Results

Mutations in ttc-1 restore resistance to anoxia in hyl-2 deficient mutant in the nematode Caenorhabditis elegans

Sébastien Gentina, Audrey Bellier, J. Thomas Hannich, Howard Riezman and Jean-Claude Martinou

This manuscript is in preparation and contains the results of my main thesis project (project 1, described in point 4 of Introduction).

Mutations in ttc-1 restore resistance to anoxia in hyl-2 deficient mutant in the nematode Caenorhabditis elegans

Authors

Sebastien Gentina¹, Audrey Bellier¹, J. Thomas Hannich², Howard Riezman² and Jean-Claude Martinou¹

1 Department of Cell Biology, University of Geneva, 30 quai Ernest-Ansermet, 1211 Genève 4, Switzerland

2 Department of Biochemistry and NCCR Chemical Biology, 30 quai Ernest-Ansermet, 1211 Genève 4, Switzerland

Keywords

Sensitivity to anoxia, suppressor screen, T19A5.1, rescue, lipidomics, ceramide, glucosylceramide, sphingomyelin

Abstract

While most organisms are unable to survive in the total absence of oxygen, Caenorhabditis elegans has developed strategies to survive short-term anoxia. We previously identified a loss of function mutation in the ceramide synthase HYL-2 that induces variations in the ceramide content and confers hypersensitivity of the C.

elegans mutant hyl-2(gnv1) to anoxia. Here, we performed a suppressor screen in the hyl-2(gnv1) strain and identified ttc-1(gnv3), a poorly characterized gene encoding a tetratricopeptide-repeat containing protein. The expression pattern of

ttc-1 partially overlapped the pattern of hyl-2 expression. Most importantly, not only did the mutation in ttc-1 restore resistance to anoxia in hyl-2(gnv1) mutants, it also restored normal levels of certain sphingolipid species in these animals. In particular, glucosylceramides (GlcCers) with C24 and C25 fatty acyl chains and sphingomyelins (SMs) with C24, C25 and C26 fatty acyl chains that were highly represented in the hyl-2(gnv1) anoxia-sensitive mutant, were present at a normal level in ttc-1(gnv3);hyl-2(gnv1) anoxia-resistant double mutant. Together, our data suggest that accumulation of specific sphingolipids has a deleterious effect during anoxia and that expression of these sphingolipids is under the control of ttc-1.

Introduction

Oxygen is mandatory for most metazoans to generate enough ATP for survival. As the final electron acceptor in oxidative phosphorylation, it allows aerobic respiration, which, for each molecule of glucose consumed, produces 15 times more ATP molecules than anaerobic glycolysis (Rich, 2003; Saraste, 1999). For instance, due to its high-energy need, the brain of most vertebrates is one of the first organs to fail upon anoxia (Nilsson and Lutz, 2004; P.L. Lutz, 2003). However, some organisms, such as the fruit fly, the fresh water turtle, zebrafish embryos and C. elegans, have developed strategies to survive long periods of anoxia with no or limited damage (Haddad et al., 1997; Mendenhall et al., 2006; Padilla and Roth, 2001; Paul et al., 2000; Van Voorhies and Ward, 2000; Willmore and Storey, 1997). In C. elegans the important role of the hif-1 pathway has been well described in response to hypoxia (Epstein et al., 2001; Jiang et al., 2001; Shen et al., 2005). Interestingly, studies on

does not involve hif-1 (Menuz et al., 2009; Padilla et al., 2002). This suggests the involvement of other mechanisms that confer resistance of the worm to anoxia. One of them is the insulin-like receptor daf-2 pathway, whose dysfunction leads to increased resistance to anoxia and extends the lifespan of the worm (Kenyon et al., 1993; Kimura et al., 1997; Lin et al., 2001). Mutants of nsy-1 and glp-1, which respectively encode the conserved protein Apoptosis Signalling-Regulating (ASK) and a N-glycosylated transmembrane protein, have been recently shown to promote resistance to long periods of anoxia independently of the insulin-like pathway (Hayakawa et al., 2011; Mendenhall et al., 2009).

Ceramides (Cers) are known to be involved in various stress signalling pathways (for review (Ruvolo, 2001)) and we previously reported that specific ceramides are essential for the resistance of C. elegans to anoxia. Indeed, a loss of function mutation of the hyl-2 gene encoding a ceramide synthase leads to hypersensitivity of C. elegans to anoxia (Menuz et al., 2009). In this study, we confirmed that hyl-2(gnv1) mutants contained less Cers and SMs with C20 to C22 fatty acyl chains and more with C24 to C26 fatty acyl chains compared to N2 (Menuz et al., 2009). These results suggest that the HYL-2 ceramide synthase is necessary for the protection to anoxia by producing C20 to C22 Cers and SMs, or that increased levels of Cers and SMs with C24-C26 fatty acyl chains could be deleterious for C. elegans in anoxia.

Recent studies performed with mammalian cell and rats confirmed the importance of ceramide homeostasis in the response to severe oxygen deficits (Devlin et al., 2011;

Vlassaks et al., 2013). Altogether, these studies revealed an essential role of sphingolipids in low oxygen/anoxia-related stress.

Here, we performed a suppressor screen in the hyl-2(gnv1) mutant aiming at identifying animals that recovered a normal resistance to 48 hours of anoxia. We found one suppressor in which loss of function of the poorly characterized gene T19A5.1 was able to restore a normal resistance to 48 hours of anoxia in hyl-2(gnv1).

T19A5.1 encodes a conserved tetratricopeptide-repeat domain (TPR1) protein and has been renamed ttc-1. TPR motifs are known to form helical structures domains involved in scaffolding multiprotein complexes, known to be implicated in many cellular processes including transcription, protein translocation and protein degradation (Allan and Ratajczak, 2011). Thus, this suggests a potential regulatory role for TTC-1 in modulating protein-protein interactions in C. elegans, possibly influencing different metabolic processes such as regulation of the ceramide homeostasis.

Lipidomic analysis of the suppressor mutant revealed a normal amount of certain sphingolipids, C24 and C25 GlcCers and C24, C25 and C26 SMs, which were accumulated in the hyl-2(gnv1) mutant. These changes may counteract the hypersensitivity of hyl-2(gnv1) in anoxic condition.

Together, our results confirmed the importance of ceramides and sphingolipid homeostasis in the protection against anoxia and raise the possibility that the accumulation of certain sphingolipid species might be, at least in part, responsible for the sensitivity of hyl-2(gnv1) to anoxic conditions.

Results

Isolation of a suppressor that restores normal resistance to anoxia in hyl-2(gnv1) mutant

As previously reported, hyl-2(gnv1) mutants are hypersensitive to 48 hours of anoxia ((Menuz et al., 2009) and Fig. 1A). To investigate the role of ceramides in anoxia, we performed an ethyl methanosulfonate (EMS) suppressor screen in the hyl-2(gnv1) strain. The offspring of the mutagenized animals were screened for their resistance to 48 hours of anoxia. One strain, gnv3, showed a resistance to 48 hours of anoxia comparable to the resistance of the wild type (Fig. 1A). hyl-2 genotyping confirmed the presence of the gnv1 mutation in the gnv3 worm, indicating that gnv3 is not a revertant of gnv1.

We next mapped the suppressor combining two methods: Rapid Single Nucleotide Polymorphism mapping (RSNP) and Whole Genome Sequencing (WGS). With a percentage of Bristol background close to 80% (Fig. S1B), RSNP mapping indicated that the mutation was on chromosome V. Further investigations allowed us to define that it was in between the clones Y61A9LA (-5 cM) and R10D12 (6 cM). The list of single nucleotide polymorphisms (SNPs) obtained with the WGS, allowed us to find that ttc-1(gnv3) was mutated twice at the beginning and at the end of the gene.

These mutations consisted of two substitutions: one substitution of the nucleotide 512 in exon 4 (GGA to GAA) and one substitution of the nucleotide 3781 exon 16 (CAG to TAG) resulting in Gly¹⁷¹Glu¹⁷¹ and Gln¹²⁶¹STOP¹⁶²¹ respectively. The first mutation induces a change in the amino acid properties (non polar to acidic polar)

and the second mutation generates a stop codon just at the end of the tetratricopeptide-repeat domain TPR1 of the protein (Fig. 1B). In addition, the outcrossing of the suppressor within the Hawaii strain when we performed the RSNP led us to conclude that the suppressor mutation was monogenic recessive. In fact, we observed that the number of recombinants resisting anoxia corresponded to the mendelian ratio 1:2:1 (Fig. S1A). We were not able to determine whether only one or both SNPs were needed to induce the suppressor phenotype. Segregated ttc-1(gnv3) mutants presented a normal resistance to 48h, 62h and 72h of anoxia (Fig.

2A, 2B and 2C), indicating that ttc-1 alone does not confer a hyper-resistance to anoxia and is likely involved in the hyl-2 pathway.

In order to confirm the suppressor role of ttc-1(gnv3), we established a transgenic line (JCM3) where the wild-type copy of ttc-1 was reintroduced into ttc-1(gnv3); hyl-2(gnv1) worms. As expected, the JCM3 strain was unable to resist 48 hours of anoxia (Fig 3A). We next depleted ttc-1 using RNA interference in the hyl-2(gnv1) strain and observed a partial recovery of the resistance to 48h of anoxia (Fig 3B and 3C), indicating that ttc-1(gnv3) mutation is a loss-of-function. Together, our results indicate that mutations in ttc-1 restore the normal resistance of hyl-2(gnv1) mutant C.

elegans to anoxia.

ttc-1 is expressed in the pharynx, the tail, the gut and in the developing vulva

ttc-1 encodes a poorly characterized tetratricopeptide-repeat (TPR) domain protein.

BLAST analysis indicated that ttc-1 is conserved in Drosophila melanogaster, mice and humans. To investigate the expression pattern of ttc-1, we generated a second

the adult stage. In adult worms, we observed that ttc-1 was mainly expressed in the cells surrounding the pharynx and in the tail (Fig. 4A and 4B). We observed the same expression in the L4 worms, and additionally, a strong expression in the cells of the vulva (Fig. 4C). Interestingly, ttc-1 appeared to also be expressed in some parts of the gut and was observable in L4 worms because no embryos could mask the gut (Fig. 4C). The expression in the gut and at the level of the pharynx indicated that ttc-1 could, in some parts, overlap with hyl-2 expression that we previously reported (Menuz et al., 2009). The translational GFP-fusion of JCM3 transgenic worms provided the same expression pattern but with reduced intensity (Fig S2A and S2B). We concluded that this gene is expressed within specific regions like the pharynx, the tail, the gut and the developing vulva.

Lipid profile of hyl-2(gnv1);ttc-1(gnv3) mutants

The suppressor effect of the hyl-2(gnv1) mutation by ttc-1(gnv3), the absence of hyper-resistance in segregated ttc-1(gnv3), and the expression profile of ttc-1 strongly indicated that ttc-1 is involved in the hyl-2 pathway and prompted us to investigate the sphingolipid composition of ttc-1(gnv3);hyl-2(gnv1) mutants. For this purpose, four lines (N2, ttc-1(gnv3) #2, hyl-2(gnv1) and ttc-1(gnv3);hyl-2(gnv1)) were analysed by lipid profiling.

Our results first confirmed the results obtained by Menuz et al., i.e. the absence of ceramides (Cers), dihydroceramides (DHCers), sphingomyelins (SMs) with C22 fatty acyl chains in the hyl-2(gnv1) mutant and in ttc-1(gnv3);hyl-2(gnv1) (Fig. S4A, S4B,

5B). Similar contents of the glucosylceramide (GlcCer) were also measured in both strains (Fig. 5A).

Most importantly, our results also showed that the accumulation of C24 GlcCer found in hyl-2(gnv1) was absent in the in 1(gnv3);hyl-2(gnv1) and that its amount in ttc-1(gnv3);hyl-2(gnv1) was comparable to the amount in ttc-1(gnv3) and N2 (Fig. 5A).

We made the same observation when we looked at the C24 SM (Fig. 5B). Fold of control analysis of the lipidomics data helped us refine our observation by revealing an accumulation of C16, C17 and C18 GlcCers and a decrease in C21, C22 and C23

GlcCers in both hyl-2(gnv1) and ttc-1(gnv3);hyl-2(gnv1) mutants compared to N2 and ttc-1(gnv3). However, certain GlcCers with fatty acyl chain C24 and C25 remained increased only within hyl-2(gnv1) (Fig. S3 A). Analysis of SM content relative to the control revealed that certain species of C24, C25 and C26 SMs were only accumulated within hyl-2(gnv1)(Fig. S3 B). Together, these results indicate that the increased levels of certain species of C24 and C25 GlcCers and C24, C25, and C26 SMs present in the hyl-2(gnv1) mutant are re-established to wild type level by the ttc-1(gnv3) mutation. These results prompt us to propose that ttc-1(gnv3) confers resistance to anoxia by regulating the abundance of these lipids. This suggests that the accumulation of C24 and C25 GlcCers and C24, C25, and C26 SMs could have a toxic effect in hyl-2(gnv1) under anoxia.

Discussion

The mechanism by which ceramides and their derivatives ensure resistance to anoxia is still poorly understood. Here we discovered, by EMS random mutagenesis, a new allele, ttc-1(gnv3), which completely restored resistance to 48 hours of anoxia in the ceramide synthase hyl-2(gnv1) mutant. Mutation of ttc-1 alone did not confer any increased resistance to anoxia. Therefore, ttc-1 appears to only sensitize worms with a hyl-2 loss of function, which strongly suggests that it could be implicated in the ceramide pathway.

ttc-1 encodes a poorly characterized tetratricopeptide repeat protein and we showed that it was expressed mainly in the head, the gut, the tail and the developing vulva.

This pattern partially overlapped with the expression pattern of hyl-2 previously described by Menuz et al. 2009. We also observed that suppressor mutations in ttc-1 restored normal levels of specific sphingolipid species that were increased in hyl-2(gnv1) mutants. The lipidomic profiling first confirmed the result obtained by Menuz et al. 2009, showing the absence of GlcCers and SMs with C22 fatty acyl chains and high expression of C24 and C25 GlcCers and C24, C25 and C26 SMs. Importantly, our results showed that mutations in ttc-1(gnv3) restored normal levels of C24 and C25

GlcCers and C24, C25 and C26 SMs in hyl-2(gnv1). These results strongly suggest that the cause for sensitivity of hyl-2(gnv1) to anoxia is due to these GlcCers and SMs containing C24, C25 and C26 long fatty acyl. However, we cannot exclude that another mechanism may be involved. Unfortunately, it has been impossible to feed worms with long fatty acyl chain ceramides to test whether they are the cause of sensitivity of hyl-2(gnv1) to anoxia.

However, in support of a role of long fatty acyl chain ceramides in C. elegans toxicity during anoxia-induced stress, it has been previously reported that GlcCer and SM accumulation can lead to neurodegeneration in mice and in the Niemann Pick A mouse model (Farfel-Becker et al., 2014; Trovo et al., 2014). In addition, disturbed sphingolipid homeostasis has been proposed to play a role in several neurological disorders such as Alzheimer’s and Parkinson’s diseases (Fabelo et al., 2011; Han et al., 2002; He et al., 2010; Satoi et al., 2005). In addition, ceramides have been shown to be involved in ciliogenesis (He et al., 2014; Wang et al., 2009). Interestingly homologs of TTC-1 have been recently reported to also be involved in this process (Bontems et al., 2014). In fact, in their study, Bontems et al. showed that depletion of TTC-1 homolog in human cells and zebrafish embryos resulted in defect in ciliogenesis. However, the mechanism still remain unclear.

Thus, these studies provide us with new clues that ceramide and TTC-1 might play a role in common processes.

The expression of TTC-1 in the vulva in L4 worms led us to hypothesize that TTC-1 plays a role in the vulval development. This possibility is reinforced by the predicted interaction of TTC-1 with the serine/threonine kinase SPK-1 (Zhong and Sternberg, 2006), which has been shown to be involved in germline development and embryogenesis (Kuroyanagi et al., 2000). In addition, spk-1 was also predicted to interact with the nucleosome remodelling factor nurf-1, which has been shown to be involved in the development of the vulva (Andersen et al., 2006; Zhong and Sternberg, 2006). The predicted interaction of TTC-1 with SPK-1 led us to hypothesise that it could scaffold interactions and regulate proteins implicated in

interesting in the future to test whether spk-1 mutants have an impact on the resistance of C. elegans to anoxia.

Altogether, these results highlight the importance of ttc-1 in the maintenance of sphingolipids homeostasis. ttc-1(gnv3) appears essential to counteract the accumulation of complex sphingolipids occurring when the ceramide synthase HYL-2 is not functional.

Materials and Methods

Caenorhabditis elegans strains

The wild type Bristol strain N2 was used as the reference strain and the Hawaii strain CB4856 was used as the polymorphic strain. Worms were grown, maintained and tested on NGM plates, fed with E. coli strain OP50. Maintenance and genetic manipulation were performed as described in (Brenner, 1974). We used the following mutant strains: hyl-2(gnv1), daf-2(e1370), unc-119(ed3), ttc-1(gnv3);hyl-2(gnv1), JCM2 and JCM3.

JCM2 corresponds to the transgenic strain: unc119(ed3); gnvEx2[Pttc-1::GFP;unc119(+)] and JCM3 corresponds to the transgenic strain: unc119(ed3);ttc-1(gnv3);hyl-2(gnv1); gnvEx3[Pttc1::GFP::ttc-1(+);unc119(+)]

ttc-1(gnv3) mutation was segregated in two lines: ttc-1(gnv3) #1 and ttc-1(gnv3) #2

The hyl-2(gnv1) mutation induces a restriction enzyme site recognized by SspI, which was used for genotyping. For the PCR the following primers were used:

forward 5’-3’: ggtgacaggtaaatccataataattgtcagc and reverse 5’-3’:

cgttccacccgatccccaatgc. The PCR size was 678bp and after digestion with SspI N2 fragments were 310bp + 368bp and hyl-2(gnv1) fragments were 174bp + 136bp + 368bp.

ttc-1(gnv3) SNPs were genotyped by sequencing. The following primer were used:

For the SNP 1 (GGA to GAA), forward 5’-3’: gtgtcccgagttccatgagt and reverse 5’-3’:

agctctccagtaggcagcag with a PCR fragment of 451bp. For the SNP 2 (CAG to TAG),

forward 5’-3’: gctgccatgcttcacagtaa and reverse 5’-3’: actcgaattctttcccagca with a PCR fragment of 463bp.

RNAi experiments

RNAi experiments were performed on solid NGM plates containing 25µg/ml carbenicillin and 1mM IPTG. Worms were fed with HT115 strains containing either the empty vector L4440 as a control or with L4440 containing T19A5.1 (ttc-1) or mre-11 from C. elegans RNAi library obtained at Source Bioscience LifeScience and the daf-2 clone was made by (Dillin et al., 2002). Every clone was verified by sequencing before use. All the experiments were performed at 20°C following the Ahringer lab RNAi Feeding Protocol (Version 11.04.01) based on (Kamath et al., 2001) and the downregulation of ttc-1 was analysed by semi-quantitative PCR.

EMS mutagenesis

The EMS mutagenesis was performed following the Aroian lab protocol.

L4 stage worms were placed for 4 hours on rocker in M9 buffer containing EMS 50mM final concentration. Mutagenized worms were then plated onto seeded 100 mM ENG plates O/N to let them become gravid adults.

F2 screen: gravid P0 adults were harvested and bleached and the F1 embryos were plated. Gravid F1 adults were bleached and embryos were plated and grown to obtain gravid F2 worms that were placed in anoxia for selection.

Anoxia experiment

C. elegans strains were tested in anoxia from 48 h to 72 h as described in (Menuz et al., 2009). Anoxia experiments were always performed at 20°C and a maximum of 60 strains were tested at the same time. All tested animals were synchronised young

adults (72 hours post L1 stage) and in between 25-30 worms per strain were tested.

Survivors were scored after recovering for a period of 24 h in normoxic environment.

Observations were done either with a binocular (Leica MZ6) or with an inverted fluorescent microspcope (Zeiss Axiovert).

Rapid Single Single Polymorphism (RSNP) mapping RSNP was performed as described in (Davis et al., 2005).

Whole Genome Sequencing

WGS was performed at the genomic platform of the CMU (Centre Médical Universitaire, Geneva). Genomic DNA from pooled recombinant worms from the RSNP mapping was extracted and analysed. Analysis was performed using the free software IGV (Integrative Genomic Viewer) from the Broad Institute.

Transgenic strains

Transgenic strains were obtained by gene bombardment using the Particle Delivery System PDS-1000/He Biolistic, BIO-RAD. unc119(ed3) and unc119(ed3);ttc1(gnv3);hyl-2(gnv1) were respectively bombarded with the following constructs: Pttc-1::GFP;unc119(+) and Pttc1::GFP::ttc-1(+);unc119(+)

All the constructions were cloned into pBluescript II KS+ plasmid containing a wild type copy of unc-119 clone at SacI site.

Non-unc worms were isolated and tested for their GFP expression and/or resistance to anoxia.

Microscopy

Observations were performed using confocal Zeiss LSM700 microscope at the Bioimaging center of the faculty of science (University of Geneva). For each observation, the setup of the gain was always done with the wild type animal N2 for maximal reduction of the background GFP signal from C. elegans autofluorescence.

Lipid extraction and analysis

Cryolysis was performed with a “Precellys 24, lysis & homogenization” machine (Bertin Technologies).

8000 synchronized young adults per strain were collected with double distilled H2O (without embryos). Bacteria were washed away and worms resuspended in 1 ml into a Cryolysis tube, spun down at 1000g for 2 min and then washed once with 1 ml MS-H2O. Supernatant was removed as much as possible before freezing the pelleted worms in liquid nitrogen and then kept at -80°C.

Worms were broken with 100 µl 1.4mm zirconium oxide beads (Bertin Technologies) and 800 µl MS-H2O in the Precellys machine: 3 bursts of 45’ at 6200 rpm with 45’

interruption; kept at 3-4°C. Lysates were eluted into a glass tube with lipid standards, spun down at 600 g and eluted again with 200 µl MS-H2O.

Lipid extraction was done with 3.6 ml chloroform:methanol (1:2). After vortexing and spinning at 800 g for 5 min, supernatant was transferred to a new glass tube. Phase separation was induced by adding 0.5 ml of MS-H2O plus 0.5 ml of chloroform and by vortexing. After spinning at 800 g for 5 min the lower organic phase was transferred into two 13 mm glass tubes (total lipids and sphingolipids). The sphingolipids fraction was treated with methylamine followed by a butanol extraction.

Samples were run on the Mass Spectrometer TSQ (Vantage) and analysis was performed on LipidX (SystemsX.ch The Swiss Initiative in Systems Biology).

Figure legends

Figure 1. Restored resistance to 48 hours of anoxia within the suppressor ttc-1(gnv3); hyl-2(gnv1).

Anoxia survival of N2, hyl-2(gnv1) and 1(gnv3);hyl-2(gnv1). A, the suppressor ttc-1(gnv3); hyl-2(gnv1) resists 48 hours of anoxia as well as N2 whereas the hyl-2(gnv1) hypersensitive mutant does not survive. B, schematic representation of TTC-1 protein. TTC-TTC-1 is a protein of TTC-1280 amino acids. The mutations found in ttc-TTC-1(gnv3) results in two SNPs inducing two substitutions resulting in Gly¹⁷¹ toGlu¹⁷¹ and Gln¹²⁶¹

Anoxia survival of N2, hyl-2(gnv1) and 1(gnv3);hyl-2(gnv1). A, the suppressor ttc-1(gnv3); hyl-2(gnv1) resists 48 hours of anoxia as well as N2 whereas the hyl-2(gnv1) hypersensitive mutant does not survive. B, schematic representation of TTC-1 protein. TTC-TTC-1 is a protein of TTC-1280 amino acids. The mutations found in ttc-TTC-1(gnv3) results in two SNPs inducing two substitutions resulting in Gly¹⁷¹ toGlu¹⁷¹ and Gln¹²⁶¹