[PDF] Top 20 Rare variant association testing in the non-coding genome
Has 10000 "Rare variant association testing in the non-coding genome" found on our website. Below are the top 20 most common "Rare variant association testing in the non-coding genome".
Rare variant association testing in the non-coding genome
... Introduction The development of high throughput genome sequencing technologies has opened-up new perspectives in the study of human diseases, including common diseases (Petersen et ...with ... Voir le document complet
26
Beyond genome-wide scan: Association of a cis-regulatory NCR3 variant with mild malaria in a population living in the Republic of Congo
... upstream the NCR3 translation start site (chromosome 6: 31592727– 31593389 according to the hg38 assembly) was cloned by “Sticky end PCR Cloning” ...with the for- ward primer (CGCGTACCCAACCAAACACA) ... Voir le document complet
15
Quantitative EEG during normal aging: association with the Alzheimer's disease genetic risk variant in PICALM gene.
... t Genome-wide association studies have identified novel risk variants for Alzheimer’s disease ...of the highest risks for AD is PICALM. The PICALM rs3851179 A allele is thought to have a ... Voir le document complet
8
TAGOOS: genome-wide supervised learning of non-coding loci associated to complex phenotypes
... regulatory variant priorization approaches do not take into account the LD structure of reference ...Regulatory variant priorization ap- proaches can be divided again in supervised and ... Voir le document complet
15
A novel rare CUBN variant and three additional genes identified in Europeans with and without diabetes: results from an exome-wide association study of albuminuria
... mutation in CUBN associated with the only cause of proteinuria in affected family members [ 37 ...frequent in ‘non-diseased’ popula- tions and are thus well tolerated by humans [ 38 , ... Voir le document complet
15
Family-based genome-wide association study of leprosy in Vietnam
... a rare example of an essentially clonal bacterial pathogen that affects ...reflecting the interactions between the host immune response and the ...evidence, in particular from ... Voir le document complet
17
Common and rare variant analysis in early-onset bipolar disorder vulnerability.
... of the most common and devastating psychiatric disorders whose mechanisms remain largely ...of the disease, we conducted a genome-wide association study focused on 211 patients of French ... Voir le document complet
9
Genome-Wide Association Study of HIV Whole Genome Sequences Validated using Drug Resistance
... observed. The first was two associations within RT amino acid 68. The first was between tenofovir failure and SNP 2738G resulting in a change from serine to ...using the Stan- ford University ... Voir le document complet
15
Excess of rare coding variants in PLD3 in late-but not early-onset Alzheimer's disease
... variants in central European AD and frontotem- poral lobar degeneration (FTLD) patients, particularly investigating the role of PLD3 variants in early-onset AD ...screened the 13 coding ... Voir le document complet
5
Tracking the Genetic Susceptibility Background of B-Cell Non-Hodgkin's Lymphomas from Genome-Wide Association Studies
... targets in DLBCL, for example, a two-stage French study comprising four different cohorts in European population led to the discovery of two non-coding ...variants. The first one ... Voir le document complet
22
Power of genome-wide association studies in the presence of interacting loci.
... models in stating that the use of tSNPs is an efficient way to conserve genotyping costs while maintaining power to detect an effect [ de Bakker, et .... In all models examined, the loss of ... Voir le document complet
18
Association of a Schizophrenia-Risk Nonsynonymous Variant With Putamen Volume in Adolescents A Voxelwise and Genome-Wide Association Study
... strategy in terms of Bonferroni correction for the discovery of significant vGWAS ...to the sample size of the discovery study. However, if we used the meta-analysis for the ... Voir le document complet
12
Assessing the Impact of Differential Genotyping Errors on Rare Variant Tests of Association
... on the statistical methods used to analyze rare variant data, regardless of the technology used to generate the variant ...simplifies the true allele frequency ... Voir le document complet
11
Association mapping of inflammatory bowel disease loci to single variant resolution.
... available in the online version of the ...assistance in designing illustrations, and K. de Lange for comments on the Supplementary ...from the following ...for the ... Voir le document complet
19
Exome-Wide Association Study Identifies New Low-Frequency and Rare UGT1A1 Coding Variants and UGT1A6 Coding Variants Influencing Serum Bilirubin in Elderly Subjects
... Abstract: Genome-wide association studies (GWASs) have identified loci contributing to total serum bilirubin ...assessed the influence of protein-coding variants on unconjugated, conjugated, ... Voir le document complet
12
Characterizing non-coding hits in genome-wide association studies using epigenetic data
... By starting from the empirical cutoff rather than from enriched clusters directly, we also find some novel enrichments. For example, we find over 1,000-fold enrichment of [r] ... Voir le document complet
48
In silico mining of microsatellites in coding sequences of the date palm (arecaceae) genome, characterization and transferability
... CONCLUSIONS The loci described here are a useful addition to previously published microsatellite markers for .... The most polymor- phic loci can be added to other SSR loci to create marker sets for genetic ... Voir le document complet
7
Absence of NMDA receptor antibodies in the rare association between Type 1 Narcolepsy and Psychosis
... underlying the association between narcolepsy type 1 (NT1) and psychosis remain unclear with potential role for a common immune ...estimated the frequency of psychosis and its characteristics ... Voir le document complet
7
Undetectable HbA1c in a type 2 diabetic woman: Case report of a rare haemoglobin variant
... HbA 1c concentrations measured using a HPLC method (Adams ARKRAY, KYOTO, Japan distributed through Menarini, Italy) were undetectable. An electrophoresis of hemoglobin reported: HbA 0% (normal range 94,5-98,5), HbA2 2,4% ... Voir le document complet
1
The Non-Coding RNA Journal Club: Highlights on Recent Papers
... Yang The structures of RNA molecules, the skeletons bound by trans-acting RNA-Binding proteins (RBPs), are essential for their function and ...RBP in human 293 cells [15]. In a separate study, ... Voir le document complet
7
Sujets connexes