 1637–1646

28. Veyron-Churlet, R., Guerrini, O., Mourey, L., Daffe, M., and Zerbib, D.

(2004) Mol. Microbiol. 54, 1161–1172

29. Miroux, B., and Walker, J. E. (1996) J. Mol. Biol. 260, 289 –298

30. Kremer, L., Nampoothiri, K. M., Lesjean, S., Dover, L. G., Graham, S., Betts, J., Brennan, P. J., Minnikin, D. E., Locht, C., and Besra, G. S. (2001) J. Biol. Chem. 276,27967–27974

31. Molle, V., Saint, N., Campagna, S., Kremer, L., Lea, E., Draper, P., and Molle, G. (2006) Mol. Microbiol. 61, 826 – 837

32. Grangeasse, C., Doublet, P., Vaganay, E., Vincent, C., Deleage, G., Duclos, B., and Cozzone, A. J. (1997) Gene (Amst.) 204, 259 –265

33. Jackson, M., Crick, D. C., and Brennan, P. J. (2000) J. Biol. Chem. 275, 30092–30099

34. Stover, C. K., de la Cruz, V. F., Fuerst, T. R., Burlein, J. E., Benson, L. A., Bennett, L. T., Bansal, G. P., Young, J. F., Lee, M. H., Hatfull, G. F., Snapper, S. B., Barletta, R. G., Jacobs, W. R., Jr., and Bloom, B. R. (1991) Nature 351, 456 – 460

35. Kremer, L., Guerardel, Y., Gurcha, S. S., Locht, C., and Besra, G. S. (2002) Microbiology 148,3145–3154

36. Mdluli, K., Slayden, R. A., Zhu, Y., Ramaswamy, S., Pan, X., Mead, D., Crane, D. D., Musser, J. M., and Barry, C. E., 3rd. (1998) Science 280, 1607–1610

37. Sinha, I., Boon, C., and Dick, T. (2003) FEMS Microbiol. Lett. 227, 141–147

38. Senaratne, R. H., Mobasheri, H., Papavinasasundaram, K. G., Jenner, P., Lea, E. J., and Draper, P. (1998) J. Bacteriol. 180, 3541–3547

39. Grundner, C., Gay, L. M., and Alber, T. (2005) Protein Sci. 14, 1918 –1921 40. Alderwick, L. J., Molle, V., Kremer, L., Cozzone, A. J., Dafforn, T. R., Besra, G. S., and Futterer, K. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 2558 –2563 41. Grangeasse, C., Obadia, B., Mijakovic, I., Deutscher, J., Cozzone, A. J., and

Doublet, P. (2003) J. Biol. Chem. 278, 39323–39329

42. Duran, R., Villarino, A., Bellinzoni, M., Wehenkel, A., Fernandez, P., Boi- tel, B., Cole, S. T., Alzari, P. M., and Cervenansky, C. (2005) Biochem.

Biophys. Res. Commun. 333,858 – 867

43. Slayden, R. A., and Barry, C. E., 3rd. (2002) Tuberculosis (Edinb.) 82, 149 –160

44. Bhatt, A., Kremer, L., Dai, A. Z., Sacchettini, J. C., and Jacobs, W. R., Jr.

(2005) J. Bacteriol. 187, 7596 –7606

45. Ojha, A., Anand, M., Bhatt, A., Kremer, L., Jacobs, W. R., Jr., and Hatfull, G. F. (2005) Cell 123, 861– 873

46. Shawver, L. K., Slamon, D., and Ullrich, A. (2002) Cancer Cell 1, 117–123 47. Walburger, A., Koul, A., Ferrari, G., Nguyen, L., Prescianotto-Baschong, C., Huygen, K., Klebl, B., Thompson, C., Bacher, G., and Pieters, J. (2004) Science 304,1800 –1804

30103