• Aucun résultat trouvé

Targeting GLP-1 receptor trafficking to improve agonist efficacy

N/A
N/A
Protected

Academic year: 2022

Partager "Targeting GLP-1 receptor trafficking to improve agonist efficacy"

Copied!
26
0
0

Texte intégral

(1)

Article

Reference

Targeting GLP-1 receptor trafficking to improve agonist efficacy

JONES, Ben, et al.

Abstract

Glucagon-like peptide-1 receptor (GLP-1R) activation promotes insulin secretion from pancreatic beta cells, causes weight loss, and is an important pharmacological target in type 2 diabetes (T2D). Like other G protein-coupled receptors, the GLP-1R undergoes agonist-mediated endocytosis, but the functional and therapeutic consequences of modulating GLP-1R endocytic trafficking have not been clearly defined. Here, we investigate a series of biased GLP-1R agonists with variable propensities for GLP-1R internalization and recycling.

Compared to a panel of FDA-approved GLP-1 mimetics, compounds that retain GLP-1R at the plasma membrane produce greater long-term insulin release, which is dependent on a reduction in β-arrestin recruitment and faster agonist dissociation rates. Such molecules elicit glycemic benefits in mice without concomitant increases in signs of nausea, a common side effect of GLP-1 therapies. Our study identifies a set of agents with specific GLP-1R trafficking profiles and the potential for greater efficacy and tolerability as T2D treatments.

JONES, Ben, et al. Targeting GLP-1 receptor trafficking to improve agonist efficacy. Nature Communications, 2018, vol. 9, no. 1, p. 1602

PMID : 29686402

DOI : 10.1038/s41467-018-03941-2

Available at:

http://archive-ouverte.unige.ch/unige:128571

Disclaimer: layout of this document may differ from the published version.

1 / 1

(2)

Targeting GLP-1 receptor trafficking to improve agonist efficacy. Jones et al.

(3)

a

Ex4 H G E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-dHis1 dH G E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-asn1 N G E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-gln1 Q G E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-tyr1 Y G E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-dTyr1 dY G E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-phe1 F G E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-ala2 H A E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-AIB2 H AIB E G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-asp3 H G D G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-gln3 H G Q G T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-dGln3 H G dQG T F T S D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2

b

Internalization CHO-SNAP-GLP-1R

cAMP

PathHunter CHO-GLP-1R

β-arrestin-2 PathHunter CHO-GLP-1R LogEC50

(M)

Emax

(% loss) Hill slope LogEC50

(M)

Emax

(% GLP-1) Hill slope LogEC50

(M)

Emax

(% GLP-1) Hill slope

ex4 -8.2

(0.1) 83 (7)

2.1 (0.3)

-10.3 (0.0)

105 (3)

1.7 (0.1)

-7.7 (0.1)

97 (8)

1.0 (0.1) ex-dHis1 -7.6*

(0)

73**

(3)

1.2 (0.2)

-10.3 (0.0)

96 (3)

1.9 (0.3)

-7.1 (0.1)

48***

(5)

0.9 (0.1) ex-asn1 -7.2**

(0.3)

41***

(4)

5.0 (4)

-9.8 ***

(0.1) 101

(4)

1.6 (0.1)

-7.1 (0.1)

15***

(2)

1.5 (0.2) ex-gln1

N.C.

22***

(5) N.C.

-9.2***

(0.0)

105 (2)

2 (0.1)

-6.4***

(0.3)

6***

(1)

1.4 (0.4) ex-tyr1 -7.7*

(0.3)

42***

(5)

1.9 (0.6)

-9.7***

(0.0) 96 (4)

2.1 (0.1)

-7.0*

(0.2)

12***

(1)

1.1 (0.2) ex-dTyr1

N.C.

7***

(6) N.C.

-9.2***

(0.1) 99 (6)

2.1 (0.4)

-6.3***

(0.3)

5***

(1)

1.2 (0.5) ex-phe1 -7.2***

(0)

28**

(9)

2.1 (1.3)

-9.9***

(0.1) 99 (3)

2.4 (0.6)

-7.3 (0.1)

12***

(1)

1.2 (0.1) ex-ala2 -8.2

(0.1)

88*

(3)

1.8 (0.2)

-9.8***

(0.0)

106 (3)

1.9 (0.3)

-7.6 (0.0)

99 (9)

1.3 (0.2) ex-AIB2 -8.4

(0)

82 (2)

3.2 (1.7)

-9.8***

(0.1)

104 (4)

1.8 (0.3)

-7.6 (0.0)

89 (5)

1.4 (0.2) ex-asp3 -8.2

(0.1)

91**

(3)

1.5 (0.2)

-9.9***

(0.0)

110 (12)

1.4 (0.2)

-7.7 (0.1)

98 (9)

1.1 (0.1) ex-gln3 -8.4

(0.1) 84 (3)

1.5 (0.2)

-10.2 (0.1)

113 (18)

1.6 (0.4)

-7.8 (0.1)

81 (10)

1.4 (0.2) ex-dGln3 -7.4***

(0.1) 70 (7)

3.1 (1.8)

-10.0***

(0.1) 97 (3)

2.7 (0.9)

-7.1*

(0.1)

31***

(4)

1.1 (0.2) Exendin(9-39) D L S K Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2

GLP-1(7-36)NH2 H A E G T F T S D V S S Y L E G Q A A K E F I A W L V K G R NH2

(4)

Supplementary Figure 1: Agonist sequences and screen results.

(a) Agonist sequences using single letter amino acid code, including parent molecule exendin-4 (“ex4”). (b) Agonist pharmacological characteristics, including GLP-1R internalization in CHO- SNAP-GLP-1R cells (90 min, Emax expressed as % surface receptor loss, n=5), cAMP potency in PathHunter CHO-GLP-1R cells (90 min, Emax expressed relative to GLP-1, n=5), β-arrestin-2 recruitment in PathHunter CHO-GLP-1R cells (90 min, Emax expressed relative to GLP-1, n=5).

Curve fitting parameter estimates from 4-parameter logistic fit, compared by one-way randomized block ANOVA with Dunnett’s test vs. exendin-4. (c) Prolonged (16 h) and acute (1 h) agonist insulin secretion results in INS-1 832/3 and MIN6B1 cells, Emax expressed as insulin secretion index (“ISI”), i.e. fold increase vs. 11 mM glucose alone, n=5-7. Parameter estimates from 4- parameter logistic fit, with Hill slope globally constrained for each assay, compared by one-way randomized block ANOVA with Dunnett’s test vs. exendin-4. * p<0.05, ** p<0.01, *** p<0.001 vs.

c

16 h insulin secretion 1 h insulin secretion

INS-1 832/3 MIN6B1 INS-1 832/3 MIN6B1

LogEC50

(M)

Emax

(ISI) Hill slope ISI LogEC50

(M)

Emax

(ISI) Hill slope ISI

ex4 -11.4

(0.3)

2.8 (0.4)

0.64 (0.05)

1.8 (0.2)

-9.9 (0.4)

1.9 (0.1)

0.66 (0.03)

1.5 (0.1) ex-dHis1 -10.0**

(0.3)

4.0**

(0.6) shared

2.0 (0.2)

-10.8 (0.4)

1.6

(0.1) shared

1.4 (0.1) ex-asn1 -8.5***

(0.4)

4.8***

(0.7) shared

2.1 (0.2)

-10.2 (0.5)

1.6

(0.1) shared

1.4 (0.1) ex-gln1 -8.2***

(0.2)

4.3***

(0.6) shared

2.1 (0.2)

-8.4 (0.6)

1.9

(0.4) shared

1.4 (0.1) ex-tyr1 -9.5***

(0.2)

4.0**

(0.6) shared

2.1**

(0.2)

-9.8 (0.6)

1.5

(0.1) shared

1.4 (0.1) ex-dTyr1 -8.8***

(0.3)

4.3***

(0.6) shared

2.1**

(0.2)

-9.0 (0.7)

2.0

(0.3) shared

1.4 (0.1) ex-phe1 -9.6***

(0.3)

4.4***

(0.6) shared

2.1**

(0.2)

-8.6 (0.4)

2.0

(0.2) shared

1.5 (0.0) ex-ala2 -10.7

(0.7)

1.6**

(0.2) shared

1.5***

(0.1)

-9.9 (0.4)

1.7

(0.1) shared

1.4 (0.1) ex-AIB2 -11.1

(0.5)

2.4

(0.4) shared

1.9 (0.2)

-9.7 (0.4)

2.0

(0.2) shared

1.4 (0.0) ex-asp3 -10.7

(0.6)

1.7*

(0.2) shared

1.5***

(0.2)

-9.2 (0.5)

1.7

(0.2) shared

1.4 (0.0) ex-gln3 -11.0

(0.4)

2.6

(0.4) shared

1.8 (0.2)

-9.8 (0.4)

1.8

(0.2) shared

1.4 (0.1) ex-dGln3 -9.6***

(0.2)

4.0**

(0.6) shared

2.0 (0.2)

-9.3 (0.7)

1.9

(0.2) shared

1.5 (0.1)

(5)

exendin-4 using statistical test indicated above. SEM indicated in brackets. N.C. = not calculable (in case of very low efficacy agonists).

(6)

Supplementary Figure 2: Additional beta cell testing.

(a) Insulin release during overnight incubation with exendin-phe1 ± 10 µM exendin(9-39), n=3. (b) Dose response for apoptosis inhibition in INS-1 832/3 cells treated overnight with 1 µM thapsigargin to induce ER stress, expressed relative to thapsigargin alone, n=6, 4-parameter logistic fit of averaged data shown. (c) Effect of test agonists on apoptosis induced by glucolipotoxicity (25 mM glucose, 0.5 mM BSA-palmitate overnight) in MIN6B1 cells, as determined by TUNEL assay, expressed relative to high glucose/palmitate alone, n=4, one-way ANOVA with Dunnett’s test vs. exendin-4. Agonists applied at 100 nM unless indicated. ** p<0.01 vs. exendin-4 using statistical test indicated above. Error bars indicate SEM.

a

-12-10 -8 -6 60

80 100 120

Log [agonist] (M) Caspase activity (% thapsigargin ctrl)

ex4 ex-phe1 ex-asp3

ex4 ex-p

he1 ex-a

sp3 0

50 100 150

TUNEL +ve nuclei (% control)

**

ns

1 2 3

ISI (vs G11)

ex(9-39) - +

b c

(7)

Supplementary Figure 3: GLP-1R trafficking in CHO-SNAP-GLP-1R cells.

(a) Schematic describing DERET assay. (b) Agonist-induced SNAP-GLP-1R internalization in CHO-SNAP-GLP-1R cells quantified by diffusion-enhanced resonance energy transfer (DERET) assay, indicated as fold signal increase from baseline, n=6. (c) Internalization in CHO-SNAP-GLP- 1R cells, quantified by FACS as in Fig. 2b, n=3, two-way ANOVA with Dunnett’s test vs. exendin-4.

(d) Recycling (30 min) after an initial 15 min agonist exposure in CHO-SNAP-GLP-1R cells, quantified by FACS as above, n=3, one-way ANOVA with Dunnett’s test vs. exendin-4. (e) Representative images of CHO-SNAP-GLP-1R cells, labeled with SNAP-Surface 488 and treated with agonist for 30 min, to induce internalization, n=2; scale bars, 8 µm. (f) Agonist-induced GLP-

a

b

ex4 ex-p

he1 ex-a

sp3 0

20 40 60 80

Recycling (% internalized receptor)

*

0 20 40 60

1 2 3

Time (min) Internalization (fold increase)

Fluor- escein

agonist label

SNAP-

GLP-1R fluorescein SNAP-

Terbium Fluorescence excita=on

0 20 40 60

0 50 100

Time (min)

Internalization (%)

*** *** ***

c d

e

SNAP-Surface-488 DAPI

ex4 ex-phe1 ex-asp3

ex4 ex-p

he1 ex-a

sp3 0

20 40 60 80 100

Internalization (%)

***

ex4 ex-p

he1 ex-a

sp3 0

20 40 60 80 100

Recycling (% internalized receptor)

*

f g

*

(8)

1R internalization measured by post-stimulation surface labeling with Lumi4-Tb in a plate reader, 60 min stimulation, n=5, one-way randomized block ANOVA with Dunnett’s test vs. exendin-4. (g) As for (f) but with further 60 min recycling in the presence of 10 µM exendin(9-39), n=6. Agonists applied at 100 nM. * p<0.05, *** p<0.001 vs. exendin-4 using statistical test indicated above. Error bars indicate SEM.

(9)

Supplementary Figure 4: FITC-agonists.

(a) FITC-agonist sequences denoted by single letter amino acid code. (b) cAMP responses in CHO-SNAP-GLP-1R cells demonstrating agonist potency for FITC-conjugated vs. unmodified agonists, 30 min incubation, n=3. (c) Effect of pH on FITC-agonist fluorescence in solution, normalized to pH 7.4 value, data fitted by linear regression, n=3. (d) Direct measurement of FITC fluorescence from internalized FITC-agonist (30 min, 100 nM) in CHO-SNAP-GLP-1R cells ±

a

b

-12 -10 -8

0 50 100

Log [agonist] (M)

cAMP (% GLP-1 max)

ex4 ex4-FITC

-12 -10 -8

0 50 100

Log [agonist] (M)

cAMP (% GLP-1 max)

ex-asp3 ex-asp3-FITC

-12 -10 -8

0 50 100

Log [agonist] (M)

cAMP (% GLP-1 max)

ex-phe1 ex-phe1-FITC

ex4 H G E G T F T S D L S K-FITC Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-phe1 F G E G T F T S D L S K-FITC Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2 ex-asp3 H G D G T F T S D L S K-FITC Q M E E E A V R L F I E W L K N G G P S S G A P P P S NH2

4 5 6 7 8 0.0

0.5 1.0 1.5

pH Normalized FITC fluoresence

ex4-FITC ex-phe1-FITC ex-asp3-FITC

0 20 40 60

0 1 2

Time (min)

Normalized FITC fluorescence ex4-FITC ex-phe1-FITC ex-asp3-FITC ex4-FITC + baf ex-phe1-FITC + baf ex-asp3-FITC + baf

ex4-FITC ex-phe1-FITC ex-asp3-FITC 4

6 8 10

Calculated pH

*

***

c d

e

(10)

bafilomycin (“baf”, 100 nM), measured over 60 min and normalized to baseline reading without bafilomycin, n=4. (e) Estimated average pH of FITC-agonist after 30 min internalization, by extrapolation of data from (d) to calibration shown in (c), n=4. * p<0.05, *** p<0.001 by one-way randomized block ANOVA with Dunnett’s test vs. exendin-4. Error bars indicate SEM.

(11)

c

f

Degrada'on*assay*Exp1*

CHO*SNAP9GLP91R;*no*cycloheximide,*no*serum*

An'9SNAP*blot*

(high*exposure)*

An'9Tubulin*blot*

*******1*******2*******3*******4* *******1******2*******3********4*

An'9SNAP*blot*

(low*exposure)*

↵SNAP9GLP91R*

***(full*length)*

↵SNAP9GLP91R**

***(N9terminal*fragment)*

1:*Vehicle**************

2:*Ex94*100*nM**

3:*Phe1*100*nM*

4:*Asp3*100*nM**

4*hours*incuba'on* 16*hours*incuba'on*

↵SNAP9GLP91R*

***(full*length)*

↵SNAP9GLP91R**

***(N9terminal*fragment)*

veh ex4 ex-phe1

4 h 16 h

anti- tubulin anti-SNAP (high exposure) anti-SNAP (low exposure)

N-terminal fragment full length SNAP-GLP-1R N-terminal fragment

b

ex4 ex-p

he1 ex-a

sp3 0

50 100 150

Surface GLP-1R (MFI, % vehicle)

* INS-1 832/3

g

h

ex4 ex-phe1 ex-asp3

MIN6B1INS-1 832/3

CHO-SNAP-GLP-1R

CHO-SNAP-GLP-1R

-10 -8 -6

0.0 0.1 0.2 0.3

Log [agonist] (M) Surface SNAP-GLP-1R (OD)

ex4 ex-phe1 ex-asp3

ex4 ex-p

he1 ex-a

sp3 0

5000 10000 15000

Surface GLP-1R (MFI)

*

* MIN6B1

a

plasma membrane cytoplasm

ex4ex-phe1 ex-asp3 veh ex4 ex-phe1 ex-asp3

full length SNAP-GLP-1R

GLP-1R DAPI ex4

ex-p he1 ex-a

sp3 0

50 100 150

Surface GLP-1R (MFI, % vehicle)

MIN6B1

**

ex4 ex-p

he1 ex-a

sp3 0

50 100 150

Surface GLP-1R (MFI, % vehicle)

INS-1 832/3

*

d

FACS

e

FACS

(12)

Supplementary Figure 5: Further analysis of surface GLP-1R down-regulation and degradation.

(a) Representative electron micrographs showing typical subcellular localization of SNAP-GLP-1R (labeled with cleavable SNAP-Surface-biotin plus streptavidin-10 nm-gold, arrows), 60 min agonist exposure; scale bars, 0.1 µm; images are from same experiments as in Fig. 2f. (b) Surface down- regulation of GLP-1R measured by surface ELISA in CHO-GLP-1R cells exposed to agonist for 16 h, n=5, table indicates relative agonist potencies compared by one-way randomized block ANOVA with Dunnett’s test vs. exendin-4. (c) Immunoblot indicating agonist-induced degradation of GLP- 1R in CHO-SNAP-GLP-1R cells after 4 and 16 h agonist exposure, representative result from n=2 experiments. (d) Surface down-regulation of GLP-1R in MIN6B1 cells, residual surface receptor labeled after 16 h agonist treatment and quantified by FACS, results normalized to vehicle control, n=4, one-way ANOVA with Dunnett’s test vs. exendin-4. (e) As for (d), but for INS-1 832/3 cells, n=4. (f) Immunofluorescence images demonstrating surface GLP-1R down-regulation in MIN6B1

and INS-1 832/3 cells; residual surface receptor labeled after 16 h agonist treatment; scale bars, 100 µm (MIN6B1) and 50 µm (INS-1 832/3). (g) and (h) Quantification of residual surface GLP-1R in experiments shown in (f), 5 images analyzed from n=3-5 coverslips, mean cellular fluorescence indicated (normalized for INS-1 832/3 to exendin-4), one-way ANOVA with Dunnett’s test vs.

exendin-4. Agonists applied at 100 nM except where indicated. * p<0.05, *** p<0.001, by statistical test indicated above. Error bars indicate SEM.

(13)

-12 -11 -10 -9 -8 -7 0

50 100

Log [agonist] (M)

cAMP (% GLP-1 max)

-12 -11 -10 -9 -8 -7

0 50 100

Log [agonist] (M)

cAMP (% GLP-1 max)

-12 -11 -10 -9 -8 -7

0 50 100

Log [agonist] (M)

cAMP (% GLP-1 max)

-10 -9 -8 -7 -6 -5

0 50 100

Log [agonist] (M)

βarr2 (% GLP-1 max)

ex4 ex-dHis1 ex-asn1 ex-gln1 ex-tyr1 ex-dTyr1 ex-phe1

-10 -9 -8 -7 -6 -5

0 50 100

Log [agonist] (M)

βarr2 (% GLP-1 max)

ex4 ex-ala2 ex-AIB2

-10 -9 -8 -7 -6 -5

0 50 100

Log [agonist] (M)

βarr2 (% GLP-1 max)

ex4 ex-asp3 ex-gln3 ex-dGln3

a b

ex4 dHis1 asn1 gln1 tyr1 dTyr1 phe1 ala2 AIB2 asp3 gln3 dGln3 -1

0 1

Exendin-4 substitution

log (bias) vs ex4

βarr2

cAMP

c

P1 P1

P2 P2

P3 P3

ex4 dHis1 asn1 gln1 tyr1 dTyr1 phe1 ala2 AIB2 asp3 gln3 dGln3 0

50 100

Exendin-4 substitution Arrestin recruitment (% GLP-1)

βarr1 βarr2

d

-10 -8 -6 -4

0 50 100

Log [agonist] (M) βarr1 response (%GLP-1 max)

-10 -8 -6 -4

0 50 100

Log [agonist] M βarr2 response (%GLP-1 max)

GLP-1 ex-phe1 ex-phe1 + GLP-1 150 nM

e f

(14)

Supplementary Figure 6: Biased signaling.

Note – these data are also summarized in Supplementary Fig. 1b. (a) cAMP responses, 90 min incubation, n=5, graphs arranged by substitution position (position 1 = “P1”, etc.). (b) As in (a) but for β-arrestin-2 recruitment. (c) Signaling bias, quantified as ΔΔlog(𝝉/KA) using data from (a) and

(b), error bars indicate 95% CI. (d) Comparison of β-arrestin1 and β-arrestin-2 responses, 1 µM agonist, 90 min incubation, expressed relative to GLP-1 response, n=3. Competitive antagonism by exendin-phe1 against GLP-1-induced (e) β-arrestin-1 recruitment, n=5, and (f) β-arrestin-2 recruitment, n=6. Exendin-phe1 and GLP-1 (150 nM) applied simultaneously for 90 min. All experiments performed in PathHunter CHO-GLP-1R cells. Except where indicated (bias plot), error bars indicate SEM.

(15)

0 20 40 60 0

50 100

Time (min)

Internalization (%)

ctrl siRNA βarr1/βarr2 siRNA

** ** **

a

INS-1 832/3

c

ctrl KD 0.0 0.5 1.0 1.5

Arrb1 expression

**

ctrl KD 0.0 0.5 1.0 1.5

Arrb2 expression

**

b

d

actinarrestin arrestinactin

ctrl

siRNA βarr1/βarr2 ctrl siRNA siRNA

g h

βarr1/βarr2 siRNA

e

ctrl KD 0.0 0.5 1.0 1.5

Arrb1 expression

***

ctrl KD 0.0 0.5 1.0 1.5

Arrb2 expression

**

MIN6B1

MIN6B1- SNAP-GLP-1R

βarr1/βarr2 siRNA

SNAP-Surface 488 DAPI ctrl siRNA

HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293'wt'

HEK293'Barr1/2'KO'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9'

vehicle' 10'min'Ex:4' 60'min'Ex:4' 60'min'Ex:4'+'3h'Ex9' HEK293- SNAP-GLP-1Rβarr-less HEK293- SNAP-GLP-1R

+ex4 +ex4

vehicle 10 min ex4 10 min ex4 60 min recycling 3 h

i

-14 -12 -10 -8 0

1 2 3

Log [ex4] (M) cAMP (normalized to receptor expression)

10 min 60 min

SNAP-Surface 488

k

DAPI

-14 -12 -10 -8 0

1 2 3

Log [ex4] (M) cAMP (normalized to receptor expression)

HEK293- SNAP-GLP-1R

βarr-less HEK293- SNAP-GLP-1R

j

INS-1 832/3 MIN6B1 EndoC βH1

Wildtype HEK293- SNAP-GLP-1R

βarr-less HEK293- SNAP-GLP-1R LogEC50 Emax Hill slope LogEC50 Emax Hill slope 10 min -9.5

(0.13)

1.47 (0.17)

0.83 (0.06)

-10.3*

(0.15)

1.78 (0.35)

0.92 (0.15) 60 min -10.2

(0.27)

1.08 (0.12)

0.97 (0.23)

-11.2*

(0.16)

2.60***

(0.52) 0.95 (0.15)

ctrl KD 0.0 0.5 1.0 1.5

Arrb1 expression

***

ctrl KD 0.0 0.5 1.0 1.5

Arrb2 expression

***

arrestinGAPDH

wt HEK293

βarr-less HEK293

f

(16)

Supplementary Figure 7: Effects of dual β-arrestin silencing.

(a) Knockdown efficiency determined by qRT-PCR in INS-1 832/3 cells at 72 h, relative to control (ctrl) RNAi, n=4, two-tailed t-test. (b) As for (a) but in MIN6B1. (c) Western blot demonstrating β- arrestin-1/2 protein knockdown in INS-1 832/3 cells at 72 h; 60.2% knockdown achieved after normalization for loading control. (d) As in (c) but for MIN6B1 cells, 77.3% knockdown achieved after normalization for loading control. (e) Knockdown efficiency in EndoC-βH1 lentivirally transduced with β-arrestin-1 and β-arrestin-2 shRNA, n=3, two-tailed t-test. (f) Western blot showing β-arrestin-1/2 knockout in β-arrestin-less (“βarr-less”) vs. wild-type HEK293 cells. (g) Representative image demonstrating delayed SNAP-GLP-1R internalization after dual β-arrestin knockdown in MIN6B1-SNAP-GLP-1R cells labeled with SNAP-Surface 488 prior to 15 min treatment with exendin-4; scale bars, 10 µm, n=2. (h) Effect of dual β-arrestin silencing on exendin-4-induced GLP-1R internalization (by FACS) in MIN6B1-SNAP-GLP-1R cells, n=3, two- way randomized block ANOVA with Sidak’s test. (i) Delayed SNAP-GLP-1R endocytosis in β- arrestin-less vs. wild-type HEK293 cells stably expressing SNAP-GLP-1R, labeled before agonist stimulation with SNAP-Surface-488, n=3. (j) cAMP responses to exendin-4 in β-arrestin-less vs.

wild-type HEK293-SNAP-GLP-1R cells at 10 min and 60 min, no IBMX, n=3. (k) Quantification of responses shown in (i), curve fitting by 4-parameter logistic fit, parameters compared with paired two-way ANOVA with Sidak’s test for β-arrestin-less vs. wild-type. Agonists applied at 100 nM except where indicated. * p<0.05, ** p<0.01, *** p<0.001 by statistical test defined in the text. Error bars (and bracketed numbers in table) indicate SEM.

(17)

Supplementary Figure 8: Inhibition of endocytosis.

(a) Microscopy demonstrating effect of metabolic inhibitor cocktail (20 min pre-treatment) on 100 nM, 10 min exendin-4-induced internalization in CHO-SNAP-GLP-1R cells. (b) As for (a) but measurement by DERET, n=2. Error bars indicate SEM.

-15 0 15 30

1 2 3

Time (min)

Internalization (fold increase) vehicle ex4 ex4 + metabolic inhibitors

a

CHO-SNAP-GLP-1R

b

CHO-SNAP-GLP-1R

no inhibitor +metabolic inh

vehicle+ex4

SNAP-Surface-488 DAPI

(18)

a

0 2 4 6 8 0

5 10 15

Time (h)

Glucose (mM)

vehicle

ex4 0.24 nmol/kg ex-phe1 0.24 nmol/kg ex4 2.4 nmol/kg ex-phe1 2.4 nmol/kg

vehicle ex4 0.24

ex-p he1

ex4 2.4 ex-p

he1 2.4 -40

-20 0

Glucose AUC (mM.hr) *

*** *

b

1 4 7 10 13 16 19 0.0

0.5 1.0

Time bin (3 min)

Proportion of mice

Vehicle

1 4 7 10 13 16 19 0.0

0.5 1.0

Time bin (3 min)

Proportion of mice

Ex4 2.4 nmol/kg

1 4 7 10 13 16 19 0.0

0.5 1.0

Time bin (3 min)

Proportion of mice

Ex-phe1 2.4 nmol/kg

Feeding Drinking Pica Activity Stationary

c

vehicle ex4 ex-p

he1 LiCl 0.0

0.5 1.0

Preference (grape / total)

**

ns

d

0 20 40 60

0 10 20 30 40

Time (min) Glucose (mM) ** *** ***

vehicle ex4

ex-p he1 0

500 1000 1500 2000

AUC glucose (mM.min)

ns **

***

0 2 4 6 8 0

1 2 3

Time (h)

Cumulative FI (g)

e f g

CTA 2.4 nmol/kg 8h IPGTT 0.24 nmol/kg 0.24 nmol/kg FI

1 4 7 10 13 16 19 0.0

0.5 1.0

Time bin (3 min)

Proportion of mice

Vehicle

1 4 7 10 13 16 19 0.0

0.5 1.0

Time bin (3 min)

Proportion of mice

Ex4 0.24 nmol/kg

1 4 7 10 13 16 19 0.0

0.5 1.0

Time bin (3 min)

Proportion of mice

Ex-phe1 0.24 nmol/kg

Feeding Drinking Pica Activity Stationary

j

CTA 0.24 nmol/kg

vehicle ex4 ex-p

he1 LiCl 0.0

0.5 1.0

Preference (cherry / total)

**

ns

h

i

vehicle ex4 ex-p

he1 0

1 2 3

Pica (number of observations)

ns

0 30 60 90

0 10 20 30 40

Time (min)

Glucose (mM)

vehicle ex4 ex-dHis1 ex-asn1 ex-gln1

ex-dTyr1 ex-phe1 ex-asp3 ex-dGln3

k

8h IPGTT 2.4 nmol/kg Pica 0.24 nmol/kg

(19)

Supplementary Figure 9: Further in vivo results.

(a) Effect of single IP agonist injection at the indicated dose on blood glucose in HFHS mice, n=9- 10 per group. (b) AUC calculated from (a), relative to baseline glucose at t=0, one-way ANOVA with Tukey’s test. (c) Behavioral satiety study in fasted lean mice injected with 2.4 nmol/kg agonist IP, with indicated behaviors monitored after return of food provision, at 3-minute intervals for 60 min, n=7-8 per treatment. (d) Conditioned taste aversion in lean mice trained to associated indicated stimulus with grape Kool-Aid flavor and then given free choice of water or Kool-Aid;

agonist dose 2.4 nmol/kg, LiCl (0.15 M in a volume equivalent to 2% body weight) used as positive control; n=8/group, one-way ANOVA with Holm-Sidak test. (e) Blood glucose during IPGTT (2 g/kg) in HFHS mice 8 h after IP injection of agonist (0.24 nmol/kg), n=8 per group, two-way repeated-measures ANOVA with Tukey’s test, significance shown for exendin-phe1 vs. exendin-4.

(f) AUC calculated from (d), relative to baseline glucose at t=0, one-way ANOVA with Tukey’s test.

(g) Cumulative food intake in fasted HFHS mice after IP injection of agonist (0.24 nmol/kg), n=8 per group. (h) As for (c) but 0.24 nmol/kg, n=10-11 per treatment. (i) Quantification of pica behavior from (i), Mann-Whitney test comparing exendin-4 vs. exendin-phe1. (j) As for (d) but agonist dose 0.24 nmol/kg, cherry Kool-Aid. (k) Blood glucose during IPGTT (2 g/kg) in lean, chow-fed mice performed 8 h after IP injection of indicated agonist (2.4 nmol/kg), n=4 per group. (l) Representative liver haematoxylin/eosin stained sections after 16 days continuous administration of agonist (0.24 nmol/kg/day) or vehicle, as used to calculate NAS score (Fig. 9g); scale bars, 10 µm. Data expressed as mean ± SEM. * p<0.05, ** p<0.01, *** p<0.001, by statistical test defined in the text.

vehicle ex4 ex-phe1

l

(20)

0 2×105 4×105

0 200 400 600

GLP-1R internalization (RFU)

Insulin release (pmol/L) 0 2×105 4×1050

200 400 600 800

GLP-1R internalization (RFU)

Insulin release (pmol/L)

-12 -10 -8 -6 0

100 200 300 400

Log [agonist] (M) Insulin release (pmol/L)

-10 -8 -6

0 2×105 4×105

Log [agonist] (M) GLP-1R internalization (RFU)

0 2×105 4×105

0 10 20

GLP-1R internalization (RFU)

cAMP (nmol/L)

IBMX IBMX / ex4

-12 -10 -8

0 100 200 300 400

Log [agonist] (M)

cAMP (nmol/L)

-10 -8 -6

0 5000 10000 15000 20000

Log [agonist] (M)

βarr1 (RLU)

-10 -8 -6

0 20000 40000 60000 80000

Log [agonist] (M)

βarr2 (RLU)

ex4 Lixisenatide Liraglutide Dulaglutide Semaglutide 0

20 40 60

Residence time (min)

** *

ex4 Lixisenatide Liraglutide Dulaglutide Semaglutide 0

50 100

Internalization (%) ex4 Lixisenatide Liraglutide Dulaglutide Semaglutide0 50

100

Recycling (%)

a b c

d

e

f

g

h i j

INS-1 832/3 MIN6B1 CHO-SNAP-GLP-1R

INS-1 832/3

INS-1 832/3

FACS trafficking, MIN6B1-SNAP-GLP-1R

cAMP βarr1 βarr2

Ex-4

Time (min) +MesNa -MesNa +MesNa -MesNa +MesNa -MesNa +MesNa -MesNa +MesNa -MesNa 0 1358 4007 474 1677.3 431 1279.5 726.5 2656.5 823 2469 15 3481 3807 1740 1807 918 1034 2900 2910 2241 2489 30 3437 3872 1700 1877 997 1055 2713 2810 1887 2094 60 3541 3848 1750 1844 801 863 2285 2366 1830 2081 Ex-Phe1

Time (min) +MesNa -MesNa +MesNa -MesNa +MesNa -MesNa

0 1358 4007 705 2821 654 2885

15 1970 3640 1031 2224 993 2218 30 2695 3973 1204 2303 879 1630 60 2531 3519 1178 1954 1067 1684 Ex-Asp3

Time (min) +MesNa -MesNa +MesNa -MesNa +MesNa -MesNa 0 1358 4007 1187 3599 874 3615 15 3008 3467 3606 3984 3101 3664 30 3430 3914 3285 3358 2948 3307 60 3232 3743 3240 3285 2967 3143

Exp1 Exp2 Exp3

Exp1 Exp2 Exp3 Exp4 Exp5

Exp1 Exp2 Exp3

(21)

Supplementary Figure 10: Selected non-normalized data sets.

(a) Results from Fig. 1a, replotted to show absolute supernatant insulin concentration and loss of Lumi4-Tb-labelled cell surface SNAP-GLP-1R as relative fluorescence units (RFU). (b) As for (a), but referring to Fig. 1b. (c) Results from Fig. 1f, replotted to show loss of Lumi4-Tb-labelled cell surface SNAP-GLP-1R in RFU. (d) Results from Fig. 1g, replotted to show absolute supernatant insulin concentration. (e) Raw data from Fig. 2b, given here as median fluorescence units for each experiment. (f) Data from Fig. 3e, replotted to show absolute cAMP concentration against loss of Lumi4-Tb-labelled cell surface SNAP-GLP-1R in RFU. (g) Dose responses in PathHunter CHO-K1 cells replotted from Fig. 4c to show absolute cAMP concentration, and β-arrestin recruitment in relative luminescence units (RLU). (h) Agonist residence time, replotted from data in Fig. 6a to show absolute residence time in min. (i) GLP-1R internalization, as shown in Fig. 6e, replotted relative to vehicle treatment. (j) SNAP-GLP-1R recycling, as shown in Fig. 6f, replotted as % of internalized receptor undergoing recycling back to plasma membrane. Error bars indicate SEM.

(22)

Supplementary Figure 11: Full scans of all blots presented in cropped form in figures in the primary and supplementary manuscript texts.

Figure 2h

Supplementary Figure 5c

Supplementary Figure 7c, d, f

(23)

Supplementary Figure 12: Individual red and green channels from merged RGB images shown in the main figures.

Blue in merged, DAPI.

Figure 2e

Figure 4e

Figure 5e

Figure 7a

SNAP-Surface 549 FITC Merged

Insulin GLP-1R Merged

SNAP-Surface 549 βarr2-GFP Merged

Rab11 FITC Merged

(24)

Supplementary Table 1: Target shRNA / siRNA sequences used in this study.

Target and description Sequence(s)

Human arrb1, lentiviral shRNA GAACTGCCCTTCACCCTAATG Human arrb2, lentiviral shRNA CTTCGTAGATCACCTGGACAA

Mouse arrb1, siRNA

UGGAUAAGGAGAUCUAUUA GGAGAACCCAUCAGCGUUA UCAUAGAGCUUGACACCAA ACGGGAAGCUCAAGCAUGA

Mouse arrb2, siRNA

GGGCCUGUCUUUCCGCAAA CUACUUGAAGGACCGGAAA AUACCAACCUCAUCGAAUU GUGCCAAAUCAAUAGAAGA Rat arrb1, siRNA (Silencer Select s129662) GAACUGCCCUUUACCUUAATT Rat arrb2, siRNA (Silencer Select s129665) GCUUAUCAUCAGAAAGGUATT

(25)

Supplementary Table 2: List and characteristics of human islet donors included in this study, including date and location of isolation.

Date Isolation centre Age Gender BMI (kg/m2)

09/02/2016 Geneva 37 Female 25.2

07/04/2016 Pisa 72 Male 27.4

13/04/2016 Edmonton 42 Male 33.3

20/04/2016 Edmonton 54 Male 28.7

19/05/2016 Pisa 61 Male 23.1

25/05/2016 Pisa 58 Male 26.1

27/05/2016 Edmonton (Macdonald) 55 male 23.6 01/06/2015 Edmonton (Macdonald) 28 Male 23.4 01/06/2016 Edmonton (Shapiro) 25 Male 20.8

01/06/2016 Oxford 63 Male 23

08/06/2016 Edmonton (MacDonald) 54 Female 23.4 15/06/2016 Edmonton (Shapiro) 36 Female 28.8

12/07/2016 Pisa 68 Male 21.5

14/07/2016 Milan 61 Male 27.8

22/09/2016 Pisa 75 Male 22.9

23/09/2016 Edmonton (MacDonald) 66 Female 33.1

(26)

Supplementary Table 3: qRT-PCR primer sequences used in this study.

Target and

description Sequence(s)

Human arrb1 F: GCGGTGTGGACTATGAAGTCAA R: ACAGAATTCCGCTTGTGGATCT Human arrb2 F: GACCGTCAAGAAGATCAAAGTCTCT

R: GAGATACCTGGTCATCTTGTTCGA Mouse arrb1 F: CCAGACAGTTCCTTATGTCAGACAA

R: TTCTCCGTGGTAATAGATCTCCTTATC Mouse arrb2 F: ACCACACGCCACTTCCTCAT

R: CCCGTGGTAGTACAGCTCTTTGT Rat arrb1,

Taqman assay Rn01648673_m1

Amplicon context sequence:

GAAGCTGGGCGTTGAGATCCCGCCAAACCTTCCGTGCTCAGTCATTGAGATCCCGCCAAACCTTCCGTGC TCAGTCA

Rat arrb2, Taqman assay Rn01456874_g1

Amplicon context sequence:

CCACTTCCTCATGTCTGACCGGAGGTCCCTGCACCTAGAGGCTTCCCTGGACAAAGAGCTGTACTACCAT GGGGAACCCCTCAATGTCAACGTCCACGTCACCAACAATTCTGCCAAGACCGTCAA

Références

Documents relatifs

HCC = Hepatocellular carcinoma; HOMA = Homeostasis model assessment; HSC = Hepatic stellate cell; LC = Long chain; LC-MS = Liquid chromatography mass spectrometry; Lira = Lira-

Type 2 Diabetes Mellitus (T2DM) leads to bone fragility and predisposes to increased risk of 19.. fracture, poor bone healing and other

1 As they noted, opioid use disorder has a considerable public health effect in terms of morbidity and mortality, and it is essential that eligible patients are offered opioid

Maintaining himself loyal to Hegel, he accepts the rel- evance of civil society, but always subordinate to the State, the true “we”, as the interests of the civil society and the

Remarkably, LPSs also stimulated GLP-1 secretion in humans, and GLP-1 levels were rapidly increased in humans with acute experimental intestinal ischemia.. Hence, gut barrier

• étude exploratoire de la substitution de l ’’ ’ ’ insuline basale par un agoniste du GLP-1 chez des patients sous traitement.

To explore the potential adversity of chronic injections of a5IA, another group of euploid mice was treated for 2 weeks (5 mg/kg, five injections/week; five a5IA-treated mice;

et une méta-analyse des données des essais plus récents évaluant des stratégies de contrôle glycémique ambitieux chez des patients avec un diabète plus ancien, souvent