Présentation des travaux - Voie Hedgehog et système VIP-récepteurs dans des cellules de gliobla

Chapitre IV. Présentation des travaux

Article n°1

Evaluation des propriétés cytotoxiques de la

prodrogue glucuronylée de la cyclopamine dans

des cellules de glioblastome, des astrocytes et le

tissu cérébralde rat

Souheyla BENSALMA, Corinne CHADENEAU, Thibaut LEGIGAN, Brigitte RENOUX,

Caroline PINET-CHARVET, Sébastien PAPOT and Jean Marc MULLER.

En révision dans le journal « Journal of Molecular Neuroscience »

Les travaux présentés dans ce premier article ont pour objectif d’évaluer la cytotoxicité de la prodrogue glucuronylée de la cyclopamine (prodrogue 1b) dans les cellules C6 de GBM de rat ainsi que dans des astrocytes normaux de rat nouveaux nés (NRA).

Dans un premier temps nous avons vérifié l’expression des composants de la voie Hh dans ces cellules. L’analyse par RT-PCR révèle une forte expression du gène cible de la voie, le gène GLI1, dans les cellules C6 tandis qu’un faible niveau d’ARNm GLI1 a été détecté dans les NRA. De plus, la cible de la cyclopamine, le co-récepteur de la voie Hh, SMO, a été recherché dans ces cellules par une étude d’immunocytochimie. Chez les mammifères la protéine SMO est connue pour être localisée au niveau du cil primaire. L’étude immunocytochimique de la protéine SMO dans les cellules C6 et NRA a montré une colocalisation de SMO avec la tubuline-α-acétylée, un marqueur du cil primaire. Ceci indique que la cible de la cyclopamine est exprimée dans ces cellules au niveau de la localisation attendue.

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

Nous avons ensuite isolé les cellules souches cancéreuses (CSC) existantes dans la lignée C6 de GBM. Ceci est réalisé par culture des cellules C6 dans un milieu sans sérum supplémenté avec des facteurs croissances (EGF et FGF). Ces CSC de la lignée C6 (C6-GSC) expriment des marqueurs de cellules souches SOX2 et nestine, et en présence de sérum ces cellules se différencient en astrocytes (GFAP positifs) et en neurones (tubuline-β-III positifs).

Des analyses de viabilité cellulaire par le MTS indiquent que la prodrogue 1b n’affecte pas la viabilité des cellules C6 et les C6-GSC en absence de la β-glucuronidase. Cependant, l’addition de la β-glucuronidase dans le milieu de culture induit une diminution de la viablité cellulaire, similaire à celle obtenue avec la cyclopamine seule. L’analyse de l’activité de la capsase 3/7 montre que ces effets sur la viabilité semblent être dus à une activation du phénomène d’apoptose.

De plus, la prodrogue 1b n’affecte pas la viabilité des astrocytes en absence ou en présence de la β-glucuronidase. Ceci pourrait être dû à la faible activation de la voie Hh dans ces cellules.

Pour vérifier la spécificité de l’effet de la prodrogue activée et de la cyclopamine sur la voie Hh, une analyse de l’expression du gène GLI1 a été réalisée par RT-qPCR dans les cellules C6 et C6-GSC. Les données démontrent que la prodrogue diminue l’expression du gène GLI1 seulement en présence de la β-glucuronidase, similairement à la cyclopamine, indiquant ainsi que la voie Hh est active dans ces cellules et qu’elle est bien inhibée par la cyclopamine.

Enfin, les propriétés cytotoxiques de la prodrogue 1b ont été évaluées sur des coupes organotypiques du cerveau préparées à partir de rats adultes. Après traitement des coupes avec la prodrogue en absence ou en présence la β-glucuronidase, nous avons réalisé un marquage des cellules vivantes et mortes en utilisant la calcéine (chélateur du calcium) et l'iodure de propidium, respectivement. Le traitement avec la prodrogue seule n’induit pas de mort cellulaire, tandis que l’ajout de la β-glucuronidase à la prodrogue provoque, comme en présence de cyclopamine, de la mort cellulaire dans différentes zones de la coupe du cerveau. Ceci indique l’intérêt de la prodrogue 1b pour cibler l’action de la cyclopamine au niveau de la zone de nécrose des GBM, tout en épargnant le tissu cérébral en général et en particulier, les cellules souches cérébrales saines.

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

Evaluation of cytotoxic properties of a cyclopamine

glucuronide prodrug in rat glioblastoma cells, astrocytes and

brain tissue

Souheyla BENSALMA1, 2, Corinne CHADENEAU1,2, Thibaut LEGIGAN2, Brigitte RENOUX2, Caroline PINET-CHARVET2, Sébastien PAPOT2 and Jean Marc MULLER1,2*.

1_{« Récepteurs, régulations et cellules tumorales » 2RCT group, Université de Poitiers, 1 Rue} Georges Bonnet, 86022 Poitiers, France.

2_{CNRS FRE 3511, Université de Poitiers, 1 Rue Georges Bonnet, 86022 Poitiers, France.} 2_{Institut de Chimie des Milieux et des Matériaux, IC2MP, Université de Poitiers, UMR-}

CNRS 7285, 4 Rue Michel Brunet, 86022 Poitiers, France.

souheyla.bensalma@univ-poitiers.fr; corinne.chadeneau@univ-poitiers.fr;

thibaut.legigan@univ-poitiers.fr; brigitte.renoux@univ-poitiers.fr; caroline.charvet@univ- poitiers.fr; sebastien.papot@univ-poitiers.fr

*To whom correspondence should be addressed, jean.marc.muller@univ-poitiers.fr

Conflicts of interest: no actual or potential conflicts of interest in relation to this article exist.

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

79 Abstract:

Glioblastoma multiforme (GBM) is the most common and aggressive primary brain tumor. Activation of the developmental Hedgehog (Hh) pathway is observed in GBM, particularly in the so-called glioma stem cells (GSCs). An inhibitor of this pathway is the steroidal alkaloid cyclopamine, an antagonist of the Hh co-receptor Smoothened (SMO). To limit the toxicity of cyclopamine towards Hh-dependent non tumor cells, our group previously reported the synthesis of a prodrug (called 1b), designed to deliver cyclopamine in the presence of β- glucuronidase, an enzyme found in the necrotic area of GBM. Here we aimed to compare the in vitro cytotoxic properties of this prodrug in the C6 rat GBM cells, in non-tumor astrocytes and in rat brain tissue explants. In the presence of β-glucuronidase, the prodrug 1b was toxic and down-regulated expression of Gli1, an Hh target gene, in C6 cells and C6-GSCs. The activated prodrug did not affect viability of normal rat astrocytes. In the absence of β- glucuronidase, the prodrug 1b displayed no obvious toxicity towards brain tissue explants. The prodrug 1b thus appears as a good candidate for future in vivo investigations using C6 cells that generate GBM with a necrotic area when injected into the rat brain.

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

80 1. Introduction

Gliomas are the most frequent primary tumors arising in the brain. The glioblastoma multiforme (GBM) is the most malignant form of glioma with a median patient survival time of 14.6 months (Stupp et al, 2005). Recent advances in neural stem cells research indicate that brain tumors contain a subpopulation of cancer stem cells (CSCs), also called brain tumor-initiating cells or stem cell-like cancer cells which contribute to radiation and chemotherapy resistance. These CSCs are neurosphere-forming precursor cells that expressed neuronal and astroglial markers upon differentiation (Piccirillo et al, 2009). A number of signaling mechanisms involved in the maintenance of brain CSC phenotypes have been reported (Candace et al, 2009). Among them, the hedgehog (Hh) cascade is one of the key regulatory pathways critical for the maintenance of several types of adult stem cells, including neural stem cells (Ruiz i Altaba et al, 2007). Hh signal transduction is initiated by the binding of the processed and lipid-modified Hh protein to its receptor Patched (Ptc1), a 12-pass transmembrane glycoprotein. In the absence of the Hh ligand, Ptc1 represses the activity of the seven-pass transmembrane glycoprotein Smoothened (Smo), a member of the G-protein- coupled receptor (GPCR) superfamily. Upon Hh binding, the inhibitory function of Ptch1 on Smo is abolished, resulting in Smo activation. The ultimate step in the pathway is mediated by the zinc finger transcription factors Gli, where Gli1 and Gli2 represent the main activators of Hh target genes and Gli3 acts mostly as a repressor. When activated, Gli1and Gli2 increase transcription of the direct target gene Gli1 itself. The mechanisms of signal transduction from Smo to Gli proteins are not completely elucidated. However, in numerous cell types, a key component of the Hh pathway at the subcellular level is the primary cilium, where several components of this cascade (Smo, Gli) have been co-localized (Tasouri and Tucker, 2011;Wilson and Chuang, 2010).

Aberrant Hh signaling has been linked to different cancer types such as basal cell carcinoma, medulloblastoma and rhabdomyosarcoma (Ng and Curran, 2011). Active Hh signaling is also associated with glioma (Shahi et al, 2008), where Gli was first discovered (Kinzler et al, 1987). A number of Hh signaling antagonists have been characterized. These compounds include cyclopamine, a plant-derived steroidal alkaloid first identified as a potent teratogen in sheep (Incardona et al, 1998). This molecule is thought to act by direct binding to Smo thereby inhibiting downstream canonical signaling (Chen et al, 2002). Several studies

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

showed that the Hh pathway regulates glioma growth, glioma stem cell (GSC) self-renewal and GSC tumorigenic capacity. The blockade of Hh signaling by treatment with cyclopamine or RNA interference of Gli depletes GSCs (Bar et al, 2007). Importantly, cyclopamine enhances the efﬁcacy of temozolomide (TMZ) to inhibit GSC proliferation and to induce cell death, and also improves the effect of radiations on GSCs (Clement et al, 2007). However the potential therapeutic interest of cyclopamine is limited by its toxicity which could also be directed against normal stem cells and brain tissues displaying an activated Hh pathway.

Recently, a wide spectrum of non-toxic drug carriers has been studied with the aim to increase drug deposition in tumors, while avoiding accumulation of cytotoxic agents in healthy tissues (Kratz et al, 2008). In this context, numerous glucuronide prodrugs (Grinda et al, 2011 and 2012; Thomas et al, 2008; Tietze et al, 2011) that can be activated by β- glucuronidase present in the tumor microenvironment (Bosslet et al, 1995; Connors et al, 1966) have been investigated to enhance the selectivity of cancer chemotherapy. The β- glucuronidase is a lysosomal enzyme released mainly by the immune and inflammatory cells of the necrotic area (Bosslet et al, 1998). The validity of this targeting strategy was demonstrated in vivo with several β-glucuronidase-responsive prodrugs that showed superior antitumor efficacy associated with reduced toxicity compared to standard treatments (Bosslet et al, 1998; Houba et al, 1998 and 2001; Juan et al, 2009; Legigan et al, 2012; Woessner et al, 2000). This provides a rationale to develop glucuronide prodrugs designed for the selective delivery of cyclopamine in the microenvironment of GBM tumors where high level of β- glucuronidase has been detected (Nygren et al, 1997). Within this framework, our group synthesized the two cyclopamine glucuronide prodrugs 1a (Hamon et al, 2010) and 1b (Renoux et al, 2011). These compounds include a glucuronide trigger, a self-immolative linker and the drug. In the presence of β-glucuronidase, a glycosidic bond is hydrolyzed rapidly to generate the corresponding phenol intermediate which decomposes spontaneously to release the free cyclopamine (Papot et al, 2002, Tranoy-Opalinski et al, 2008). Viability tests on U87 human GBM cells indicated that derivatization of cyclopamine in the form of the prodrugs 1a or 1b resulted in non-toxic compounds. On the other hand, as expected, incubation of the prodrugs with the activating enzyme restores antiproliferative activity of cyclopamine towards U87 cells. It is worth mentioning that the prodrug 1b was more soluble than 1a due to the presence of a glycosylated poly (ethylene glycol) side chain on the self-

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

immolative linker, which is of potential interest for future in vivo assays. The aim of the present study was to further define the ability of the cyclopamine prodrug 1b to efficiently target the Hh pathway, particularly in glioblastoma CSCs and to analyze its cytotoxic properties in rat C6 GBM cells, normal astrocytes and brain tissue explants. The C6 GBM cell line was chosen in the present studies, since it has been previously determined that (i) it spontaneously presents a large population of CSCs (Kondo et al, 2004), (ii) it leads to GBM with a necrotic area after injection in rat brain (Morrone et al, 2004). These properties make this cell line very suitable for further in vivo evaluation of prodrug 1b properties.

2. Methods

C6 glioblastoma cell culture

The rat C6 glioma cell line (Benda et al, 1968) was purchased from the European Collection of Animal Cell Culture (ECACC) (Salisbury, UK). In standard monolayer conditions, these cells were cultured in high glucose (4.5g/l) Dulbecco’s modified eagle’s medium (DMEM) (Lonza) with GlutamaxTM I, and supplemented with 10 % fetal bovine serum (Lonza), 100 U/ml penicillin and 100 µg/ml streptomycin (Lonza). Cells were incubated in humidified 95% air, 5% CO2 at 37°C. Medium was changed twice a week, and cells were subcultured once a week using trypsin-EDTA solution (Lonza).

In tumorsphere conditions, C6 cells in the exponential growth phase were collected and cultured in serum-free neural stem cell medium containing DMEM/F12 (Gibco), B27 supplement (Gibco), recombinant human epidermal growth factor (EGF, 20 ng/ml; Invitrogen) and basic fibroblast growth factor (bFGF, 20 ng/ml; Invitrogen). Cells were incubated at 37°C in humidified 95% air, 5% CO2. Tumorspheres (C6-GSCs) reaching approximately 100-200 cells/sphere were used in all experiments.

Primary rat astrocytes-enriched culture (NRA)

Primary cortical astrocytes were isolated from brains of newborn rats at P2 or P3 as previously reported, with minor modiﬁcations (McCarthy and de Vellis, 1980). Brieﬂy, newborn rats were euthanized, and the cortices were dissected out. Then, the tissues were dissociated mechanically using a sterile pipette in DMEM medium (Lonza) containing 10 % fetal bovine serum. The mixed glial cells were plated onto 100-cm culture plates and

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

incubated at 37°C in humidified 95% air and 5% CO2. The culture medium was changed every 2–3 days. The cells were subcultured twice to achieve a homogeneous monolayer of astrocytes.

Organotypic brain slice culture

Organotypic brain slices were prepared from adult Wistar rats. After anesthesia and euthanasia, the brain was rapidly removed and immersed in ice-cold Hanks’ balanced salt solution (HBSS) with 10 mM HEPES. The cerebrum was cut vertically to the base into 400 µm–thick slices with a vibratome (Leica VT1200S; Leica Microsystems). Two brain slices then were laid down on a Millicell-CM membrane insert (Millipore) and the insert was placed in individual wells of six-well plates. Medium (1ml) was added to the bottom of culture plate. Slices were cultured in the same culture medium as C6 cells at 37C° in a 5% CO2 incubator. After 24 hours, the culture medium was changed and the slices were treated with 10µM of cyclopamine or the prodrug 1b  β-glucuronidase. After 5 days of treatment, the slices were incubated for 20 min with Calcein-AM (Sigma, 4µg/ml) which stains live cells (green fluorescence) and with propidium iodide (Sigma, 5µg/ml) which stains the nucleus of dead cells (red fluorescence). Stained slices were then imaged on an inverted fluorescence confocal microscope using a rhodamine filter set (488 nm/515 nm).

Cell viability assay

Cell viability was evaluated using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega). C6 cells, C6-GSCs, NRA or NHA cells were seeded onto 96- well plates and maintained for 24h in complete medium. Next the cells were incubated with increasing concentrations of cyclopamine or the prodrug 1b in the absence or presence of β-glucuronidase (5 U/ml, Sigma) for 5 days. An equal volume of DMSO (used for prodrug or cyclopamine solubilization) was added to the control cells. Each condition was performed in six replicate wells. Cell numbers were determined by adding 20 µl of CellTiter 96 AQueous One Solution Reagent into each well 3 h before measuring the optical densities (OD). Metabolically active, viable cells convert MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) into a colored formazan product that was measured using a spectrophotometric microplate reader (Mithras, Berthold) at 490 nm. The OD of control samples was considered as the 100 value.

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

84 Clonogenic survival assay

Clonogenic survival assay was used to determine the sensitivity of cells to cyclopamine as described previously (Franken et al, 2006). C6 cells were seeded into 6-well plates (50 cells/wells). After 24 h of incubation, medium was replaced by medium containing the prodrug 1b±β-glucuronidase (5 U/mL) or cyclopamine. Control cells were incubated in the presence of DMSO±β-glucuronidase. After 24, 48 or 72 hours of treatment, medium was replaced with fresh medium without treatment and the cells were maintained for an additional 8 days. Colonies were fixed with 70% ethanol and counterstained with 0.1% crystal violet. Colonies containing more than 50 cells were scored as surviving clonogens. Surviving fraction (SF) was determined as the number of colonies formed by treated cells divided by the number of those formed in control cells ×100.

Measurement of caspase-3/7 activity

C6 cells or C6-GSCs were seeded at 7000 cells per well in 96-well black plates overnight and incubated with DMSO, 10μM cyclopamine, or 10 μM prodrug 1b in the absence or presence of β-glucuronidase for 72 hours. Levels of caspase-3/7 activity were determined using the ApoONE Homogeneous Caspase 3/7Assay kit (Promega) following the manufacturer’s instructions. The intensity of the emitted fluorescence was determined using a spectrophotometric microplate reader (Mithras, Berthold) at 521 nm.

cDNA synthesis

Total RNA was isolated by using the GenElute Mammalian Total RNA kit (Sigma- Aldrich) following the manufacturer's instructions. Total RNA was quantified with a GeneQuant II spectrophotometer (Pharmacia). Total RNA was treated with DNase I Amplification Grade (1 U/µg RNA) (Invitrogen) according to the manufacturer's recommendations, and in the presence of RNaseOUT (10 U/µg RNA) (Invitrogen). After DNase inactivation, RNA was reverse transcribed using random primers (Promega) and M- MLV Reverse Transcriptase H Minus (Promega) according to the manufacturer's instruction.

Polymerase chain reaction

The forward and reverse primers used in the PCR reactions were designed with Primer3 software (http://frodo.wi.mit.edu/), except for the rat Gli1 (rGli1) (Lelievre et al, 2006), and

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

were as followes: rGli1: forward, CAGGAACTTCCATATCAGAG, reverse, AAAGCCAGATCCAAACGTAG and GAPDH forward, GGTCTACATGTTCCAGTATGA, reverse, GTTGATGACCAGCTTCCCATT. Expression of Gapdh mRNA was used as an internal control. The cycle program for the amplified cDNA was: 1 cycle at 95°C for 2 min, 35 cycles (or 25 cycles for GAPDH) at 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, and one cycle at 72°C for 2 min. PCR products were resolved and visualized on a 3% agarose gel containing SYBR Green (Invitrogen).

Real-time RT-PCR and quantification

Real-time RT-PCR was carried out with the LightCycler System (Roche Molecular Biochemicals) by using the SYBR® Premix Ex TaqTM (Perfect Real Time) kit (Takara) according to the manufacturer’s instructions, except that reaction volume was 10 µl. The cDNA amplification program was 10 s at 95°C to activate ExTaqTMpolymerase followed by at least 45 cycles of 5 s at 95 °C, 5 s at 60 °C and 10 s at 72 °C. Each sample was analyzed in triplicate and the level of Gapdh mRNA was used to normalize mRNA levels between samples. The quantification was performed using the method described by Pfaffl et al. (Pfaffl et al, 2001).

Immunocytochemistry

Cells were fixed in 4% paraformaldehyde (Sigma) for 30 min at room temperature. They were washed thrice with phosphate-buffered saline (PBS) and incubated for 1 to 2 hours in blocking buffer which contains 3% BSA and 0.3% Triton x100. The cells were stained with the following primary antibodies in blocking buffer at 4°C overnight: goat anti-Smo (1:50, N19 Santa Cruz Biotechnology), mouse anti-acetylated α-tubulin (1:1000, Sigma), mouse anti-Nestin (1:100, Millipore Mab353), goat anti-Sox2(1:100, Y-17 Santa Cruz Biotechnology), rabbit anti-Glial fibrillary protein (anti-GFAP) (1:1000, Dako) or mouse anti- β-tubulin III (1:100, Sigma). After three washes with PBS, the cells were incubated with the following secondary antibodies (1:250, Invitrogen): donkey anti-goat Alexa Fluor (AF) 555, goat anti-mouse AF 488, goat anti-rabbit AF 488 or donkey anti-mouse AF 647. The cells were washed as before and mounted in Vectashield containing 4’6’ diamidino-2-phenylindole (DAPI) (Sigma). Samples were examined by confocal laser scanning microscopy using a confocal FV-1000 station installed on an inverted microscope IX-81(Olympus, Tokyo,

Chapitre IV. Présentation des travaux Article 1 : La prodrogue glucuronylée de la cyclopamine dans des cellules de GBM

Japan). Images were obtained with an Olympus planApo x60 oil, 1.40 NA, objective lens and zoom x2 (800x800 pixels, 0.13 µm/pixel). Multiple fluorescence signals were acquired sequentially to avoid cross-talk between image channels. Samples were excited with 405nm diode (for DAPI), 488nm line of an argon laser (for AF488), 543nm line of an HeNe laser (for AF555), 633nm line of an HeNe laser (for AF647). The emitted fluorescence were detected

Dans le document Voie Hedgehog et système VIP-récepteurs dans des cellules de glioblastome (Page 113-174)