Résultats et conclusions

1. Lors d’injection striatale, le TetON présente une efficacité inférieure au rAAV2/1-pCMV en terme de nombre de cellules exprimant la GFP mais pas en terme de volume de tissu touché. Par ailleurs, le vecteur rAAV2/1-TetON présente un profil de biosécurité supérieur au vecteur rAAV2/1 en ce sens que la dispersion du produit de son transgène dans d’autres régions cérébrales que le striatum, en particulier dans la substance noire est plus limitée que dans le cas du rAAV2/1-pCMV. Par ailleurs, tout comme le rAAV2/1-pCMV, le vecteur rAAV2/1-TetON n’entraîne pas de recrutement de lymphocytes T, ni d’activation de la microglie.

2. Lors d’injection mésencéphalique, le rAAV2/1-TetON, contrairement au rAAV2/1-pCMV, présente une expression préférentielle dans les neurones dopaminergiques de la SNpc. Des expériences de quantification de génomes viraux et de transcrits du transgène montrent qu’il s’agit bien d’une expression préférentielle.

B. Les vecteurs AAV de sérotype 1 inhibent transitoirement la

prolifération des précurseurs de la zone sous-ventriculaire de rat.

Les vecteurs rAAV2/1 ont la capacité de transduire les progéniteurs de la SVZ mais cette caractéristique est peu documentée. Le but de ce travail est d’étudier les vecteurs rAAV2/1 (génome simple-brin) et scAAV2/1 (génome self-complémentaire pouvant se reployer sous forme double-brin) comme outils de transfert de gènes pour les progéniteurs de la SVZ de rat sain.

II. Résultats et conclusions :

1. Lorsque le rAAV2/1 est injecté dans le striatum adjacent à la SVZ, il présente une affinité importante pour les cellules constituant cette zone et une expression précoce.

2. Le scAAV2/1 présente une cinétique d’expression dans la SVZ plus rapide que le rAAV2/1 (expression maximale à 24h et 48h respectivement).

3. Les scAAV2/1 et rAAV2/1 présentent une affinité importante pour les cellules de type A (neuroblastes en migration) et C (« transit amplifying cells ») mais ne semble pas être très efficace sur les cellules B (cellules souches neurales).

4. Les scAAV2/1 et rAAV2/1 induisent une baisse de la prolifération transitoire dans la SVZ.

5. Cette baisse de prolifération n’est pas induite par l’expression du transgène.

6. La transduction de la SVZ par du rAAV2/1 n’induit pas d’apoptose des progéniteurs de la SVZ.

7. L’infection des progéniteurs de la SVZ ne modifie pas leur capacité à migrer dans le BO et à s’y différencier ou à s’intégrer.

AAV serotype 1 vectors transiently inhibit proliferation of neural precursors

of the rat subventricular zone.

O.Bockstael ^1,2, C.Melas^1,2, D.McCarty^3,$, J.Brotchi¹, M.Levivier^1,§, R.J. Samulski³ , L.Tenenbaum^1,2,#

1Laboratory of Experimental Neurosurgery and ²Multidisciplinary Research Institute (I.R.I.B.H.M.), Free University of Brussels (ULB), ³Center for Gene Therapy, University of North Carolina at Chapel Hill

§Present address: Dpt of Neurosurgery, CHUV, Lausanne

$Present address: Children's Hospital, Columbus, Ohio.

#Corresponding author : Laboratory of Experimental Neurosurgery/IRIBHM, CP602, U.L.B.-Hôpital Erasme, Brussels, Belgium Tel: +32-2-555-40-95, Fax: 32-2-555-46-55; E-mail:

ABSTRACT

Precursor cells found in the adult brain subventricular zone (SVZ) can proliferate and migrate to the olfactory bulb (OB) where they differentiate into mature neurons. Gene transfer into SVZ precursors prior to their migration has been proposed with the purpose to recruit these cells for repair of CNS lesions. Pseudotyped adeno-associated viral vectors type 1 (rAAV2/1) have a preferential tropism for the SVZ. We have investigated the efficiency and cellular specificity of titer-matched single-stranded (ssAAV2/1) and self-complementary (scAAV2/1) vectors in the SVZ. GFP-positive cells were detected as early as 17H and 24H post-injection of scAAV2/1 and ssAAV2/1, respectively and maximal transduction was reached at 24H and 48H, respectively. After 4 days, transduction decreased with both vectors, possibly due to the migration of transduced cells. Increasing the titer of ssAAV2/1 20-fold did not modify the kinetics and the maximal transduction efficiency. Both vectors mainly transduced transit-amplifying Olig2⁺ cells and Dcx⁺ migrating neuroblasts: respectively, 37% and 45%, at 2 days post-injection. In contrast, only 6 % of transduced cells were GFAP⁺ neural stem cells.

Unexpectedly, 24 hours after injection of high-titer ssAAV2/1, the proliferation index in the SVZ was significantly reduced. UV-irradiated viral particles which have lost the capacity to express GFP in 293T cells in vitro still inhibited proliferation in the SVZ suggesting that this effect was not dependent on transgene expression. GFP⁺ cells co-labeling with the NeuN marker of mature neurons were found in the OB one month after virus injection, suggesting that the proliferation inhibitory effect did not drastically impede migration and differentiation of neuronal progenitors. After 4 weeks, the proliferation index was similar in ssAAV2/1- and sham-injected animals, suggesting that the inhibitory effect was restricted to the population of initially-infected progenitors.

INTRODUCTION

The neurogenic pathway of the adult rat subventricular zone (SVZ) consists of three cell types: glial fibrillary acidic protein (GFAP)-positive cells among which multipolar astrocyte-like cells and mono- or bipolar cells which are slowly proliferative (called “type B” cells), rapidly dividing Olig2-positive cells (called “transit-amplifying” or “type C” cells) and neuroblasts (called “type A” cells) which are characterized by the expression of double-cortin (Dcx) and migrate through the rostral migratory stream to the olfactory bulb (OB) 705.

By selective killing of type C cells or by cell fate mapping using GFAP-Cre transgenic mice, it has been shown that type B cells are the ancestor of type C and type A cells ^{259, 366}.

Gene transfer into the neural stem cells of the SVZ prior to their migration has been proposed with the purpose to recruit these cells for repair of CNS lesions. Several viral vectors have been shown to efficiently transduce cells of the SVZ-OB lineage.

Retroviral vectors were first used ⁷⁰⁶. Their requirement for cell division has allowed to specifically label proliferating cells of the SVZ, namely the rapidly proliferating type C cells and to a lesser extent the slowly proliferating GFAP-positive type B cells. Since retroviral vectors integrate into the cellular genome, they have been used for tracing and fate analysis of neural stem cells ⁷⁰⁷.

More recently, lentiviral vectors which can transduce both dividing and non-dividing cells have been proposed for neural stem cells fate analysis ⁷⁰⁸. Lentiviral vectors pseudotyped with vesicular stomatitis virus envelop, were shown to overpass retroviral vectors for both efficiency and stability of transgene expression ^{708, 709}. In particular, these vectors efficiently transduce the GFAP-positive neural stem cells ensuring a long-term labeling of the whole pathway. Indeed, the number of labeled cells in the OB increased with time up to at least 7 months ⁷⁰⁸.

However, for therapeutical gene delivery, a non-integrative vector should be preferred in order to minimize the risk of insertional mutagenesis into dividing cells ⁷¹⁰.

Adenoviral vectors which are able to transduce both dividing and non-dividing cells, are expected to transfer genes in the 3 cell types of the SVZ neurogenic pathway and GFP expression was found in the SVZ and in the OB for at least 2 months post-injection ⁷¹¹.

Recombinant AAV4 vectors specifically transduce ependymal and GFAP-positive cells of the SVZ after injection in the lateral ventricle 712.

Recombinant rAAV2/1 vectors were previously shown to efficiently transduce cells of the SVZ which lateron migrate to the OB ⁶⁶⁴. However, these cells have not been further characterized. Single-stranded rAAV2/1 vectors (ssAAV2/1) were shown to express gfp up to detectable levels as early as 4 days post-injection in the brain ^{683, 713}, a time point at which a significant fraction of the initially-infected cells are expected to have migrated away from the SVZ (Craig et al., 1999). Self-complementary AAV vectors (scAAV), bypassing the need for second-strand synthesis, were shown to shorten the delay for transgene expression in the brain 683, 687, 695, 695, 713, 714.

In this report, it is shown that ssAAV2/1 and scAAV2/1 vectors injected in the medial striatum can mediate detectable gfp transgene expression in the SVZ as early as 24h and 17h, respectively. Both vectors mainly transduced Olig2-positive and Dcx-positive cells and resulted in the appearance of numerous GFP-positive cells in the OB one month post-infection. A partial inhibition of cell proliferation was observed in the transduced area 24 hours post-injection of high-titer ssAAV2/1. These data are in accordance with the previously observed cell cycle perturbation of primary cultures of fibroblasts by high loads of AAV2 ^{715, 716}. This inhibitory effect did not depend on transgene expression, was transient and did not impede the migration of the transduced cells to the OB and their integration as mature neurons.

MATERIAL AND METHODS

Plasmids and viruses

Recombinant scAAV2/1 or ssAAV2/1 virus expressing the eGFP reporter gene under the control of the CMV promoter were produced by cotransfection of HEK-293T cells with pHpaItrs (⁶⁸⁷ or pTR-eGFP ⁷¹⁷, respectively, and pDP1rs ⁵⁷¹ purchased from Plasmid Factory). Briefly, 3 μg pTR-eGFP or pHpaI-trs and 10 μg pDP1rs were transfected into 5 X 10⁶ cells (per 10cm-plate seeded one day before) using the calcium-phosphate co-precipitation method. The cell pellets from 20 plates were harvested, treated with benzonase and purified by iodixanol gradient followed by QXL chromatography ⁵⁷⁷. The virus was microconcentrated and diluted into D-PBS using Centriplus (Millipore).

Titers were measured by real-time PCR as described in (http://www.bioprocessingjournal.com/ReferenceMaterials/pdfs/AAV2_RSS_genome_copy_titration_ QPCR.pdf ). Briefly, the method was first established using rAAV serotype 2 reference standard (Moullier and Snyder, 2008; Potter et al., 2008). Viral particles were digested using DNAse 1 (10U per 5 ml of virus diluted in 50 ml of DNAse digestion buffer (13 mM Tris-Cl pH 7.5,5mM MgCl2; 0.12 mM CaCl2). Serial dilutions of the virus were submitted to qPCR using the qPCR Master mix (Applied BioSystems) and as forward primer (5’AGCAATAGCATCACAAATTTCACAA3’); as reverse primer (5’CCAGACATGATAAGATACATTGATGAGTT3’), and as internal fluorescent probe 6FAM-AGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTC-TAMRA (Eurogentec, Liège, Belgium). Titers expressed as viral genomes per milliliter were: ssAAV2/1-CMV-eGFP , 8.6 X 10¹¹ ; scAAV2/1-CMV-eGFP, 2.1 X 10¹⁰.

The amount of viral capsids in the ssAAV2/1-CMV-eGFP viral preparation per milliliter was found to be 5.9 X 10¹². (as evaluated by ELISA assay according to manufacturer’s recommendations ; Progen, Heidelberg, Germany).

Surgical procedures

Adult female Wistar rats of 250 g (Charles River, France) were used for unilateral intracerebral injections as previously described 663. The animals were anesthetized using a mixture of ketamine (ketalar, 100 mg kg − 1 ip) and xylazine (Rompun, Bayer; 10 mg kg− 1 ip). Injections were made according to coordinates defined by Paxinos and Watson ⁷¹⁸ using a Kopf stereotaxic apparatus (David Kopf, Tujunga, CA). Viral particles diluted in 2 μl D-PBS (BioWittaker) were infused using a

motor-driven Hamilton syringe (0.2 μl/min) with a 30-G needle at the following coordinates: AP=0 mm, L=-2.2 mm relative to bregma and DV=-4.2 mm relative to cerebral surface. After injection, the needle was left in place for 5 min in order to allow diffusion of the viral suspension in the parenchyma. The needle was then slowly lifted 1 mm up and left in place 5 min, then slowly removed.

Animals were maintained, 4 in each cage, in a 12:12 h light–dark cycle with free access to rat chow and water. All experimental procedures were conducted in accordance with the Belgium Biosafety Advisory Committee and with the ethical committee of the Faculty of Medicine (CEBEA, ULB).

Animals were killed at the indicated time after virus injection by an overdose of anesthetic (200 mg kg− 1 ketamine and 20 mg kg− 1 xylazine). For immunohistological analysis, animals were perfused through the ascending aorta first with 150–200 ml of saline (NaCl 0.9%), then with 200 ml 4% paraformaldehyde in 0.1 M phosphate buffer (PF4). After overnight post-fixation in PF4 at 4 °C, brains were transferred to phosphate-buffered saline (PBS) and stored at 4 °C.

BrdU:

When indicated, 5-bromo-2’-deoxyuridine-5’-monophosphate (BrdU 20 mg kg^-1; Sigma) was injected intraperitoneally twice a day.

For proliferative index, BrdU (20mg kg^-1 was injected 3 times intraperitonaly 20, 4 and 2 hours before surgery. BrdU (1 mg ml^-1) was also given in drinking water containing sucrose (30g l^-1) during the night before surgery (from 20h before surgery to 4h before surgery).

Immunohistochemistry

For GFP stainings, vibrating blade microtome sections (50 μm) were sequentially incubated in: i) 3% H2O2 in TBS (Tris 10mM, 0.9% NaCl, pH7.6) for 30 min.; ii) THST (50mM Tris, 0.5 M NaCl, 0.5% Triton X100 pH7.6) containing 10% horse serum for 1 hour.; iii) polyclonal rabbit anti-GFP (Clonetech, Palo Alto, CA) diluted 1:3000 in THST containing 5% horse serum overnight à 4°C; iv) donkey anti rabbit IgG conjugated with biotin (Amersham, GE Healthcare, Munich, Germany) 1:600 in THST containing 5% horse serum, 2 hours at room temperature. The peroxidase staining was revealed using the ABC Elite vectastain kit and diaminobenzidine (Vector, NTL Laboratories, Brussels, Belgium), according to the manufacturer’s protocol. Sections were mounted on gelatin-coated slides, dehydrated and mounted using DPX mounting fluid (Sigma-Aldrich, St Louis, MO). Sections were photographed using a Zeiss Axiophot 2 microscope (Carl Zeiss, Gottingen, Germany).

For evaluation of transduction volumes, surfaces of labeled SVZ were first evaluated on every fifth section using the Axiovision program (Version 4.7.1; Carl Zeiss Imaging Solutions). Volumes (in μm³) were calculated by adding the surfaces of positive sections and multiplying by the section thickness (50 μm) and by 5.

Immunofluorescence

Coronal sections (50 μm) obtained using a vibrating blade microtome (Leica) were sequentially incubated in: i) THST (50mM Tris, 0.5 M NaCl, 0.5% Triton X100 (Merck) pH7.6) containing 10% horse serum for 2 hours.; ii) polyclonal rabbit anti-GFP IgG(1:3000, Molecular Probes, InVitrogen) diluted in THST containing 5% horse serum for 16 hours at 4°C; iii) donkey anti rabbit IgG conjugated with biotin (Amersham) diluted 1:600 in THST containing 5% horse serum, 2 hour at room temperature; iv) streptavidin conjugated to cyanine 2 (1:300; Jackson ImmunoResearch, West Grove PA) in THST containing 5% horse serum, 2 hours at room temperature. Three washings in TBS (Tris 10mM, NaCl 0.9%, pH7.6) of 10 min. were performed between each step.

For double immunofluorescence, these incubations were combined with mouse monoclonal antibodies anti-NeuN (1:200, Chemicon) or anti-glial fibrillary acid protein (GFAP, 1:200, Chemicon)) (step ii); and donkey anti-mouse IgG coupled to cyanine 3 (1:200; Jackson ImmunoResearch, West Grove PA) in THST containing 5% horse serum) (step iv).

For double immunofluorescence directed against GFP and DCX, these incubations were combined with guinea pig polyclonal antibodies anti-DCX (1/300, Chemicon) (step ii); and donkey anti-guinea pig IgG coupled to cyanine 3 (1:200; Jackson ImmunoResearch, West Grove PA) in THST containing 5% horse serum (step iv).

For Olig-2/GFP immunofluorescence, a chicken monoclonal anti-GFP antibody (ABcam) at a 1:1000 dilution was combined with rabbit polyclonal anti Olig-2 IgG (1:500, Chemicon, Millipore, Billerica, MA) in PBS containing 5% horse serum and 0.1% Triton X100 16 hours at 4°C (step ii). The primary antibodies were detected using a donkey anti-rabbit IgG conjugated with biotin (1:200, Amersham, GE Healthcare, Munich, Germany) and a goat anti-chicken IgG conjugated with Alexa 488 ( 1/1000 molecular probes) in PBS containing 5% horse serum and 0.1% Triton X100, 2 hour at room temperature (step iii) and then incubated with streptavidin coupled to cyanine 3 (1/600 Jackson ImmunoResearch) in PBS containing 5% horse serum and 0.1% Triton X100, 2 hour at room temperature (step iv).

For BrdU immunofluorescence, sections were first treated as follows to allow the antibody to reach the nucleus: sections were incubated into HCl 2N for 30 min. at room temperature and then further incubated at 37°C for 30 min. Sections were then transferred into sodium borate 0.1M pH 8.5 for 15 min.

For BrdU/GFP and BrdU/Ki67 double immunofluorescence, a rat monoclonal anti-BrdU antibody (1:200, Abcam) was combined with rabbit polyclonal anti-GFP (1:3000, Molecular Probes) or rabbit polyclonal anti-Ki67 (1:500, Novo Castra) antibody in THST containing 5% horse serum 16 hours at 4°C (step ii). Step iii was performed as described above; a goat anti-rat IgG coupled to cyanine 3 (1:600, Jackson Immunoresearch) was used to detect anti BrdU primary antibodies (step iv).

Sections were mounted using FluorSave mounting fluid for fluorescence (Calbiochem) and photographed using a Zeiss Axiophot 2 microscope equipped with FITC and TRITC filters (Zeiss, Göttingen) as well as an AxioCam digital camera (Carl Zeiss, Gottingen, Germany). Images were acquired using the Axiovision program (Version 4.7.1; Carl Zeiss Imaging Solutions).

Confocal microscopy

Co-labeling analysis were performed on pictures taken on at least three different sections using an automatic image analysis system (Lasersharp version 3.2, Biorad) coupled to Axiovert 100 microscope, (Carl Zeiss, Germany). Pictures were then processed and analysed with the Image J software (NIH, USA).

Proliferative index

The proliferative index is the ratio of the number of proliferating cells (detected by the expression of the Ki67 protein) and the number of cells previously in proliferation measured by the incorporation of BrdU during a given time lapse.

Apoptosis detection:

To evaluate apoptosis induction the In Situ Cell Death Detection Kit (Roche Applied Science) was used according to manufacturer’s recommendations.

Briefly, the animals were killed 24h after surgery by decapitation after the injection of an overdose of anesthetic (200 mg kg^{− 1} ketamine and 20 mg kg^{− 1} xylazine), the brains rapidly frozen to -20°C using dry ice in a bath of methyl-butane and then stored at -80°C. Cryosections of 16µm thick were made using a Leica cryostat and placed on Superfrost + slides. TUNEL detection was made using

the In Situ Cell Death Detection Kit (Roche Applied Science) according to manufacturer’s recommendations for difficult tissues. TUNEL positive cells were quantified using a Zeiss Axiophot 2 microscope equipped with FITC and TRITC filters (Zeiss, Göttingen) on five sections surrounding the injection site covering 400µm on the antero-posterior axis. Cells were counted in the SVZ ipsilateral and contralateral to the injection site. Ipsilateral counts were divided by contralateral counts to normalize small antero-posterior differences between animals.

Statistical analyses

Means ± standard deviations are shown.

Data were analyzed using the Graph Pad Software Prism 3.0. Unpaired Student t tests were performed.

Virus irradiation:

ssAAV2/1-CMV-eGFP diluted in D-PBS (Biowhittaker) was irradiated using a UV Stratalinker chamber (Stratagene) at a dose of 4800 J/m². Irradiation completely abolished GFP expression as assessed by infection of HEK-293T cells and FACS analysis.

RESULTS

Preferential transduction of neural progenitors of the subventricular zone by rAAV2/1

It has been previously reported that, injection of rAAV2/1 vectors using the CMV promoter in the striatum of mice ^{664, 719} and rats ⁷²⁰ resulted in efficient transduction of the SVZ. In these studies, GFP-positive cells were found in the OB, the region in which neural stem cells of the SVZ terminally differentiate.

Due to the rapid dynamics of the SVZ-OB pathway 721, we evaluated transduction efficiency of self-complementary and single-stranded AAV2/1 vectors during the first 4 days after injection of 4.3 10⁷ genome copies of each virus (the titer of the ssAAV2/1 virus as evaluated by quantitative PCR was multiplied by a factor of 2 in order to match it with the double-stranded scAAV2/1 genome). Transduction efficiency was evaluated as the volume of SVZ stained by GFP immunohistochemistry (Fig 1b).

scAAV2/1 transduced the SVZ as early as 17H post-vector injection and the maximal transduction efficiency was reached at 24H (Fig 1a). In contrast, ssAAV2/1-transduced cells in the SVZ were only detected starting at 24H post-injection and the highest efficiency was reached at 48H (Fig 1a). Transduction decreased at 96 H, the decrease being more pronounced for the ssAAV2/1 vector (Fig.1a) and was very low at one month (only few GFP-positive cells; data not shown). Increasing the amount of ssAAV/2/1 20-fold (injection of 8.6 10⁸ genome copies) did not result in a significant improvement of transduction efficiency (Fig. 1b).

Characterization of GFP-positive cells in the olfactory bulb one month post-injection of rAAV2/1

We have shown previously ⁷²⁰ that numerous GFP-positive cells were present in the OB 5 weeks after injection of 4 x 10⁸ viral genomes of rAAV2/1-CMV-eGFP in the medial striatum. The olfactory bulb GFP-positive cells were further characterized by double immunofluorescence staining. No GFP/GFAP co-labeled cell was identified (fig. 2b). The vast majority of transduced cells were NeuN-positive (90.62 % ± 3.93 %, fig. 2a; n = 4). Among these, there were no TH-positive cells as expected for granular cells (data not shown).

Since most type C progenitors and type A neuroblasts which were present in the SVZ at the time of injection, are expected to have migrated away in the RMS within few days ⁷²¹, animals were sacrificed two days (n = 4) after injection of 2 10⁶ infectious units of ssAAV2/1 or scAAV2/1 into the SVZ of adult rats. Vibrating blade microtome sections were submitted to double immunofluorescence for GFP and respectively, GFAP (labeling slowly proliferating type B cells), Olig2 (labeling rapidly proliferating type C cells) or Dcx (labeling migrating type A neuroblasts) (Fig 3a).

As shown in Figure 3b, 2 days post injection of ssAAV2/1, 36,97 % ± 6.9 % of GFP+ cells in the SVZ (as delineated by Toto staining; data not shown) were Olig2⁺, 44.71 % ± 2.08 % were Dcx⁺ whereas only 5.85% ± 0.45 % were GFAP⁺. Similar proportions of Olig2⁺, and GFAP⁺ were transduced by the scAAV2/1 vector. The proportion of Dcx⁺/GFP⁺ cells was slightly but significantly higher with the ssAAV2/1 vector (44.7 % ± 2.1 % versus 32.9 ±6.2 % for the scAAV2/1 vector; p=0.0113; Student t test).

Inhibition of SVZ proliferative activity by rAAV2/1 virus

Since BrdU is mainly incorporated by transit-amplifying type C cells, it is expected that when Olig2+ transduced cells migrate to the olfactory bulb and differentiate into post-mitotic neurons, they still harbor BrdU in their genome. We thus searched for BrdU/GFP double-labeled cells in the OB.

When BrdU was administered for 5 days starting 5 days before virus injection of 4 10⁸ genomes, 83.12 % ± 11.07 % of GFP-positive cells found in the OB 5 weeks later co-labeled with