This appendix is about the first subject of my PhD, which was a continuation of my master project. It is related to the characterization of a mutant of C. elegans, which shows a dramaticly extended lifespan. This work was initiated by Vincent Menuz and Monique Fornallaz (former PhD student and former technician in the lab) who isolated this mutant. The results from the mapping of this new mutant led us to conclude that it was related to the daf-2 gene, which is known to increase the resistance of C. elegans to many stresses and to drastically increase the lifespan of the nematode.
Study of the lifespan of C. elegans
The short lifespan of Caenorhabditis elegans makes this animal a very convenient model to study aging. The insulin/IGF-1 and TOR pathways became well described, inter alia, for their importance in animal lifespans (Harrison et al., 2009; Kapahi et al., 2004; Kenyon, 2005; Kenyon et al., 1993; Kenyon, 2010; Vellai et al., 2003). For example, mutations that impair the insulin-like daf-2 pathway in C. elegans, mimic dietary restriction, and can increase the lifespan of the animal by 100% (Lin et al., 2001). An increased lifespan was also observed in C. elegans and other species when the TOR kinase was inhibited (Kenyon et al., 1993; Mendenhall et al., 2006;
Vellai et al., 2003). Nowadays, dietary restriction is the best-known signal that influences different pathways, such as the insulin-like pathway or the TOR pathway, and can lead to extended lifespans (Kenyon, 2010).
rta-1, a mutant with an extended lifespan
rta-1 was generated by mutagenizing wild type animals with ENU (N-ethyl-N-nitrosourea). It was first isolated for its ability to survive 72 hours of anoxia, and was then named rta-1 (resistant to anoxia 1). The mapping of this mutant appeared complicated and tricky because several genes appeared to be mutated: after backcrossing, the phenotype was noticeably weaker. In addition, when we produced rta-1 recombinants with the Hawaii strain for mapping the mutation(s), we never obtained a clear mendelian ratio. It was impossible for us to determine the identity of this mutation. In parallel, we noticed that rta-1 also displayed an extended lifespan compared to wild type worms. Interestingly, the mutation responsible for such a
phenotype seemed to be independent from the resistance to the anoxia phenotype and easier to map. In fact, it appeared to be recessive, monogenic.
Results
We found that rta-1 mutants had an increased lifespan when compared to the wild type animals. At 20°C the half-life of rta-1 reached 40 days whereas the half-life of wild type animals was 20 days (Figure 1A). In addition to this long lifespan, rta-1 displayed an egg-laying impairment (80 for rta-1 vs 280 for N2)(Figure 1B).
Figure 1: In A, at 20°C half-life and lifespan of rta-1 are doubled when compared to N2. This graphic
is representative of more than 3 experiments. In B, defective egg-laying was observed in rta-1 when compared to wild type animals (n = 3).
Since daf-2 mutants are known to constitutively enter dauer larval stage at 25°C (Gottlieb and Ruvkun, 1994), we first ensured that the rta-1 mutant did not display this characteristic. If it had been the case we could have hypothesised that the rta-1 mutation lied in the daf-2 gene and we would not have initiated the mapping of this
and heat shock (Lithgow et al., 1995; Mendenhall et al., 2006), and in our case we observed that the long lived recombinants that we further isolated were not all resistant to anoxia, which suggested that rta-1 may not be a daf-2 mutant.
As described in ttc-1(gnv3) project, we performed a RSNP mapping that allowed us to define a mapping zone. We combined this with a WGS performed by Fasteris. The sequenced animals were rta-1, and N2 from our lab, which was our reference.
The RSNP allowed us to map the rta-1 mutation to chromosome III, and when trying to reduce the mapping zone with new recombinants, we were unable to exclude the daf-2 gene from the zone.
In parallel the WGS was performed and no mutation was found in the daf-2 open reading frame. However, we could not exclude the possibility that daf-2 may be involved in the longevity phenotype. We decided to perform a complementation test between the rta-1 mutant and daf-2(e1370) and to analyse the lifespan of the progeny. In parallel we analysed the expression of the daf-2 gene in the rta-1 mutant by Northern blot. We crossed rta-1 with daf-2(e1370) and analysed the lifespan of the F1 rta-1+/-;daf-2+/- in comparison with 1, daf-2(e1370) and N2. We found that rta-1+/-;daf-2+/- had a lifespan similar to that of rta-1 and daf-2(e1370) (Figure 2A). This strongly suggests that the rta-1 mutant is related somehow to daf-2.
Figure 2: In A, lifespan of rta-1+/-;daf-2+/- strain compared with the lifespan of N2, rta-1 and daf-2 strains. Day 0 starts from L1 stage. rta-1, daf-2 and rta-1+/-;daf-2+/- have comparable lifespans, no striking differences were observed indicating that rta-1 does not complement daf-2. N2 was used as a control and displayed a normal lifespan. In B, Northern Blot analysis of daf-2 in N2, rta-1 and daf-2 strains. act-1 was used as a control for the quantification, which was normalised to N2 . N2 = 100%
(1), rta-1 = 30% (0.3), daf-2 = 70% (0.7) (see table). This Northern Blot revealed a decrease in daf-2 expression in the rta-1 mutant.
Since, the daf-2 gene does not show obvious mutations, we hypothesized that the rta-1 mutation could affect regulation of daf-2 expression. This hypothesis was confirmed by northern blotting as shown in Figure 2B.
Altogether these results suggest that rta-1 might not be a mutation that directly targets the daf-2 coding sequence, but rather that it affects its expression leading to a deficient insulin-like pathway and increased the lifespan of the worm.
Conclusion
The mutation in the rta-1 mutant, responsible for its extended lifespan, appeared complicated to identify. We were able by a complementation test and by northern blotting to reveal a link between rta-1 and daf-2 but we still did not know how daf-2 expression is impaired in rta-1. One hypothesis would be that a mutation lies in a daf-2 regulatory region, impairing transactivation of the gene. We wanted to sequence the promoter region of daf-2 in rta-1 but due to several nucleotide repetitions in this region, we were unable to obtain high quality sequencing. Because a large number of mutations altering daf-2 expression have been previously reported (Gami and Wolkow, 2006), we decided that it was not worth further investigating this mutant.
Material and Methods of Appendix 2
RSNP mapping
RSNP mapping was performed as described in (Davis et al., 2005) using Hawaii CB4852 as the polymorphic strain.
Whole Genome Sequencing (WGS)
WGS was performed by Fasteris (Geneva) and the results were analysed with the free software IGV (Integrative Genomic Viewer) from the Broad Institute.
ENU Mutagenesis
Synchronized 72L1 were mutagenized in M9 containing ENU (10mM) for 4 hours at 20°C. Then, they were let to recover O/N at 15°C on seeded NGM plates. 5 mutagenized animals very isolated on 5 10cm diameter plates and let to lay about 100 embryos (F1) and were then removed. F1 was removed after laying about 100 embryos. The F2 at 72L1 stage was the tested in anoxia as described in (Menuz et al., 2009).
Lifespan analysis
Synchronized L1 of each strains were grown on normal plates and then the L4 were plated onto plates seeded with OP50 containing 10% of 5mg/ml Fluorouracile (Mylan). Survivors were scored everyday and dead worms were removed from the plates.
Complementation test
rta-1 males were crossed with dpy-1(e1) daf-2(e1370)III double mutant. The non-dumpy F1 was isolated and its lifespan was analysed following a normal lifespan analysis method, as previously described.
RNA extraction and Northern blotting
Total RNA of 100µl of synchronized young adult packed worms was extracted with TRI reagent (Sigma) according to the protocol from Molecular Research Center (http://www.mrcgene.com/tri.htm). Northern blotting was performed as described in (Jourdain et al., 2013). Radio active RNA probes were prepared with SP6 RNA polymerase, for daf-2 fragment: forward ATCAACGTGAGCATCACAGC and reverse CGGATTTAGGTGACACTATAGAAGCGTCTCTTTCGGATCTTTCG, for act-1
fragment: forward CACGGTATCGTCACCAACTG and Reverse
CGGATTTAGGTGACACTATAGAAGGTTTCCGACGGTGATGACTT.
Brood size analysis
Around 3 synchronized L4 hermaphrodites per strain were isolated in 3 different NGM plates containing OP50. They were transferred every day onto new plates until they laid their last embryo and L1-L2 larvae were counted and removed from the plates.