Analysis of the intracellular localisation and alternatively spliced isoforms of splicing factor 1

(1)

Thesis

Reference

Analysis of the intracellular localisation and alternatively spliced isoforms of splicing factor 1

CHOLEZA, Maria

Abstract

Splicing factor 1 is a protein with several isoforms produced by alternative splicing of a single premRNA. These isoforms share a common N-terminal half and have distinct C-terminal portions. In this study, isoforms of SF1 in different cell lines and tissues were identified, and their composition was investigated in different tissues. The results suggest that SF1 isoforms are expressed in a tissue-specific manner. The function of SF1 and its isoforms is not clear.

To provide information towards that, we used fluorescence microscopy and demonstrated that SF1 is a new component of paraspeckles. Paraspeckles are formed around non-coding RNAs and although their function is not known, their protein content points to a role in transcriptional control and RNA metabolism. SF1 has been shown previously to bind to a number of ncRNAs. Results from this thesis support the above finding and show that ncRNAs present in paraspeckles associate with SF1.

CHOLEZA, Maria. Analysis of the intracellular localisation and alternatively spliced isoforms of splicing factor 1. Thèse de doctorat : Univ. Genève, 2009, no. Sc. 4144

URN : urn:nbn:ch:unige-50979

DOI : 10.13097/archive-ouverte/unige:5097

Available at:

http://archive-ouverte.unige.ch/unige:5097

Disclaimer: layout of this document may differ from the published version.

(2)

UNIVERSITE DE GENEVE FACULTE DES SCIENCES Département de biologie cellulaire Professeur Angela Krämer

Analysis of the intracellular localisation and alternatively spliced isoforms of splicing factor 1

THESE

présentée à la Faculté des sciences de l’Université de Genève pour obtenir le grade de Docteur ès sciences, mention biologie

par

Maria Choleza

de

Athènes (Grèce)

Thèse N°

GENEVE 2009

(3)

Acknowledgements

Thank you to…

Angela Krämer, for accepting me in her laboratory and for all advice and support during the four years of my thesis. My thesis jury, Karla Neugebauer and Françoise Stutz, for reading and evaluating my work. The ‘’Krämer family’’, Goranka, Goran, Julian, Silvia, Nicolas, Mireille, Flore, Ivona and Julie for all scientific discussion and for creating a nice and friendly atmosphere in the lab. Thanks to Silvia and Ivona for the after work recreation times! Special thanks to Mireille for all her technical support throughout my thesis, for sharing unforgettable lab moments in 2016, as well as for just being Mireille! Thanks to my good friend Tony, who ‘’stably transfected’’ me with the passion for research. Thanks to all my friends here in Switzerland, who made Geneva look sunnier in its cold, cloudy days. Last but most importantly, thanks to my family and my little bear… without you I would never have come as far…

(4)

…to my parents…

… στους γονεις μου …

(5)

Abstract

(11)

A. Abstract

Splicing factor 1 (SF1) was initially purified as a heat-resistant 75-kDa protein required for early spliceosome assembly. It is encoded by 14 exons and cDNAs encoding several SF1 isoforms, produced by alternative splicing of a single pre-mRNA, have been described in human and mouse. These isoforms share a common N-terminal half containing two nuclear localisation signals, a nuclear export signal, a U2AF⁶⁵ interaction domain, a KH-QUA2 domain required for the binding of the protein to pre- mRNA, and a zinc-knuckle that increases the affinity of SF1 for RNA. The C-terminal portions of the SF1 isoforms are distinct, containing Ala or Pro-rich regions of different length involved in protein-protein interactions. We have previously cloned 11 SF1 cDNAs from HeLa cells, six of which have not yet been described.

The function of SF1 has not been completely elucidated. Moreover, it is not clear at present whether SF1 isoforms have different functions. The highly conserved N- terminal part of the protein is responsible for its activity in pre-spliceosome assembly and more specifically in the formation of complex E. The role of the divergent C- terminal part is unclear. Previous studies have shown that SF1 is essential for viability in S. cerevisiae, C. elegans and mammalian cells. It has also been proposed that it has a kinetic role in splicing, a role in splicing of pre-mRNAs with suboptimal splice sites and in alternative splicing. Apart from splicing, it has been suggested that SF1 is involved in transcriptional regulation and nuclear pre-mRNA retention. Finally, it has been shown that SF1 shuttles continuously between the nucleus and the cytoplasm, suggesting an additional function in the cytoplasm.

The aim of the first part of this work was to provide information as to the function of SF1 protein and the role(s) of its isoforms. As a first step towards this goal, the intracellular distribution and dynamics of different SF1 isoforms in HeLa cells was determined, using fluorescence microscopy as a tool. The results presented here demonstrate that SF1 is a new component of paraspeckles and shares many characteristics with other proteins of the paraspeckles. The function of paraspeckles is not known, but their protein content points to a role in transcriptional control and RNA metabolism. Preliminary data from this study strongly suggest that paraspeckles are not involved in splicing. A role for these subnuclear structures in the retention of a non- coding RNA (ncRNA) that is released after stress has also been previously reported. A link between paraspeckles and stress is also implied by our current data. In addition,

(12)

SF1 has been shown previously to bind to a number of ncRNAs in in vivo cross-linking experiments. The results from the second part of this thesis support the above finding and show that the ncRNAs Malat-1 and Men-ε/β are present in paraspeckles and that at least Men-ε/β associates with SF1.

In the last part of this study isoforms of SF1 in different cell lines and tissues were identified, and the composition of the isoforms was investigated in different tissues.

The results presented here show that the N-terminal part of SF1 is common to all isoforms. An alternative splicing event was however observed which has been previously demonstrated in Drosophila and which produces a transcript skipping exon 3 and carrying a premature stop codon. Our data show that this isoform is probably degraded by the nonsense-mediated mRNA decay (NMD) machinery. At the C- terminal part no new isoforms were identified. Our results further suggest that SF1 isoforms are expressed in a tissue-specific manner.

(13)

Introduction

(14)

B. Introduction

B.1. Pre-mRNA splicing

In eukaryotes, the flow of genetic information from DNA to mRNA to protein involves the processes of transcription, pre-mRNA processing and translation. DNA is transcribed into an mRNA precursor (pre-mRNA) in the nucleus and is extensively processed before it reaches the cytoplasm to be translated. Pre-mRNA processing comprises capping at the 5’ end, polyadenylation at the 3’ end and the removal of introns by the process of splicing.

Splicing is the most important step in the expression of genetic information and essential for mRNA to be correctly translated into protein. During splicing, stretches of non-coding regions (introns) are removed from the pre-mRNA and protein-coding sequences (exons) are stitched together in a continuous manner to form the mature mRNA. Correct splicing is essential for cells. If introns are not properly removed from primary transcripts, the aberrantly spliced mRNA is translated into proteins that are non-functional or even deleterious to the cell.

For many genes, introns of a single pre-mRNA can be spliced in different ways, giving rise to distinct mRNAs. These are subsequently translated into different protein isoforms, producing more than one protein from a single gene, in contrast to the ‘one gene, one protein’ rule (Matlin et al., 2005). The mechanism of differential inclusion or exclusion of regions of the pre-mRNA is termed alternative splicing and is used by higher eukaryotes to produce functionally distinct protein isoforms from a single RNA transcript, thus increasing proteomic diversity. In humans, more than 80% of the pre- mRNAs are alternatively spliced, and the best example of protein diversity that can be achieved by alternative splicing is the Dscam pre-mRNA in Drosophila, which generates 38,016 predicted isoforms. The modes of alternative splicing are summarized in Figure 1. Approximately half of the alternative splicing events result in changes in the reading frame of a protein. One third of these changes introduce premature termination codons into the mRNA, followed by degradation of the mRNA by nonsense-mediated decay (NMD) (Silva and Romao, 2009).

(15)

Figure 1. Modes of alternative splicing. Alternative splicing occurs in five main modes: exon inclusion or exclusion, mutual exclusion of exons, retention of an intron, and duplication of 5’ or 3’ splice sites. All of these alternative splicing patterns give rise to distinct mRNA transcripts and subsequently protein isoforms.

Although self-splicing introns (ribozymes) exist in pre-mRNAs of lower eukaryotes, the steps that lead to the removal of introns from vertebrate pre-mRNAs are catalysed by a large, highly dynamic complex, the spliceosome.

The spliceosome

Two types of introns exist, the major (or U2-type) and the minor (or U12-type) introns, which are removed by the major and minor spliceosomes, respectively. Most pre- mRNA introns are of the U2-type, while minor introns are present in a small number of pre-mRNAs of some metazoa and plants (Patel and Steitz, 2003).

The major spliceosome (referred to simply as spliceosome) is a highly dynamic macromolecular machine formed from five small nuclear ribonucleoprotein subunits (U1, U2, U4, U5 and U6 snRNPs) and more than 100 non-snRNP splicing factors (RNA-binding proteins, RNA helicases, etc.) (Jurica et al., 2002; Jurica and Moore, 2003; Rappsilber et al., 2002; Zhou et al., 2002). It is widely accepted that the spliceosome assembles de novo and in a stepwise manner at each cycle of splicing through a series of intermediate complexes (E, A, B, B* and C, the active spliceosome). During formation of these complexes, snRNPs and non-snRNP proteins

(16)

are recruited and released from the pre-mRNA at different stages (Figure 2) (Wahl et al., 2009).

Figure 2. Schematic representation of spliceosome assembly (Will and Lührmann, 2006).

The spliceosome assembles in a stepwise manner, through formation of individual complexes:

E, A, B, B* and C. During the assembly five snRNPs and many non-snRNP proteins are recruited and released from the complexes in a highly regulated process, to finally give rise to the active spliceosome, complex C. SF1 is involved in the very early steps of spliceosome assembly, in the formation of complex E, and is displaced by U2 snRNP during the formation of complex A (not indicated in the figure).

However, several observations suggest that the U1 and/or U2 snRNPs interact with the U4/U6/U5 tri-snRNP prior to binding the pre-mRNA. Stevens and coworkers (Stevens et al., 2002) have isolated a large RNP complex from yeast, termed penta- snRNP, which contains all five snRNPs and more than 60 proteins, and is functional in splicing. This penta-snRNP was proposed to bind to pre-mRNA as a pre-assembled complex and become catalytically active after stabilisation of spliceosome-RNA interactions. Later studies in yeast employing chromatin immunoprecipitation analysis, supported a stepwise recruitment of the U snRNPs during spliceosome assembly (Gornemann et al., 2005; Tardiff and Rosbash, 2006). In addition, Behzadnia et al.

(17)

(Behzadnia et al., 2006) also demonstrated that in the human system, at least in vitro, spliceosome assembly does not require the formation of a holospliceosome.

Splicing reaction

For splicing to occur, components of the splicing apparatus recognize and specifically bind conserved, essential nucleotide sequences located at the exon-intron borders (Figure 3). These sequences include the 5’ and 3’ splice sites (ss), a polypyrimidine (poly-Py) tract preceding the 3’ ss, and the branch point sequence (BPS) located 18 to 40 nucleotides upstream of the 3’ ss.

Figure 3. Essential nucleotide sequences at the exon-intron borders (Pagani and Baralle, 2004). Several conserved motifs in the nucleotide sequences near the intron–exon boundaries act as essential splicing signals: GU and AG dinucleotides at the exon–intron 5’ splice site and intron–exon 3’ splice site junctions respectively, a polypyrimidine tract (Py)n and an Adenine (A) nucleotide at the branch point sequence.

Additional sequences of importance in splicing are found both in the introns and exons and are termed intronic and exonic splicing enhancers or silencers. These sequences are recognized by SR proteins, a family of nuclear factors with significant roles in constitutive splicing and in the regulation of alternative splicing (Fu, 1995).

Interestingly, SR proteins have been shown to play multiple roles in the cell and are now considered as major regulators of gene expression coupling transcription to splicing and participating in mRNA nuclear export, NMD, and translation (Long and Caceres, 2009; Zhong et al., 2009). In general, SR proteins function as positive splicing regulators, whereas hnRNP proteins, which also bind the regulatory elements, have negative effects.

After recruitment of spliceosome components by sequence-specific recognition and spliceosome assembly, the activated spliceosome, complex C, catalyses the excision

(18)

of the intron and the ligation of the 5’ and 3’ exons in two sequential transesterification reactions (Figure 4). The first reaction involves a nucleophilic attack of the 2’ hydroxyl group of the conserved adenosine of the BPS on the phosphodiester bond at the 5’ ss.

Subsequently, the 5’ terminal guanosine of the intron is covalently attached to the branch site adenosine in an unusual 2’-5’ phosphodiester bond forming the lariat intermediate. The second transesterification reaction then follows with the attack of the free 3’ hydroxyl group of the 5’ exon on the phosphodiester bond at the 3’ ss, leading to the displacement of the lariat intron and the joining of the two exons.

Figure 4. The splicing reaction (Griffiths et al., 1999). Splicing of pre-mRNAs takes place in two transesterification reactions. In the first reaction, the 2'-hydroxyl group of the A residue at the branch site attacks the phosphate at the 5'-ss. This leads to cleavage of the 5' exon from the intron and the formation of a lariat intermediate. The second step involves the phosphate at the 3' end of the intron and the 3'-hydroxyl group of the cleaved 5’ exon. This transesterification reaction releases the intron, and ligates the two exons.

(19)

B.2. Splicing factor 1

SF1 was first identified in 1992, when it was purified as a heat-resistant 75-kDa protein implicated in the early steps of spliceosome assembly (Krämer, 1992). It was later found to be involved in the formation of complex E by specifically binding to the BPS of introns, and hence was named mBBP (mammalian branchpoint binding protein) (Berglund et al., 1998).

Functions of SF1

So far, the function(s) of SF1 has not been completely elucidated. The highly conserved N-terminal part of the protein is responsible for the activity of SF1 in spliceosome assembly (Rain et al., 1998), whereas the role(s) of the different C- terminal parts (section B.2) is unclear. SF1 has been reported to be essential for viability in S. cerevisiae (Rain et al., 1998), C. elegans (Mazroui et al., 1999) and mammalian cells (Tanackovic and Krämer, 2005), implying an important cellular function. It has also been proposed that its role in splicing is limited to increasing the kinetics of spliceosome assembly and thus the splicing reaction (Guth and Valcarcel, 2000; Rutz and Seraphin, 1999). In yeast, a role for SF1 in splicing of pre-mRNAs with suboptimal splice sites (Rutz and Seraphin, 2000) has been demonstrated, while the protein also appears to be involved in alternative splicing in mammalian cells (Shitashige et al., 2007a); Corioni et al., in preparation). Furthermore, SF1 has been shown to bind to several transcription factors and is thus implicated in transcriptional regulation (Goldstrohm et al., 2001; Zhang and Childs, 1998; Zhang et al., 1998). In addition, studies in yeast proposed that SF1 has a role in nuclear pre-mRNA retention (Galy et al., 2004; Rutz and Seraphin, 2000). Finally, it has been shown that SF1 can shuttle between the nucleus and the cytoplasm (G. Moreau and A. Krämer, unpublished data), suggesting an additional function in the cytoplasm.

SF1 in splicing

E complex formation and SF1

Complex E is the first specific complex formed in spliceosome assembly and SF1 is required for its formation in vitro (Abovich and Rosbash, 1997). During assembly of complex E, U1 snRNP binds to the 5' ss (Black et al., 1985; Mount et al., 1983). In addition, SF1 forms a complex with the U2 snRNP auxiliary factor heterodimer

(20)

(U2AF⁶⁵ and U2AF³⁵) by binding to U2AF⁶⁵, and together they cooperatively associate with the BPS and poly-Py tract at the 3’ ss, respectively (Berglund et al., 1998; Rain et al., 1998; Selenko et al., 2003). In the following step, the formation of complex A, the U2 snRNP is recruited to the BPS through interactions with U2AF⁶⁵. This recruitment displaces SF1 from the pre-mRNA, the branch site adenosine is now in close contact to a subunit of SF3b and the BPS is base-paired to U2 snRNA (Gozani et al., 1998;

Rutz and Seraphin, 1999).

Recently, another complex (E’) has been identified, which is a precursor of complex E (Kent et al., 2005). This complex assembles in a U2AF⁶⁵ and BPS-independent manner and contains U1 and SF1 bound to the 5’ and 3’ ss, respectively.

The role of SF1 in splicing

Although SF1 clearly participates in the early steps of spliceosome formation, its exact role in splicing remains obscure. From work in yeast it became evident that S.

cerevisiae (Sc)SF1 (or BBP) is specifically required for the formation of commitment complex (CC) 2, whereas it is not present in subsequent splicing complexes (Rutz and Seraphin, 1999). CC1 and CC2 are the yeast equivalent of mammalian complex E.

Moreover, depletion of ScSF1 to 99% did not impair either spliceosome formation or splicing in vitro, but rather decreased the transition rate from CC1 to CC2 (Rutz and Seraphin, 1999, 2000). This data suggests a role for SF1 in the kinetics of spliceosome formation. Furthermore, these authors proposed a model in which SF1 is recycled after the CC2 to pre-spliceosome transition step and thus small amounts of SF1 are sufficient for splicing. Additional support for a kinetic role of SF1 in splicing emerged from work with HeLa cells, where depletion of SF1 from nuclear extracts did not have major effects on spliceosome assembly and splicing; in addition, a mutated consensus BPS or depletion of SF1 led to a slower recruitment of the U2 snRNP to the pre-mRNA (Guth and Valcarcel, 2000). It has therefore been proposed that SF1 facilitates the recruitment of U2 snRNP to the BPS, accelerating the transition from complex E to complex A, and thus pre-spliceosome formation and splicing. SF1 has also been shown, at least in vitro, to have a role in splicing of only a subset of introns carrying weak or mutated 5’ ss and/or BPS, rather than affecting general splicing (Rutz and Seraphin, 2000). Taken together, the data mentioned above imply that SF1 has a kinetic role in splicing and greatly affects splicing of introns with suboptimal splice sites.

(21)

The role of SF1 in alternative splicing

Apart from its role in constitutive splicing SF1 has also been implicated in the alternative splicing of a number of pre-mRNAs, some of which are linked to disease.

More specifically, SF1 has been shown to be involved in the alternative splicing of a pre-mRNA encoding histocompatibility leukocyte antigens (HLA) (Kralovicova et al., 2004). HLA genes harbor several single nucleotide polymorphisms (SNPs). Some of these SNPs change the splicing pattern of the pre-mRNA and predispose individuals to autoimmune disorders. In the HLA-DQB1 gene, certain of these polymorphisms are located within the BPS of intron 3 and cause skipping of exon 4. The resulting HLA- DQB1 isoform lacks the transmembrane domain of the protein and is thus released by the cell inducing apoptosis and autoimmune responses. It has been demonstrated that these SNPs impair binding of SF1 to the BPS, and it has been proposed that failure of SF1 binding causes a defect in early spliceosome assembly and subsequent removal of intron 3. Alternative splicing in this case is therefore controlled by differential recognition of the BPS by SF1.

SF1 has also been shown to induce splice variants of estrogen receptor beta (ERβ), Wnt-induced secreted protein 1 (WISP1), a connective tissue growth factor, and fibroblast growth factor receptor-3 (FGFR3) protein (Shitashige et al., 2007a). In particular, over-expression of SF1 in various cell lines favored the expression of variants of these proteins that are well known to be cancer-related (ERβΔ5-6, WISP1v, and FGFR3R-ATII). Although the exact mechanism of the induction is not known, it is clear that SF1 is involved in the differential selection of splice sites.

A role for SF1 in alternative splicing has also been demonstrated in S. pombe (Haraguchi et al., 2007). It was demonstrated that mutations either in the BPS region of an artificial intron of a gene inserted in the pre-mRNA of another gene, or in the SF1 protein, lead to exon skipping.

Consistent with its proposed regulatory role in splicing, SF1 has also been found to bind to an intronic splicing enhancer (ISE) in the 6-nt microexon 17 of the chicken cardiac troponin T (cTNT) gene (Carlo et al., 2000). In general, although short exons are spliced in vertebrates, artificially shortened exons are not efficiently spliced and ISEs are employed to enhance intron-exon recognition. In the case of cTNT, the ISE of microexon 17 is bound by SF1, leading to efficient recognition of the upstream exon during exon definition. These results suggest that SF1 acts as a splicing enhancer for

(22)

small exons, extending the domain of the exon during the early steps of spliceosome assembly and therefore favoring its recognition (Carlo et al., 2000).

SF1 in pre-mRNA retention

In eukaryotic cells, pre-mRNA splicing is essential before transcripts are exported to the cytoplasm. Transport of unspliced RNAs to the cytoplasm would result in an accumulation of aberrant proteins that could be deleterious to the cell. The cell therefore has evolved mechanisms for distinguishing spliced from unspliced RNA and for retaining unspliced RNA in the nucleus. Although these mechanisms are not entirely clear, the splicing reaction and several splicing factors are important for this process. More specifically, a relationship between splicing and pre-mRNA nuclear retention was provided by work on the HIV-1 Rev protein, where it was shown that unspliced viral mRNA is retained in the nucleus, and this retention can only be overcome in the presence of Rev response elements (Chang and Sharp, 1989). In addition, an intact 5’ ss and BPS were shown to be required for the nuclear retention of pre-mRNAs (Legrain and Rosbash, 1989; Rain and Legrain, 1997). In the same studies, it was further demonstrated that mutations impairing the activity of splicing factors Prp6, Prp9 and Mud2 (the homologue of U2AF⁶⁵ in yeast), and in the U1 snRNA cause cytoplasmic leakage of pre-mRNAs.

As mentioned previously, SF1 depletion has been shown to be lethal in S. cerevisiae, C. elegans and human cells (Abovich and Rosbash, 1997; Mazroui et al., 1999; Rain et al., 1998; Tanackovic and Krämer, 2005). The reasons for this lethality are not clear.

Work in yeast suggests that splicing defects are most likely not responsible for lethality, as depletion of or mutations in ScSF1 have little or no effect on either spliceosome formation or splicing in vitro and in vivo (Rutz and Seraphin, 1999, 2000).

It has therefore been suggested that the essential function of SF1 could be related to the retention of pre-mRNAs in the nucleus (Galy et al., 2004; Rutz and Seraphin, 2000). In particular, conditional mutants of the MSL5 gene (the gene coding for ScSF1) showed increased pre-mRNA leakage to the cytoplasm. This leakage directly correlated with the severity of the growth defect exhibited by the specific mutant (Rutz and Seraphin, 2000). In accordance with the above, combination of these mutants with disruption of the NMD pathway resulted in a synthetic lethal phenotype, probably due to cytoplasmic accumulation of aberrant proteins (Rutz and Seraphin, 2000).

(23)

Further strengthening the role of ScSF1 in pre-mRNA retention, it was later shown that a small proportion of ScSF1 interacts with myosin-like protein 1 (Mlp1) in vivo, in an RNA-dependent manner (Galy et al., 2004). Mlp1 is an inner perinuclear structural protein present in some nuclear pore complexes (NPCs) that physically interacts with RNA and preferentially with intron-containing RNA. Deletion of Mlp1 induces a defect in nuclear pre-mRNA retention with no effect on splicing (Galy et al., 2004).

Furthermore, a general role of MLP1 in nuclear retention has been revealed by its physical interaction with the mRNP components Yra1 and Nab2 (Green et al., 2003;

Vinciguerra et al., 2005). Together these findings have led to the suggestion that Mlp1 is involved in mRNA/mRNP quality control at the NPCs, physically retaining faulty pre- mRNAs/mRNPs.

Although there is currently no data about a potential role of SF1 in pre-mRNA retention in mammals, there is evidence that SF1 shuttles between the nucleus and the cytoplasm (G. Moreau and A. Krämer, unpublished results). This suggests a role for SF1 in the cytoplasm and maybe in RNA transport and nuclear pre-mRNA retention.

SF1 as transcriptional repressor

In addition to its roles in splicing and pre-mRNA retention, some reports also implicate SF1 in transcriptional regulation. This is not surprising as, to date, a number of proteins with a role both in splicing and transcription have been identified, and the processes of transcription and pre-mRNA processing are coupled (Moore and Proudfoot, 2009; Pandit et al., 2008).

In one report, SF1 was isolated in a yeast two-hybrid screen for proteins that can interact with the activation domain of Stage-specific activator protein (SSAP) (Zhang and Childs, 1998). SSAP is a transcription factor that specifically binds to an enhancer element of the promoter of the sea-urchin late H1 gene at the mid-blastula stage of embryogenesis to enhance its transcription (DeAngelo et al., 1995). Its activation domain, referred to as GQC domain (glycine/glutamine-rich sequence with a C- terminal region enriched in serine/threonine and basic amino acids), has previously been shown to interact with a number of transcription factors, such as TBP and TFIIB (DeFalco and Childs, 1996).

In a subsequent study, interactions of SF1 with the TET (TAF15-EWS-TLS) family of transcription factors EWS, TLS and hTAFII68 were shown in vivo and in vitro (Bertolotti et al., 1996; Zhang et al., 1998). EWS is a human protein involved in cellular

(24)

transformation in Ewing’s sarcoma tumors, and contains an N-terminal transcriptional activation domain (NTD) very similar to that of SSAP (Zhang and Childs, 1998; Zhang et al., 1998). TLS and hTAFII68 share extensive homology with EWS and also contain NTDs (Bertolotti et al., 1996; Crozat et al., 1993). Like EWS, both proteins are implicated in carcinogenesis (Bertolotti et al., 1999; May et al., 1993; Prasad et al., 1994). EWS, TLS and hTAFII68 have been shown to associate with RNA polymerase II (RNA Pol II) and TFIID, and are thus implicated in transcription initiation and elongation (Bertolotti et al., 1996; Bertolotti et al., 1998; Yang et al., 2000). Functional assays from the above studies established SF1 as a transcriptional repressor, although not a global one. This activity is mediated by two separate regions on SF1; a repression domain found within the N-terminal 137 amino acids, as well as a GQC/SYGQ-rich interaction domain located after the zinc knuckle motif (Zhang and Childs, 1998; Zhang et al., 1998).

Moreover, SF1 was reported to interact with the WW1 and WW2 domains of CA150 in vitro and in vivo (Goldstrohm et al., 2001; Sanchez-Alvarez et al., 2006). CA150 represses RNA Pol II-mediated transcription by binding to the phosphorylated CTD (C- terminal domain) of RNA Pol II, which inhibits the elongation of transcripts (Goldstrohm et al., 2001; Sune and Garcia-Blanco, 1999; Sune et al., 1997). Intriguingly, the WW1 and WW2 domains of CA150 are required for efficient repression, and binding of SF1 to these domains correlated well with the transcription repression activity of CA150 (Goldstrohm et al., 2001). Based on these data a model has been proposed, in which CA150 binds to the CTD of elongating RNAP Pol II to repress transcription and SF1 targets the nascent transcript acting as negative transcription elongation factor.

Finally, in a large-scale protein profiling study of more than 4000 peptides derived from colorectal cancer cells, SF1 was identified as one of the proteins negatively regulated at the post-transcriptional level by the β-catenin/TCF4 complex (Shitashige et al., 2007a). In a feedback loop, SF1 was also reported to be a suppressor of β–catenin- evoked transcriptional activity of TCF-4. β-catenin is the downstream effector of the Wnt signalling pathway and, together with TCF-4, is involved in the process of colorectal carcinogenesis. Interestingly, in this, and a subsequent study in mice from the same group, expression of SF1 was noted to correlate with the differentiation status of cells and inversely correlate with colon cancer formation (Shitashige et al., 2007b).

(25)

In agreement with the above, reports that cytokine-induced down-regulation of SF1 promotes smooth muscle cell proliferation, and that SF1 is activated in p53-induced apoptosis, further link SF1 to transcriptional repression and suggest a role for SF1 in cancer protection (Amson et al., 1996; Cattaruzza et al., 2002). Interestingly however, a role for SF1 as an ‘anti-cancer’ protein in transcriptional repression appears to be in contrast to its activities in alternative splicing, where it favors cancer formation.

Structure of SF1

The human SF1 gene is encoded on chromosome 11q13 and contains 14 exons.

Alternative splicing of a single SF1 pre-mRNA gives rise to cDNAs encoding several protein isoforms that have been described in human and mouse (Arning et al., 1996).

These isoforms share a common N-terminal half (comprising residues 1-356), which contains:

• two nuclear localisation signals (NLS1 and NLS2), between residues 15-19 and 92-104,

• a nuclear export signal (NES), in residues 30-80,

• the U2AF⁶⁵ interaction domain, between residues 15-22,

• a hnRNP K and Quaking homology (KH-QUA2) domain required for BPS binding and pre-spliceosome assembly, and

• a zinc-knuckle (Zn) that increases the affinity of SF1 for RNA.

The C-terminal halves of the SF1 isoforms are distinct, consisting of Ala- or Pro-rich regions of different length. A schematic representation of the different domains of SF1 is shown in Figure 5.

Figure 5. Schematic representation of SF1. SF1 can be split into two halves. The N-terminal part of the protein, common to all known isoforms, contains all so far characterised domains that are essential for SF1 function: two nuclear localisation signals (NLS), a nuclear export signal (NES), the interaction domain with U2AF⁶⁵, and a KH-QUA2 domain which, together with a Zinc knuckle, is responsible for binding of SF1 to RNA. The C-terminal halves of the protein isoforms contain Pro- or Ala rich sequences of different length. The various domains of SF1 are shown in different colours.

(26)

SF1 isoforms

So far, seven cDNAs encoding SF1 isoforms have been identified (Figure 6). Toda et al. (Toda et al., 1994) first reported the isolation of cDNAs encoding a protein with a zinc finger motif close to the locus of the gene responsible for multiple endocrine neoplasia type 1 (MEN1) on chromosome 11q13 and termed it zinc finger gene on the MEN1 locus (ZFM1). Three cDNAs for human SF1 were further isolated by Arning et al. (Arning et al., 1996) and an additional splice variant was identified in screens for SF1 cDNAs in HeLa cells (Zhang and Childs, 1998).

Figure 6. Schematic representation of known SF1 splicing isoforms. Seven SF1 isoforms have been identified so far in human and mouse tissues. They share a common N-terminal part (gray) up to aa 448, followed by either a Pro-rich domain (light blue) or an Ala-rich region (yellow), and have distinct C-termini of various length (indicated in different colours; red, orange, beige, brown, and green).

Together, these studies demonstrated that different SF1 isoforms share a common N- terminal half (residues 1-356), comprising all so far known functional domains of the protein. The isoforms vary in their C-terminal halves, where alternative splicing gives rise to Pro- or Ala-rich sequences of different length. An alternative 3’ ss of exon 10 leads to inclusion/exclusion of 21 nucleotides (i.e. 7 amino acids) without changing the

(27)

ORF of the protein (Arning et al., 1996). Moreover, alternative 5’ ss in exon 10 generate proteins that contain either Pro- or Ala-rich C-termini. Further alternative splicing events leading to retention of intron 13, skipping of exon 12 or skipping of exons 11 and 12, result in C-termini with different lengths and different reading frames (Arning et al., 1996; Shitashige et al., 2007b). In these and other reports it was also shown that SF1 isoforms are expressed in a cell type and tissue-specific manner, and in relation to the differentiation state of the cells (Amson et al., 1996; Arning et al., 1996; Cattaruzza et al., 2002; Shitashige et al., 2007a; Shitashige et al., 2007b; Zhang and Childs, 1998).

Interestingly, a distinct SF1 isoform has been identified in Drosophila that lacks exon 4 (Mazroui et al., 1999). In Drosophila, this isoform is expressed at all developmental stages, but at two- to ten-fold lower levels than the full-length protein. Exon 4 of DmSF1 corresponds to exon 3 of human SF1. Conceptual translation of the mRNA for human SF1 yields a protein that is collinear with full-length SF1 up to sequences encoded by exon 2, continues in exon 4 in a different reading frame, and terminates at a premature stop codon in exon 5. The truncated protein would carry the U2AF⁶⁵ interaction domain, but lack the RNA binding domain, which could imply a role for this isoform in the regulation of spliceosome assembly. However, due to the presence of a premature termination codon, it is likely that the mRNA is subject to NMD.

Functions of SF1 isoforms

As mentioned previously, when mutant SF1 proteins were tested in a reconstituted in vitro system for pre-spliceosome formation, it was shown that the N-terminal part of the protein is required for pre-spliceosome assembly, but the variable C-terminal tail is dispensable for this step (Rain et al., 1998). Further assays combined with structural analysis have shown that the SF1 KH-QUA2 domain located in the N-terminal half is essential for binding to the BPS (Liu et al., 2001). The N-terminal part of SF1 has also been demonstrated, in vitro and in vivo, to be required for the interaction with U2AF⁶⁵ (Rain et al., 1998). In further experiments amino acids 15-22 have been defined as the U2AF⁶⁵ binding site of SF1 (Selenko et al., 2003). Moreover, the conserved Ser20 of SF1 within the U2AF⁶⁵ interaction domain has been identified as a specific substrate for PKG-I (Wang et al., 1999). Phosphorylation of SF1 at Ser20 has been shown to block its interaction with U2AF⁶⁵ and inhibit pre-splicing complex formation.

(28)

The role of the variable C-terminal part of SF1 has not been determined. Several reports suggest that at least the Pro-rich C-terminal regions of several SF1 isoforms mediate protein-protein interactions. These regions have been shown to interact with the Src homology region 3 (SH3) domain of the proto-oncogene product Abl (Bedford et al., 1997), as well as with the WW domains of the early spliceosomal proteins FBP11 and FBP21 (Formin-binding proteins) and the WW1 and WW2 domains of the transcription elongation factor CA150 (Bedford et al., 1997; Bedford et al., 1998;

Goldstrohm et al., 2001). SF1 was also found to bind to the transcriptional activator SSAP as well as EWS through amino acids 321-484 (Zhang and Childs, 1998; Zhang et al., 1998). In addition to their role in alternative splicing, the binding partners of SF1 - FBP11, FBP21 and CA150 - have been proposed previously to couple transcription to translation via different protein-protein interactions mediated by their WW and FF motifs (Bohne et al., 2000; Goldstrohm et al., 2001; Lin et al., 2004; Smith et al., 2004). Mass spectrometry has identified more than 148 proteins that associate with WW domain-containing proteins, all of which are involved in transcription, RNA processing and cytoskeletal control (Ingham et al., 2005). The roles of SSAP, CA150 and EWS proteins have been discussed previously.

B.3. The nucleus

The mammalian cell nucleus is a multifunctional, highly organized and complex compartment that contains structural and functional sub-domains (Figure 7).

Compartmentalization of the nucleus appears to be prerequisite for the organization of all the molecular machineries involved in activities such as replication, transcription, splicing, rRNA biosynthesis etc. Some of the subnuclear compartments are the nucleolus, promyelocytic leukemia protein (PML) bodies, Cajal or coiled bodies (CBs), Gemini of coiled bodies (gems), speckles and paraspeckles (Lamond and Sleeman, 2003; Platani and Lamond, 2004).

(29)

Figure 7. The cell nucleus (Spector, 2001). A cartoon of the cell nucleus with some of its most ‘popular’ subnuclear compartments like the nucleolus, Cajal bodies, PML bodies etc.

Nucleolus

(Boisvert et al., 2007; Sirri et al., 2008)

The nucleolus is probably the most well-studied compartment of the nucleus, and new information is continuously emerging regarding its roles in the cell. It is characterized as the ribosome factory of the cell, but also implicated in other functions such as the control of cell survival and proliferation. Mammalian cell nuclei contain from one to four nucleoli. These are present throughout the cell cycle, but, because of their dynamic nature, they reorganize in response to certain stimuli, like RNA Pol I or Pol II inhibition.

Interestingly, during RNA Pol II transcription inhibition, apart from their reorganization, nucleoli also attract various nucleoplasmic components to their vicinity, which form perinucleolar caps. Components of all of the below mentioned sub-nuclear structures move to the same or distinct perinucleolar caps in transcriptionally arrested cells (Shav-Tal et al., 2005). The function of these caps is not understood.

(30)

PML bodies

(Bernardi and Pandolfi, 2007)

PML bodies are focal nuclear structures present in most mammalian nuclei. They vary in number from 10 to 30 per nucleus, and their integrity depends on the PML protein, which is concentrated in these structures. Because PML bodies contain a large number of different molecules, they have been linked to many nuclear functions such as transcription, DNA repair, and apoptosis.

Cajal bodies

(Cioce and Lamond, 2005; Morris, 2008)

CBs were named after their discoverer Santiago Ramon y Cajal, who first reported them in 1903. They are small, round sub-nuclear compartments, often found in the vicinity of nucleoli and present in nuclei of cells that are transcriptionally highly active.

Their number depends on the cell type as well as on the stage of the cell cycle and varies from zero to ten per nucleus. A major constituent of CBs is p80 coilin, which also serves as a marker for these structures. CBs have been associated with several cellular functions, like stress response, aging and transcription, but their main role appears to be in snRNP and snoRNP biogenesis and trafficking.

Gems

(Liu and Dreyfuss, 1996)

Gems are characterized by the presence of the Survival of motor neuron (SMN) protein, as well as several gemins. These structures are often structurally associated with CBs, hence their name “gemini of CBs”. They are also very similar in terms of size and number to CBs and in some cases the two structures colocalise. Their function remains obscure. Although they do not contain any snRNPs, their close relationship to CBs and the presence of SMN, a protein involved in snRNP biogenesis, implies a role for them in this process.

Speckles

(Lamond and Spector, 2003)

Mammalian cells contain 10-30 splicing speckles, which are irregular, but discrete domains that correspond to interchromatin granule clusters (IGCs). They can be visualized by an antibody against splicing factor SC35, which has been widely used as

(31)

a marker for speckles (Fu and Maniatis, 1990). Since they are devoid of pre-mRNA, it was thought until recently that splicing speckles (also termed SC35 domains) were storage sites for the majority of snRNPs and non-snRNP splicing factors that, in addition to being diffusely distributed throughout the nucleoplasm, concentrate in these domains in nuclei of interphase cells when they are not forming spliceosomes.

However, a recent report has shown that splicing proteins move constantly by Brownian diffusion in the nucleus and collide randomly, transiently and independently of splicing activity with pre-mRNAs and speckle components (Rino et al., 2007). These authors suggested that the concentration of splicing proteins in speckles does not indicate storage, but is a result of a higher number of binding sites available for splicing factors inside the speckles as compared to the nucleoplasm.

Paraspeckles

(Bond and Fox, 2009)

Splicing speckles are found closely associated with paraspeckles, a relatively novel subnuclear compartment (Fox et al., 2002). Paraspeckles are irregularly shaped structures scattered throughout the nucleoplasm and within the interchromatin space.

Mammalian cells contain 2-20 paraspeckles, the number varying depending on the cell cycle. Paraspeckles contain a marker protein, named paraspeckle protein 1 (PSP1), and to date only a few other proteins (PSP2, p54^nrb, PSF, CFIm68 and RNA polymerase II) have been found associated with them.

The role of paraspeckles is not clear yet, but their protein content suggests that they are involved in transcriptional control and RNA metabolism. More specifically, PSP1 has been shown to concentrate in testis. It has been suggested that PSP1 regulates early mRNA processing in germ cells and assists in chromatin remodeling and nuclear shaping during spermatogenesis (Myojin et al., 2004). PSP2 is a steroid hormone receptor coactivator, implicated in transcription and RNA splicing (Auboeuf et al., 2004). The third component of paraspeckles, p54^nrb, forms a dimer with PSP1 (Fox et al., 2005) and is involved in numerous nuclear events, including transcriptional regulation and splicing (Shav-Tal and Zipori, 2002). p54^nrb also dimerises with polypyrimidine tract-binding protein (PTB)-associated splicing factor (PSF) (Peng et al., 2002), another paraspeckle resident. PSF is an RNA-binding component of the spliceosome, but also interacts with DNA and functions as transcriptional regulator (Shav-Tal and Zipori, 2002). Finally, the 68-kDa subunit of mammalian cleavage factor

(32)

Im (CFIm68) is an RNA-binding protein required for the first step in pre-mRNA 3’ end processing (Dettwiler et al., 2004).

In addition to their proposed role in transcriptional control and RNA metabolism, paraspeckles have also been implicated in nuclear retention of RNAs that undergo A to I RNA-editing (Prasanth et al., 2005). Furthermore, it has been reported recently that the non-coding (nc) RNAs Men-ε and Men-β are retained in paraspeckles and are essential structural units of these subnuclear structures. A link has therefore been established between paraspeckles and non-coding RNAs (Clemson et al., 2009;

Sasaki et al., 2009; Sunwoo et al., 2009).

As in the nucleus, concentrations of proteins with similar functions are also observed at distinct cytoplasmic sites. Some of these structures are processing (P) bodies, uridine-rich (U) bodies and stress granules (SG), the latter appearing only upon induction of stress.

Cytoplasmic Stress Granules (Anderson and Kedersha, 2008)

SGs are aggregates of proteins and untranslated mRNAs that form in the cytoplasm when cells are exposed to stress. Many functions have been proposed for these structures, such as protection of RNA from exposure to harmful agents, as temporary storage sites for mRNA, and as a decision-making compartment between translation and decay. Recent data however demonstrates that a wide variety of proteins with distinct functions accumulate in SGs (transcription and splicing factors, adhesion and signaling molecules, etc.), making their role even more obscure. The typical protein marker for this compartment is TIA-1 (T-cell-restricted intracellular antigen-1), which is also involved in splicing.

B.4. Non-coding RNAs

In addition to protein-coding genes, the genome codes for a significant number of transcripts that are not translated into protein. These are called non-coding RNAs and include tRNAs, rRNAs, snRNAs, snoRNAs, miRNAs, piRNAs, RNase P and long ncRNAs. In the last few years, large-scale analysis of the transcriptome has revealed the existence of many long ncRNAs and their number is continuously growing. The functions of the majority of these RNAs are not known. However, it is now clear that

(33)

long ncRNAs have roles in many key regulatory processes such as transcription and RNA processing, while they also serve as precursors to small RNAs and as structural and organizational molecules (Wilusz et al., 2009). In addition, a considerable amount of different disease and tumor-associated ncRNAs have been identified. Two ncRNAs of particular interest for this thesis are Malat-1 and Men-ε/β, which were recently shown to be highly enriched in the nucleus and present in speckles and paraspeckles, respectively (Clemson et al., 2009; Hutchinson et al., 2007; Sasaki et al., 2009;

Sunwoo et al., 2009). Both transcripts are encoded on chromosome 11q13, in proximity to the gene encoding SF1. In addition, in a search for in vivo targets for SF1 and U2AF⁶⁵ using the CLIP method (in vivo cross-linking and immunoprecipitation), both Malat-1 and Men-ε/β ncRNAs were identified in SF1-RNA complexes (Figure 8).

Figure 8. Schematic representation of the CLIP tag distribution of SF1 and U2AF⁶⁵ on Malat-1 and Men-ε/β ncRNAs. In in vivo cross-linking and immunoprecipitation experiments Malat-1 and Men-ε/β ncRNAs were shown to interact with both SF1 and U2AF⁶⁵ (M. Corioni, J.

Pakay and A. Krämer, unpublished data). The positions of the tags are shown in blue for SF1 and in red for U2AF⁶⁵.

Malat-1

Metastasis associated lung adenocarcinoma transcript 1 (Malat-1) was first described in a screen for genes over-expressed in metastatic non-small-cell lung cancer (Ji et al., 2003). It is broadly expressed in many normal tissues, but has been shown to be highly over-expressed in many cancers and is considered a good marker diagnostic for cancer and prognosis of metastasis. Although Malat-1 is not present in non- mammalian species, it is highly conserved in mammals, which indicates an important

(34)

function. Malat-1 RNA is mainly present in the cell unspliced. It has a size of ~7 kb, is polyadenylated and lacks an open reading frame of significant length. FISH data revealed that Malat-1 is broadly distributed in the cell nucleus and concentrates in speckles, implying a role in pre-mRNA metabolism (Hutchinson et al., 2007).

Men-ε/β

Men-ε/β is encoded in the multiple endocrine neoplasia (MEN-I) locus and has two isoforms: Men-ε and Men-β. Men-ε is predominantly unspliced, ~3.7 kb in length and contains a genomically encoded poly(A) sequence. Men-β is a longer, polyadenylated transcript of ~23 kb that shares the same transcriptional start site with Men-ε. Both transcripts are relatively abundant, with broad tissue expression and at least the shorter Men-ε is conserved within the mammalian lineage. Neither RNA has an apparent open reading frame. Similar to Malat-1, the function of Men-ε/β is unclear. It too has been linked to cancer, since it is enriched in the nucleus in a number of carcinomas. Recent publications reported that both Men-ε/β transcripts localise in paraspeckles, suggesting a role in pre-mRNA metabolism. Interestingly, Men-ε/β has been shown to be a core structural component of paraspeckles contributing, together with other paraspeckle proteins, to the organization of these structures (Clemson et al., 2009; Sasaki et al., 2009; Sunwoo et al., 2009). This is the first time that a long ncRNA has been shown to have a structural role.

B.5. Aim of the thesis

The role of SF1 in the cell is not entirely clear and the presence of a relatively large number of isoforms complicates the study of its function. In the first part of this thesis the role of SF1 in the cell nucleus was investigated by undertaking an immunofluorescence approach. The cellular localisation and dynamics of individual isoforms was examined and some steps were taken towards understanding the function of SF1 in terms of its subnuclear distribution and interaction with different molecules. The relationship of SF1 to ncRNAs has been analysed in the second part of the thesis, again in the context of its nuclear localisation as well as interactions.

SF1 has been shown to be extensively alternatively spliced in its C-terminal, but not N- terminal region. In addition, to date most isoforms have been identified in HeLa cells.

In the last part of this work the presence of SF1 isoforms in different mammalian cell lines and tissues was examined. Moreover, the questions of whether the N-terminal

(35)

part of SF1 is indeed common to all isoforms and whether the alternative splicing events in the C-terminal part of SF1 are numerous, even in non-cancer cells, were also addressed. Finally, the tissue-specific expression of particular isoforms was investigated.

(36)

Materials and Methods

(37)

C. Materials and Methods

C.1. Cell culture

The following cell lines were used: HeLa (human epithelial adenocarcinoma), MCF7 (human breast adenocarcinoma), 293T (human epithelial kidney), p15 (human neuroblastoma), and Hek293 (human embryonic kidney). HeLa, MCF7, 293T, and Hek293 cells were grown in DMEM (Sigma) supplemented with 10% FBS (Sigma), 1%

penicillin-streptomycin (GIBCO), and 1% L-glutamine (GIBCO). p15 cells were grown in DMEM/Nutrive mix F-12 with glutamax 1 (GIBCO) supplemented with 10% FBS (Sigma), 1% penicillin-streptomycin (GIBCO), and 1% L-glutamine (GIBCO).

Treatment with actinomycin D (ActD) (Sigma) was performed at a final concentration of 1 µg/ml for 4 hr, followed by fixation and image acquisition or extract preparation.

Digestion with RNase A (Sigma) for immunofluorescence was performed as described (Fox et al., 2005).

To induce the formation of stress granules, cells were exposed to 1 mM sodium arsenite (Riedel-de Häen) for 1 hr at 37°C.

C.2. Transfection procedures Transfections for localisation studies

HeLa or 293T cells were transfected with the calcium phosphate method (Jordan et al., 1996) at a confluency of ~70%. Immunofluorescence or extract preparation was performed 48 hr later, or as stated if otherwise.

Transfections for RNAi

For RNAi experiments, HeLa cells (4 x 10⁵) were transfected with Lipofectamine 2000 (Invitrogen) following the manufacturers instructions. Knock-down of SF1 was performed in the presence of two siRNAs (1/470 – GACCUGACUCGUAAACUGCtt and 2/D3 – UGGACUUACUCGAGAACAAtt, Dharmacon) at a final concentration of 70 nM. Knock-down of UPF1 was performed in the presence of one siRNA (AAUGGAGCGGAACUGCAUCUU, Dharmacon) at a final concentration of 70 nM. The GL2 siRNA targeting firefly luciferase mRNA served as negative control (Elbashir et al., 2002). For SF1, cells were collected 54 hr post-transfection for further analysis. For UPF1 they were collected 48 hr and 72 hr post-transfection.

(38)

C.3. DNA constructs

All DNA constructs made and/or used in this study are shown in Table 1.

Table 1. DNA constructs made and/or used in this study

Name Vector Insert Product

pcDNA-Pro-A^a pcDNA3.1/His Pro-A 6xHis-Pro-A

pcDNA-Pro-B^a pcDNA3.1/His Pro-B 6xHis-Pro-B

pcDNA-Pro-C^a pcDNA3.1/His Pro-C 6xHis-Pro-C

pcDNA-Pro-D^a pcDNA3.1/His Pro-D 6xHis-Pro-D

pcDNA-GKS-Ala-A^a pcDNA3.1/His GKS-Ala-A 6xHis-GKS-Ala-A pcDNA-GKS-Ala-B^a pcDNA3.1/His GKS-Ala-B 6xHis-GKS-Ala-B

pcDNA-GKS-Ala-D pcDNA3.1/His GKS-Ala-D 6xHis-GKS-Ala-D

pcDNA-Ala-A pcDNA3.1/His Ala-A 6xHis-Ala-A

pcDNA-Ala-C pcDNA3.1/His Ala-C 6xHis-Ala-C

pcDNA-Ala-D pcDNA3.1/His Ala-D 6xHis-Ala-D

GFP-Pro-A^a pEGFP Pro-A GFP-Pro-A

GFP-Pro-B^a pEGFP Pro-B GFP-Pro-B

GFP-Pro-C pEGFP Pro-C GFP-Pro-C

GFP-Pro-D pEGFP Pro-D GFP-Pro-D

GFP-GKS-Ala-A^a pEGFP GKS-Ala-A GFP-GKS-Ala-A

GFP-GKS-Ala-B^a pEGFP GKS-Ala-B GFP-GKS-Ala-B

GFP-GKS-Ala-D pEGFP GKS-Ala-D GFP-GKS-Ala-D

GFP-Ala-C pEGFP Ala-C GFP-Ala-C

GFP-Ala-D pEGFP Ala-D GFP-Ala-D

GFP-C2 pEGFP SF1 2-705 aa GFP-Insert

GFP-C7 pEGFP SF1 1402-GKS-Ala-A end GFP-NLS*-Insert

GFP-C8 pEGFP SF1 1402-1636 aa GFP-NLS-Insert

GFP-C9 pEGFP SF1 1402-Pro-A end GFP-NLS-Insert

GFP-C10 pEGFP SF1 1402-GKS-Ala-B end GFP-NLS-Insert GFP-C11 pEGFP SF1 1402-1700 aa Pro GFP-NLS-Insert GFP-C12 pEGFP SF1 1402-1700 aa GKS-Ala GFP-NLS-Insert

GFP-C13 pEGFP SF1 E14b GFP-NLS-PK*-Insert

GFP-C14 pEGFP SF1 1402-Pro-D GFP-NLS-Insert

GFP-C15 pEGFP SF1 1402-GKS-Ala-D GFP-NLS-Insert

GFP-C16 pEGFP SF1 1645-2010 aa Ala GFP-Insert GFP-C18 pEGFP SF1 1402-2010 aa Ala GFP-NLS-Insert

GFP-C19 pEGFP SF1 E11b Ala GFP-NLS-Insert

GFP-C21 pEGFP SF1 full-length ΔE10b-GKS-Pro-A GFP-Insert

(39)

GFP-NLS (C20) pEGFP NLS GFP-NLS

HcRed-Pro-B pHcRed1 Pro-B Red-Pro-B

HcRed-Pro-C pHcRed1 Pro-C Red-Pro-C

GFP-SF3a120^a pEGFP SF3a120 GFP-SF3a120

GFP-SC35 pEGFP SC35 GFP-SC35

GFP-TIA^a pEGFP TIA GFP-TIA

CFP-U2AF^{35 a} pECFP U2AF³⁵ CFP-U2AF³⁵

* NLS: nuclear localization signal, PK: pyruvate kinase

a : Existing constructs. GFP-TIA was a kind gift of Juan Valcarcel. CFP-U2AF³⁵was provided by Maria Carmo-Fonseca

C.4. Cloning procedures SF1 isoforms

cDNAs encoding different SF1 isoforms were obtained by restriction digestion of published plasmids (Arning et al., 1996) or PCR-amplified products from HeLa cell cDNA, followed by sub-cloning into appropriate restriction sites of pcDNA3.1/His (Invitrogen), pEGFP (Clontech) or pHcRed vectors (Evrogen).

Deletion mutants

Deletion mutants were generated by restriction digestion of full-length cDNAs corresponding to various SF1 isoforms and insertion into pEGFP, digested with the same enzymes. Several mutant proteins contained the NLS of SF3a120 (C.J. Huang, F. Ferfoglia, F. Mulhaupt, A. Krämer, manuscript in preparation) inserted between the GFP and SF1-coding sequences. Plasmid GFP-C13 also contained the sequence of pyruvate kinase. All tags were present at the N termini of the proteins. Deletion mutants are summarized in Table 1.

Other plasmids

SC35 was obtained by restriction digestion of pCMV-HA-SC35 and sub-cloning into pEGFP using appropriate restriction enzymes. GFP-SF3a120, 66 and 60 plasmids were provided by F.Ferfoglia. pECFP-U2AF³⁵ was a gift from M. Carmo-Fonseca (University of Lisbon, Portugal). The GFP-TIA-1 plasmid was a gift from J. Valcarcel (Center of Genomic Regulation, Barcelona, Spain).

(40)

C.5. DNA sequencing

Correct cloning for all plasmids was confirmed by DNA sequencing (Fasteris, Geneva, Switzerland).

C.6. Antibodies and Dyes

All antibodies and dyes used are summarized in Table 2.

Table 2. Antibodies and dyes used in this study

Antibody Host Dilution Company

WB IF IP

SF1 Mouse 1:6000 1:2000 1 µg/IP Abnova

PSP1 Rabbit 1:10000 1:1000 - DCP

SC35 Mouse 1:2000 1:500 - Sigma

ASF/SF2 Mouse - 1:100 - Zymed

PML Mouse - 1:200 - SantaCruz

P80-coilin Mouse - 1:750 - Sigma

P54 Mouse 1:5000 1:1000 1 µg/IP BD Transduction

P54 Rabbit 1:5000 1:1000 - SantaCruz

PSF Mouse 1:2000 - 4 µg/IP Sigma

GFP Rabbit 1:2000 1:500 - Invitrogen

CFIm68 Rabbit 1:10000 - - W.Keller

SMN Mouse - 1:100 - BD Transduction

DIG Sheep - 1:200 - Roche

UPF1 Goat 1:1000 - - Bethyl

U2AF65 Mouse 1:1000 1:1000 - Sigma

SF3b155 Rabbit - 1:100 - L.Lührmann

TIA Goat - 1:100 - SantaCruz

Tubulin Mouse 1:5000 - - Sigma

Mcm3 rabbit 1:2000 - - Abcam

IgG2a Mouse - - 1.4 µg/IP Sigma

His Mouse 1:2000 1:500 - Sigma

Alexa 544 α-

mouse Goat - 1:1000 - Invitrogen

Alexa 594 α-

mouse Goat - 1:1000 - Invitrogen

Alexa 544 α-rabbit Goat - 1:1000 - Invitrogen

Alexa 594 α-rabbit Goat - 1:1000 - Invitrogen

Alexa 594 α-goat Donkey - 1:1000 - Invitrogen

Alexa 594 α-

sheep Donkey - 1:1000 - Invitrogen

HRP-conjugated

α-rabbit Mouse 1:25000 - - Dako

HRP-conjugated

α-mouse Rabbit 1:2500 - - Jackson

Laboratories HRP-conjugated

α-goat Donkey 1:1000 - - SantaCruz

Dyes

Hoechst - - 2 ng/ml - Molecular probes

Pyronin Y - - 4 µg/ml - Sigma

Analysis of the intracellular localisation and alternatively spliced isoforms of splicing factor 1

Thesis

Reference

Analysis of the intracellular localisation and alternatively spliced isoforms of splicing factor 1

Analysis of the intracellular localisation and alternatively spliced isoforms of splicing factor 1

THESE

Maria Choleza

Acknowledgements

…to my parents…

… στους γονεις μου …

Table of Contents

TABLE OF CONTENTS

Abstract

Introduction

Materials and Methods