Advance Access publication March 28, 2008
Renal Anemia Induced by Chronic Ingestion of Depleted Uranium in Rats
Hanaaˆ Berradi,* Jean-Marc Bertho,* Nicolas Dudoignon,* Andre´ Mazur,† Line Grandcolas,* Ce´dric Baudelin,*
Ste´phane Grison,* Philippe Voisin,* Patrick Gourmelon,* and Isabelle Dublineau*
,1*Institut de Radioprotection et de Suˆrete´ Nucle´aire, Direction de la RadioProtection de l’Homme, Service de Radiobiologie et d’Epide´miologie, F-92262 Fontenay-aux-Roses Cedex, France; and †Unite´ des Maladies Me´taboliques et Micronutriments, Institut National de la Recherche Agronomique, Centre de
Clermont-Ferrand/Theix, F63122 Saint-Genes Champanelle, France
Received December 5, 2007; accepted March 2, 2008
Kidney disease is a frequent consequence of heavy metal
exposure and renal anemia occurs secondarily to the progression
of kidney deterioration into chronic disease. In contrast, little is
known about effects on kidney of chronic exposure to low levels of
depleted uranium (DU). Study was performed with rats exposed
to DU at 40 mg/l by chronic ingestion during 9 months. In the
present work, a
~20% reduction in red blood cell (RBC) count was
observed after DU exposure. Hence, three hypotheses were tested
to determinate origin of RBC loss: (1) reduced erythropoiesis,
(2) increased RBC degradation, and/or (3) kidney dysfunction.
Erythropoiesis was not reduced after exposure to DU as revealed
by erythroid progenitors, blood Flt3 ligand and erythropoietin
(EPO) blood and kidney levels. Concerning messenger RNA
(mRNA) and protein levels of spleen iron recycling markers from
RBC degradation (DMT1 [divalent metal transporter 1], iron
regulated protein 1, HO1, HO2 [heme oxygenase 1 and 2], cluster
of differentiation 36), increase in HO2 and DMT1 mRNA level
was induced after chronic exposure to DU. Kidneys of
DU-contaminated rats had more frequently high grade
tubulo-interstitial and glomerular lesions, accumulated iron more
frequently and presented more apoptotic cells. In addition,
chronic exposure to DU induced increased gene expression of
ceruloplasmin (312), of DMT1 (32.5), and decreased mRNA
levels of erythropoietin receptor (30.2). Increased mRNA level of
DMT1 was associated to decreased protein level (30.25). To
conclude, a chronic ingestion of DU leads mainly to kidney
deterioration that is probably responsible for RBC count decrease
in rats. Spleen erythropoiesis and molecules involved in
erythro-cyte degradation were also modified by chronic DU exposure.
Key Words: metal; iron homeostasis; chronic; ingestion; kidney;
depleted uranium.
The properties of kidney to reabsorb and accumulate
divalent metals make these tissues the first target of heavy
metal intoxication. For instance, acute exposure to chromium
leads to tubular necrosis, and tubular proteinuria observed in
workers suggests that chronic chromium exposure might also
induce tubular lesions (Wedeen and Qian, 1991). In a clinical
study, chronic exposure to dietary cadmium (Cd) was
associated with chronic end-stage renal failure (Satarug and
Moore, 2004). Experimentally, it has been shown that chronic
contamination to low levels of Cd induces tubular damages in
rat (Brzoska
et al., 2003). Lead is well known to induce, among
others, renal insufficiency (Patrick, 2006).
Kidney is also particularly sensitive to uranium, a radioactive
heavy metal. In 1909, it was shown histologically for the first
time that acute uranium exposure induced nephrotoxicity
(Dickson, 1909). Because then, several authors evidenced the
consequences of acute exposure to high uranium concentrations
on kidney at histological, cellular, and molecular levels
(Bencosme
et al., 1960; Goldman et al., 2006). However,
though the effects of acute uranium exposure on kidney are well
documented, the renal response to chronic contamination with
small depleted uranium (DU) doses remains unknown.
Nowadays the biological effects of chronic exposure to DU
are becoming an increasing concern. Extensive civil and
military applications using DU lead to increased environmental
contamination which means it is important to address the
consequences of its ingestion via the food chain and/or drinking
water on human health (Abu-Qare and Abou-Donia, 2002).
There is accumulating evidence that shows effects of chronic
exposure to small doses of DU on the central nervous system
(Lestaevel
et al., 2005), liver (Gilman et al., 1998; Pellmar
et al., 1999a, b; Souidi et al., 2005; Tissandie et al., 2007),
intestine (Dublineau
et al., 2007), lung (Souidi et al., 2005), and
kidney (Donnadieu-Claraz
et al., 2007; Taulan et al., 2004). In
light of the previous data concerning kidney and acute uranium
exposure, investigations about the effects of daily DU exposure
on kidney are of public health interest. As it is broadly accepted
that renal deterioration may lead to the progression of chronic
kidney disease responsible for anemia, it could be hypothesized
that chronic long-term ingestion of DU may result in
progressive kidney deterioration, which would induce
hemato-logical changes. To test this hypothesis, rats were subjected to
9-month contamination with 40 mg DU/l in their drinking
water. Their blood cell count was then examined. A decrease
1
To whom correspondence should be addressed at Institut de Radioprotection et de Suˆrete´ Nucle´aire, Direction de la RadioProtection de l’Homme, Service de Radiobiologie et d’Epide´miologie, Laboratoire de Radiotoxicologie Expe´rimentale, IRSN, B. P. n17, F 92262 Fontenay-aux-Roses Cedex, France. Fax:þ33-1-58-35-84-67. E-mail: isabelle.dublineau@irsn.fr.
The Author 2008. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org.
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org.
was observed in their red blood cell (RBC) content. To explain
this reduction, three hypotheses were tested: reduced
erythro-poiesis, elevated RBC degradation and renal deterioration. The
present study demonstrates that the diminution of RBC number
induced by chronic exposure to DU was mainly due to renal
deterioration. In spleen, erythropoiesis was slightly increased,
as well as iron recycling (via increased messenger RNA
[mRNA] levels of DMT1 [divalent metal transporter 1]).
MATERIALS AND METHODS
Animals. Sprague–Dawley male rats (Charles River, France) weighed 250 g at the beginning of the experiment. The rats were housed in pairs, with a 12-h light/12-h dark cycle (light on: 08:00 h/20:00 h) and a temperature of 22± 1C. Animals were given ad libitum standard diet (Safe, R04 chow, France). Drinking mineral water was also delivered ad libitum. All experimental procedures were approved by the Animal Care Committee of the Institute of Radiation protection and Nuclear Safety and complied with French regulations for animal experimentation (Ministry of Agriculture Act No. 87-848, October 19, 1987, modified 29 May 2001).
DU exposure. Rats (3 months old) were divided into two groups: an experimental group exposed to DU (DU-contaminated rats) in their drinking mineral water for 9 months and a second group of control rats that received the same drinking mineral water without DU. The mineral water used for DU exposure has the following composition (in mg/l): Ca2þ, 78; Mg2þ, 24; Naþ, 5; Kþ, 1; SO42, 10; HCO3, 357; Cl, 4,5. The DU concentration in water was 40
mg/l (specific activity, 25.103 Bq/g; 238U, 99.28%; 235U, 0.72%; 234U, 0.0056%; Merck, Strasbourg, France). The DU dose chosen in the present study was twice the highest environmental concentrations found in Finland (20 mg/l; Juntunen, 1991). In rat, this concentration corresponded to a daily ingestion of 1 mg per animal. DU-contaminated and control rats were raised in the same conditions with weekly measurement of their body weight, food, and water intake during the whole experiment.
Plasma and organ sampling. Rats were anesthetized by inhalation (TEM anesthesia, Angers, France) of 95% air/5% isoflurane (Fore`ne, Abbott, Rungis, France) and killed by intracardiac puncture with a 10-ml syringe to collect blood. Spleen and kidney were then excised, weighed, quickly frozen in liquid nitrogen and stored at80C. One third of the spleen and one femur were placed in washing medium composed of RPMI (Roswell Park Memorial Institute) 1640 medium supplemented with penicillin, streptocin, and 1% fetal calf serum (all from Invitrogen, le Pont de Claix, France) until they were processed for cell culture.
Blood analysis. A complete blood cell count was carried out immediately after blood collection on an automated cell counter, MS9 (Melet Schloesing Laboratoires, Osny, France). Blood was centrifuged at 4000 3 g at 4C for 10 min to collect serum or plasma. Serum and plasma were aliquoted and stored at80C. The serum unsaturated iron binding capacity (UIBC) of control and DU-contaminated rats was estimated colorimetrically at 600 nm using a colorimetric kit (UIBC-Test or Fer-CTF, Biolabo, Maizy, France) according to the manufacturer’s instructions. The total iron binding capacity (TIBC) was then calculated as the sum of the UIBC and serum iron concentration.
Plasma concentrations of Flt3 ligand (Flt3l) and erythropoietin (EPO) were measured by a sandwich enzyme-linked immunosorbent assays according to the manufacturer’s recommendation (R&D Systems, Abington, UK). The sensitivity of the assays was 5 pg/ml for Flt3 ligand and 12.5 pg/ml for EPO. Plasma urea and creatinine of DU-contaminated and control rats were measured using kit reagents and automated Konelab 20 apparatus (Thermo Electron Corporation, Courtaboeuf, France).
Colony-forming cell assays. Spleen was crushed into a tissue grinder and femurs were flushed using a 10-ml syringe mounted with a 19-G needle with
washing medium. Cell suspensions were centrifuged 10 min at 400 3 g. Cells were counted in the presence of 1:10 dilution of trypan blue dye. This allowed the determination of cell viability by trypan blue exclusion. Spleen and bone marrow cells were then plated at 5 3 105and 5 3 104cells, respectively, in 1.1
ml of complete methyl cellulose medium with recombinant cytokines (Stem Cell Technologies, Vancouver, Canada). Cultures were incubated at 37C in 95% air/5% CO2 in a humidified atmosphere. Colony-forming units–
granulocyte macrophage (CFU-GM), burst-forming units–erythroid (BFU-E), and CFU-granulocyte erythrocyte monocyte megakaryocytes were scored when composed of more than 50 white cells and/or red cells onto an inverted microscope on day 12 of culture.
Gene expression analysis. Total RNA from spleen and kidney of both control and DU-contaminated rats were extracted with the RNeasy total RNA isolation Kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions. Firstly, a lysis buffer containing 1% beta-mercaptoethanol was added to tissues that were then crushed using ribolyser (Hybaid, Thermo-scientific, Courtaboeuf, France). After a 3-min centrifugation at 11,000 3 g, the tissue lysates were homogenized with 70% ethanol and distributed on RNeasy column with silica resin. Different steps of elution and centrifugation were then applied. ARN was finally eluted with 40 ll of RNAse free water. The RNA quality was assessed by electrophoresis on ethidium bromide-stained agarose gel and by A260/A280 nm absorption ratio. One microgram of total RNA was reverse transcribed in complimentary DNA (cDNA) using BD Sprint PowerScript PrePrimed 96 Plate (BD Biosciences Clontech, Erembodegem, Belgium).
The following genes were studied: DMT1, Ireg1 (iron regulated protein 1), HO1, HO2 (heme oxygenase 1 and 2), CD36 (cluster of differentiation 36), EPO, erythropoietin receptor (EPOR), CP (ceruloplasmin), and the housekeep-ing gene hypoxanthine–guanine phosphoribosyltransferase (HPRT). The sequences for the forward and reverse primers used in the present study are listed in Table 1. Except for Ireg1 primers which were chosen from literature (Collins et al., 2005), primers were designed using PrimerTool (http:// biotools.umassmed.edu/bioapps/primer3_www.cgi, funded by Howard Hughes Medical Institute and by the National Institutes of Health, National Human Genome Research Institute). Experiments were performed with the ABI prism 7000 apparatus (Applied Biosystems, Courtaboeuf, France). Relative mRNA levels were quantified using the comparative DDCT method. The relative
quantification of the target, normalized to an endogenous reference (HPRT) and a relevant uncontaminated control, equals2DDCT, with DDC
Tdefined as the
difference between the mean DCT (contaminated sample)and mean DCT (control sample)and DCTas the difference between meanCT (interest gene)andCT (HPRT)as
the endogenous control. Each sample was monitored for fluorescent dyes, and signals were regarded as significant if the fluorescence intensity significantly exceeded (10-fold) the standard deviation of the baseline fluorescence, defined as threshold cycles (CT). The data were thus expressed as the ratio of each
specific gene expression to HPRT used as housekeeping gene.
Protein analysis. The following proteins were studied: DMT1, HO1, HO2, CD36, and the housekeeping protein glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Tissues extracted (~30 mg) from spleen of control and DU-contaminated rats were homogenized in a cold cell lysis buffer (radio immunoprecipitation assay buffer) containing protease-inhibitor cocktail (Sigma Aldrich, St-Quentin-Fallavier, France). After 20 min of incubation on ice, samples were centrifuged at 12,500x g at 4C. Supernatants were aliquoted and stored at 80C. Protein concentrations were determined using the Bio-Rad protein assay kit (Bio-Rad, Marnes-la-Coquette, France).
Tissue lysates (50 lg) were subjected to electrophoresis and Western blotted using anti-rat DMT1 polyclonal rabbit antibody (Interchim, Montlucxon, France),
polyclonal goat anti-rat HO1, polyclonal goat anti-human HO2, polyclonal goat anti-human CD36 (Tebu-bio, Le Perray-en-Yvelines, France) and anti-human GAPDH rabbit polyclonal antibodies (Tebu-bio) used as the internal reference antibody. Chemiluminescence was detected according to manufacturer’s protocol (ECL, Millipore, Saint-Quentin-en-Yvelynes, France). Band densities were quantified using the LAS3000 apparatus (Fujifilm, Raytest, Courbevoie, France) and normalized to the total amount of control protein (GAPDH).
Determination of iron level in rat kidney. Quantification of iron concentration was performed in kidneys of both control and DU-contaminated rats. This assay was based on a methodology kindly communicated by Dr Schumacher (Moket al., 2004). Tissue samples were digested in 3N HCl with 10% trichloroacetic acid at 65C overnight. Colorimetric iron determination of supernatants was performed using the Direct Method reagents (Biolabo) according to the manufacturer’s instructions.
Histological analyses. Renal segments were fixed in a 4% formaldehyde solution (Carlo Erba, Rueil Malmaison, France) at room temperature. Kidney samples were then dehydrated, embedded in paraffin, and cut in 5-lm-thick sections. A hematoxylin–eosin–saffron (HES) staining of paraffined slides was then performed.
The histological analysis was performed in a single-blind manner by a histopathologist (Dr Dudoignon). Glomerular lesions were semiquantitatively scored as none (0þ), mild (1þ), moderate (2þ), or severe (3þ). Tubulo-interstitial lesions were scored on the basis of tubular atrophy, dilation, hyaline casts and interstitial fibrosis as follows: 0¼ no lesion; 1 ¼ very minor dilation; 2 ¼ larger presence of dilated tubules; 3¼ marked tubular dilation and interstitial fibrosis. The proliferative cells in the renal section were estimated following the immunohistochemical staining of Ki67, antigen present on a 36-kDa nuclear protein (dilution¼ 1/100, Dako, Trappes, France).
Cell apoptosis in the kidney was analyzed using immunohistochemical staining (in situ cell death detection kit with the TUNEL [terminal deoxynucleo-tidyl transferase–mediated deoxyuridine triphosphate nick end labeling] technique, Roche Diagnostics, Meylan, France) following the manufacturer’s instructions. The number of apoptotic cells was estimated in the whole section.
Iron deposition was detected using Prussian blue staining according to the manufacturer’s recommendations (Accustain, Sigma). Iron deposition was classified as follows: small deposits (point staining), intermediate iron deposits (splash staining), and clustered iron deposits (aggregate staining) (see Fig. 4). The extension of each class of iron deposition was estimated semiquantitatively using the following scales: 0¼ none, 1 ¼ mild; 2 ¼ moderate; 3 ¼ marked.
Statistical analysis. The results are expressed as mean ± SEM for seven animals unless otherwise indicated. Comparisons between groups were performed using Student’st-test for nonpaired data or the nonparametric Mann–Whitney test (SigmaStat3.0, Systat software). The text of this report comments on signifi-cant differences (p 0.05) or strong trends (p 0.10) when appropriated within control and DU-contaminated groups, with relevantp values quoted.
Results
Changes in General Hematological Parameters
The blood cell count and global iron status (serum iron
content and iron binding capacity) were measured in both
control and DU-contaminated rats (Table 2). The RBC amount
was decreased by about 20% in DU-contaminated animals as
compared with control rats (p < 0.05). This reduction was
associated with a similar 20% diminution of hematocrit (p
¼
0.051) and hemoglobin levels (p
¼ 0.056). Other
hematolog-ical parameters (leucocytes, mean corpuscular volume and
platelets) were similar between the two groups (data not
shown). Iron concentration and iron total and unsaturated
binding capacities were not modified statistically by DU
contamination.
DU Effects on Hematopoiesis
The origin of RBC changes was first investigated within the
hematopoietic system: a decrease in erythropoiesis may lead to
a reduced RBC count. Hematopoietic activity was compared
between control and DU groups using CFC assays in both
spleen and bone marrow as well as blood cytokine
measure-ments. The chronic ingestion of DU increased the frequency of
CFU-GM and BFU-E from spleen whereas it did not affect
bone marrow progenitors (Fig. 1a). BFU-GM progenitors were
increased by 2.7-fold and BFU-E by 1.5-fold in spleen after
TABLE 2
DU Effects on Hematological Parameters
Control (n¼ 7) DU (n¼ 8) p Complete blood count
RBC (1012/l) 10.2± 0.5 8.3± 0.7 0.048* Hemoglobin (g/l) 15.8± 1.8 12.8± 2.5 0.056 Hematocrit (%) 55.9± 3.1 45.5± 3.7 0.051 Leucocytes (109/l) 5.1± 0.9 5.2± 1.0 ns Iron and binding capacity
Iron concentration (lmol/l) 48.9± 7.4 39.5± 5.6 ns UIBC (lmol/l) 90.2± 19.1 81.8± 8.6 ns
TIBC (lmol/l) 139± 15 121± 13 ns
Note. Statistical analyses were performed using Student t-test. *p < 0.05 significantly different from control group. A significant decrease was observed in RBC number. Hemoglobin and hematocrit also tended to diminish after chronic DU ingestion. ns, not significant.
TABLE 1
Primers Sequences Used for Quantitative Real-Time PCR
Primer name Accession number Forward sequence Reverse sequence
Iron flux DMT1a gi:2327066
5#GATTCCAGACGATGGTGCTT3# 5#GTGAAGGCCCAGAGTTTACG3# Ireg1 gi:18846873 5#GTGGATAAGAATGCCAGACT3# 5#CGCAGAGAATGACTGATACA3# Heme degradation HO1 gi:60551392 5#ACACCAGCCACACAGCACTA3# 5#GAAGGCGGTCTTAGCCTCTT3#
HO2 gi:38304017 5#GGGAAGGGACCCAGTTCTAC3# 5#TCCCAGGGTACCTTTGTCTG3# Adhesion receptor CD36 gi:48675378 5#TCGTATGGTGTGCTGGACAT3# 5#CGATGGTCCCAGTCTCATTT3# Superoxide scavenger CP gi:499668 5#ATGTGATGGCTATGGGCAATG3# 5#TTCCCCTGTGCTTGTATTGGA3# Erythropoiesis EPO gi:8393315 5#AATTGATGTCGCCTCCAGAC3# 5#GTGACACAGTGACGGTGAGC3# EPOR gi:59709454 5#TGAGTGTGTCCTGAGCAACC3# 5#CCAGCACAGTCAGCAACAGT3#
aDMT1 primers can amplify both iron responsive element and non-iron responsive element forms of DMT1 cDNA.
DU exposure. Hematopoietic activity was also assessed by
measuring two markers, Flt3 ligand and EPO (Fig. 1b).
Chronic exposure to DU did not induce changes in blood
concentrations of the studied cytokines. Reduced
erythropoi-esis may also be reflected by changes in EPO which mRNA
levels are informative of EPO synthesis. After 9-month DU
exposure, EPO mRNA relative levels remained unchanged
(Fig. 1c). These results indicated that DU contamination did
not induce significant changes in general hematopoiesis and
erythropoiesis.
Alterations in Spleen Iron Recycling
RBC reduction could also be a consequence of an increased
rate of erythrocyte degradation that increases iron recycling
from heme degradation. The modifications in iron recycling
from RBC degradation were thus estimated in the spleen by
measuring the expression levels of proteins involved in iron
flux (DMT1, Ireg1), heme degradation (HO1 and HO2) and
RBC adhesion (CD36) (Fig. 2). Chronic exposure to DU
enhanced the expression of iron transport. DMT1 mRNA levels
were increased by threefold (p
¼ 0.05), meanwhile the twofold
augmentation in the Ireg1 gene expression was not significant
(Fig. 2a). DU exposure affected also heme degradation through
an increase in mRNA levels of HO2 (threefold,
p
¼ 0.034)
whereas HO1 gene expression was not affected. Expression of
the RBC adhesion receptor CD36 remained unchanged with
chronic DU ingestion. The relative protein levels of DMT1,
FIG. 1. DU effects on rat hematopoiesis. (a) Effect of DU contamination on BFU-E and CFU-GM from rat spleen and bone marrow cells. Results are expressed as mean± SEM of progenitor frequency per 105mononuclear cell
(n¼ 5 animals per group, *p < 0.05, ***p < 0.001). (b) Blood concentrations of hematopoiesis markers, that is, Flt3 ligand (Flt3l) and EPO. Data are expressed as mean± SEM (n¼ 7 for each group). C ¼ control group. (c) Kidney mRNA encoding for EPO analyzed by real-time RT-PCR. The kidney target mRNA levels were normalized to the housekeeping HPRT mRNA and are shown as a ratio to control animals. Results are expressed as mean± SEM (n¼ 7 for each group, *p < 0.05).
FIG. 2. Changes in expression of splenic iron recycling markers. (a) Spleen relative mRNA levels of genes involved in iron recycling from red cell degradation. Relative mRNA levels of iron recycling associated molecules, that is, iron flux (DMT1, Ireg1), heme degradation (HO1, HO2), and red cell adhesion (CD36) were analyzed by real-time RT-PCR. Levels of mRNA were normalized to the housekeeping HPRT gene and are shown as a ratio to control animals. These results are expressed as means± SEM (n¼ 7 for each group, *p < 0.05). (b) Spleen proteins associated with iron recycling analyzed by Western blot. Above: detection of DMT1, HO1, HO2, and CD36 proteins by immunoblotting in spleen homogenates. GAPDH was used as a loading control. Below: protein relative levels of DMT1, HO1, HO2, and CD36. The results are expressed as means± SEM of the target protein band intensity as compared with GAPDH band intensity (n¼ 4 for each group, *p < 0.05). There was no significant difference in DMT1, HO1, HO2, and CD36 relative protein levels between control and DU-contaminated rats.
HO1, HO2, and CD36 are indicated in the Figure 2b. These
protein levels were not modified statistically by DU exposure.
These data suggested that an increase in RBC degradation
for iron recycling may probably not be at the origin of RBC
diminution observed after 9 months of chronic exposure to DU.
It is broadly accepted that renal deterioration may lead to the
progression of chronic kidney disease responsible for anemia.
Renal deterioration was thus the last tested hypothesis to
explain reduction in RBC.
Modifications in the Expression of Renoprotective Genes
Renal dysfunction would be reflected—among others—by
changes in renoprotective genes mRNA levels. The
renopro-tective genes measured here were EPOR because of its
antiapoptotic role in kidney (Westenfelder, 2002), HO1 and 2
which have been shown to play a key role in cellular defenses
(Maines and Panahian, 2001), and CP the so-called
‘‘Super-oxide scavenger’’ that oxidizes toxic ferrous iron to non toxic
ferric iron (Goldstein
et al., 1982). The mRNA levels of EPO
and renoprotective genes were quantified relatively to the
HPRT reference gene (Fig. 3). The EPOR expression was
reduced by about 90% after chronic ingestion of DU. The
relative mRNA levels of heme degradation enzymes HO1 and
HO2 were not modified by exposure to DU. CP mRNA relative
levels of DU-contaminated rat kidneys were 12-fold higher
than those of control animals.
DU and Iron Accumulation in Kidney
The tissue iron content in kidney was evaluated in control
and DU-contaminated rats. There was no significant difference
in the renal iron concentration between control (8.86
± 5.93
lg/g tissue; n
¼ 7) and DU-contaminated animals (7.96 ± 1.74;
n
¼ 8).
Iron deposits in tissue were observed using Prussian blue
staining (Fig. 4). As shown in Figure 4a, iron deposits were
classified in small, intermediate and clustered iron deposits.
The observed kidney sections were divided in three distinct
parts for analysis: cortex, outer medulla and inner medulla for
which the different levels of iron deposition were estimated
semiquantitatively (Fig. 4b). Concerning small iron deposits,
statistical analysis showed that there was no significant
difference between control and DU rats regardless of kidney
section part. Intermediate size iron deposits were increased
after chronic exposure to DU in the whole kidney section: they
were augmented by
~1.5-fold in the cortex, (non significant);
approximately fourfold in the outer medulla (p
¼ 0.02) and
approximately ninefold in the inner medulla (p
¼ 0.02). Iron
aggregates—referred as clustered iron deposits—were
ob-served more frequently in DU rats than in control rats:
approxi-mately twofold in the renal cortex (p
¼ 0.02); approximately
threefold in the outer medulla (p
¼ 0.02) and approximately
twofold in the inner medulla (nonsignificant).
These data indicate that DU exposure modified the
distri-bution of iron in kidney, but not the total content in this tissue.
Kidney Iron Transport is Altered by DU Contamination
The expression of DMT1, apical iron transporter, was
quantified at both mRNA and protein levels. Relative DMT1
gene expression was increased by approximately threefold in
kidney (Fig. 5a). On the contrary, renal DMT1 protein levels
were decreased by 80% in DU-contaminated rats as compared
with control rats (Fig. 5b).
Histological Changes of Kidney Tissue with following
Contamination
Creatinine and urea blood concentrations were evaluated in
control and DU-contaminated rats. The values of blood
creatinine were 55.56
± 2.56 lmol/l and 52.91 ± 2.33 for
control (n
¼ 6) and DU-exposed (n ¼ 6) rats respectively,
FIG. 3. Effects of 9-month chronic ingestion of DU on renoprotective genes. Kidney mRNA encoding for EPOR, HO1, HO2, and CP analyzed by real-time RT-PCR. The kidney target mRNA levels were normalized to the housekeeping HPRT mRNA and are shown as a ratio to control animals. Results are expressed as mean± SEM (n¼ 7 for each group, *p < 0.05).
indicating no functional alterations of renal function after
DU exposure. This was confirmed by the lack of
signifi-cant difference of blood urea levels between control rats
(6.45
± 0.50;
n
¼ 6) and DU-contaminated animals (6.02 ±
0.36;
n
¼ 6).
Representative histological slides of kidney sections are
presented in Figure 6. This figure indicated clearly tubular
dilation and presence of hyaline casts in kidney of
DU-contaminated animals. The degree of lesion observed in renal
glomerular and tubulo-interstitial tissues was scored in control
and DU rats. In the control group, glomerular lesion scores
were equally dispersed between grades 0 and 1, whereas in the
DU group, glomerular lesions were mostly found to be grade 1.
However, no clear distinction was observed between the two
experimental groups. Tubulo-interstitial lesion scores of control
rats were distributed homogenously between 0 and 3, whereas
a major part of the DU-contaminated group had higher grades
of tubulo-interstitial lesions: 70% of animals had a lesion
degree
2. These results suggest that chronic DU exposure
induced especially tubulo-interstitial lesions.
DU Affects Kidney Apoptosis
The influence of DU exposure on kidney apoptosis and
proliferation was evaluated by immunohistochemistry. On light
microscopy, apoptotic (TUNEL) and proliferative (Ki67) cells
were observed in control and DU-contaminated rat kidneys.
Representative sections are shown in Figure 7a. Quantification
of TUNEL-positive cell count indicated that the number of
apoptotic cells was enhanced by a factor of 2 in the
corticomedullary junction after DU chronic ingestion (p
¼
0.026) whereas in the inner medulla, number of apoptotic cells
was not influenced by DU contamination (Fig. 7b). Concerning
proliferation, there was no significant difference in the number
of Ki67 positive proliferative cells in the corticomedullary
junction (-36%) and in the inner medulla (-51%) of
DU-contaminated rats when compared with control rats.
FIG. 4. DU daily ingestion increased iron deposition in kidney. (a) Representative sections of iron deposition in the renal cortex obtained by Prussian blue staining in control (C) and DU-contaminated rat (objective, 340). Photographs represent small, intermediate, and clustered iron deposits. (b) Semiquantitative estimation of iron deposition in kidney of control and DU-contaminated rats. C¼ control rat. Data are expressed as mean ± SEM (n ¼ 4 for each group, *p < 0.05) of the estimated iron deposition degree (0¼ none; 1 ¼ mild; 2 ¼ moderate; 3 ¼ high).
Discussion
The present report shows for the first time that chronic
exposure to DU at dose similar to this found in the environment
induces renal deterioration responsible for a decrease in RBC
numbers. Renal anemia is known to be an early symptom in the
progression of chronic kidney disease. The present results thus
suggest that chronic DU ingestion may lead to renal anemia
consecutive to the progression of a DU-induced chronic kidney
disease. Previous records of hematological parameters after
chronic exposure to DU concerned the epidemiological survey
of human populations and proved to be contradictory (Pinney
et al., 2003; Shawky et al., 2002; Squibb and McDiarmid,
2006). For instance, hematocrit, hemoglobin and RBC content
from uranium processing site workers remained within the
normal ranges (Shawky
et al., 2002) whereas surveyed
residents living around nuclear plant area revealed increases
in these hematological parameters (Pinney
et al., 2003).
Similarly to the present work, a clinical study of Gulf War
veterans showed that soldiers exposed to uranium had
a reduction in hemoglobin and hematocrit levels (Squibb and
McDiarmid, 2006). This discrepancy between these studies
may be due to a difference in the exposure pathway (inhalation
for workers, ingestion for populations living on contaminated
territories and injury for soldiers), in the physical–chemical
form of uranium (particulate for workers and soluble for
civilian populations), in the received doses, in the duration of
exposure and the time postexposure, as well as in the
occurrence of exposure in these different cases of uranium
exposure. It can be noticed that Gulf War veterans presented
a similar decrease in hemoglobin and hematocrit levels than
rats chronically exposed to DU by ingestion, probably because
of the continuous liberation of uranium from embedded DU
fragments.
The mechanisms leading to the reduction in RBC amounts
obtained following chronic exposure to DU were then
explored. Three hypotheses could explain RBC decrease:
reduced erythropoiesis, increased erythrocyte degradation for
iron recycling or renal dysfunction.
Concerning erythropoiesis, spleen erythroid progenitors were
increased with the chronic ingestion of DU. This is contradictory
with the transient depression in erythropoiesis observed after the
intravenous injection of 1 mg uranium/kg (Giglio
et al., 1989).
This previous report showed a reduction in plasmatic EPO
concentrations, whereas in the current work no change was
observed either in EPO plasmatic concentrations or EPO kidney
mRNA levels. Furthermore, the results obtained in the present
study indicate that the RBC productions in spleen and bone
marrow were not reduced by chronic exposure to uranium.
Consequently, a diminution in the erythropoiesis could not
explain the RBC decrease observed after chronic exposure to DU.
The second possible explanation of RBC diminution in
DU-contaminated rats was the increase in RBC degradation, which
implies an increase in spleen iron recycling. Chosen indicators
to study iron recycling were those implied in RBC attachment
(CD36), heme catabolism (HO1 and HO2) and iron flux
(DMT1, Ireg1) (Beaumont and Canonne-Hergaux, 2005). The
increase in DMT1 gene expression induced by DU exposure
could indicate an increase in iron transport. The increase in
mRNA level of molecules of DMT1 could indicate an increase
in iron flux, but this was not associated to increased protein
level. HO2 mRNA relative levels were also enhanced. However
these mRNA variations were not reflected at protein level. These
data indicate thus that iron recycling rate changes could not
explain the reduction in RBC after 9-month exposure to DU.
Renal dysfunction was thus the third hypothesis tested to
explain the reduction in RBC content after 9-month chronic
exposure to DU. Uranium-induced renal injury was first
described in the early 20th century following acute exposure
to high doses of uranium (Dickson, 1909). In 1915, Oliver,
observed a tubular dilation and hyaline casts in histological
kidney sections of guinea pigs and rats acutely contaminated
with 5 mg uranium (Oliver, 1915). More recently, extensive
tubular damage was induced following the intravenous
injection of 5 mg uranium/kg in rats (Fujigaki
et al., 2003).
In this previous report, the tubules recovered 7 days after the
uranium injection, probably due to the increase in cell
proliferation. Chronic exposure to uranium was also
demon-strated to induce renal injury. A 4-week experimental chronic
exposure to uranium with doses ranging from 0.96 to 600 mg/l
FIG. 5. Renal expression of iron transporter DMT1 in DU-contaminatedand control rats. (a) Kidney DMT1 mRNA relative levels analyzed by real-time RT-PCR. Levels of mRNA were normalized to the housekeeping HPRT gene and are shown as a ratio to control animals. Results are expressed as means± SEM (n¼ 7 for each group, *p < 0.05). (b) Renal DMT1 protein levels analyzed by Western blot. Above: detection of DMT1 by immunoblotting in kidney homogenates. GAPDH was used as a loading control. Below: protein relative levels of DMT1. The results are expressed as means± SEM of the target protein band intensity as compared with GAPDH band intensity (n¼ 4 for each group, **p < 0.01).
in drinking water evidenced that uranium-treated rat kidneys
were more likely to suffer from tubular dilation than those of
control rats (Gilman
et al., 1998). These different data are
consistent with the tubular lesions seen in the current report
after chronic exposure to 40 mg uranium/l. It is well known
that functional renal deterioration correlates more closely with
the extent of tubulo-interstitial injury than glomerular
pathol-ogy both in humans and in animal models of kidney disorders
(Alfrey and Hammond, 1990; Risdon
et al., 1968). This tubular
localization of renal deterioration is thus in accordance with the
tubulo-interstitial lesions observed after chronic exposure to
DU. A decade ago, Savill suggested that defects in apoptosis
might be involved in the pathogenesis of several renal diseases
(Savill, 1994). It appeared that kidneys of DU-treated rats had
more apoptotic cells than those of controls. This was not really
surprising because several
in vitro and in vivo experiments
showed an association between kidney damages and apoptosis
following acute uranium exposure (Prat
et al., 2005; Thiebault
et al., 2007). In addition, it has been shown recently that uranium
exposure induces the activity of the apoptotic agent caspase-9 in
renal cells (Thiebault
et al., 2007). As tubulo-interstitial lesions
are more frequent in DU-contaminated rats and proliferation is
not augmented to regenerate damaged tubules, one can thus
suppose that DU-induced tubular injury may lead to early
progressive renal defect. However, the effects of 9-month DU
exposure on kidney are very subtle as no change was observed in
blood renal marker creatinin and urea. This is consistent with
a recent clinical finding that showed no significant change in
these blood markers in adults drinking water from uranium
contaminated well (Magdo
et al., 2007). Nevertheless, an
elevated creatinin level was noted for a child thus highlighting
the potential hazard of uranium contamination on kidney.
Concerning the molecular effects of chronic exposure to DU,
the present study demonstrated that iron transporters, notably
DMT1, were protein targets for uranium in kidney. However,
a discrepancy was noted between mRNA level (33) and
protein level (reduced by 80%) of this transporter after DU
ingestion. These results were not in accordance with a previous
study that demonstrated increase in both mRNA and protein
levels of DMT1 after acute short-term contamination with
manganese (Wang
et al., 2006). The discrepancy between
mRNA levels and protein levels suggests that chronic DU
contamination had an impact on DMT1 regulation, not only at
transcriptional level but also at translational level. However,
the protein processing stage—translational or post-translational
level—at which this inhibitory effect of chronic exposure to
DU occurred, remains to be determined.
Recently characterized in the kidney, EPOR was proved to
be antiapoptotic. Indeed EPOR expressing cells had reduced
apoptosis under EPO treatment (Westenfelder, 2002). The
main role of the EPO signaling pathway in kidney is to protect
this tissue from ischemic injury by preventing excess apoptosis
(Sharples and Yaqoob, 2006). Further developments made it
possible to understand EPO antiapoptotic signaling pathway:
EPO binding to EPOR leads to a cascade of phosphorylations
that inactivates proapoptotic factors such as caspase-9 (Rossert
FIG. 6. Histological alterations of kidney after DU contamination. (a) Representative histological sections of control (C) and DU-contaminated rat kidneys (DU). Five micrometers sections were stained using HES (objective, 320). Note that tubulo-interstitial lesions were very marked in kidney of DU-contaminated rat. Arrow: hyaline casts; arrowhead: dilated tubule. (b) Data are the number of Control or DU rats with observed lesion degree in whole kidney section. Glomerular and tubulo-interstitial lesion degrees were scored from 0 to 3: 0¼ none; 1 ¼ slight; 2 ¼ moderate; 3 ¼ marked. DU-contaminated rats were more frequently subjected to moderate and marked tubulo-interstitial lesions.and Eckardt, 2005). In the present investigation, the dramatic
reduction in EPOR mRNA of 90% observed in
DU-contaminated rats may thus explain the increased apoptosis in
these animals probably due to impairment of the inactivation of
apoptotic factors.
To date, no report describes EPOR downregulation in
kidney. The rare studies dealing with EPOR mRNA reduction
were made in cultured cells (Pontikoglou
et al., 2006; Yoon
et al., 2006). These previous reports indicated that EPOR
mRNA reduction may be due to hypoxia or inflammation,
suggesting a certain complexity in the mechanisms regulating
EPOR expression. Within the context of the current
in-vestigation, this raises the question of EPOR regulation in
kidney after chronic exposure to DU.
The relative expression of mRNA or protein levels of heme
oxygenases was not markedly modified by chronic DU
FIG. 7. Chronic ingestion of DU and renal apoptosis and proliferation. (a) Representative immunohistological appearance of apoptotic (TUNEL) and proliferative cells (Ki67) of control and DU rat kidneys. Above: apoptotic kidney cells detected by TUNEL staining (objective, 340). Arrowhead: apoptotic cell. Below: proliferating cells in renal tissue obtained by immunohistochemical findings of Ki67 antigen with diaminobenzidine chromogen and hematoxylin counterstain (objective, 340). Arrowhead: proliferative cell. (b) Evaluation of apoptotic and proliferative cell content in kidney by counting. Apoptotic cells or proliferative cell were detected respectively by TUNEL staining (n¼ 4 for each group) and by Ki67 immunohistochemistry (n ¼ 7 for each group) in whole kidney section. C¼ control. Data are expressed as mean ± SEM (*p < 0.05). DU-contaminated rats had twice more TUNEL-positive cells in corticomedullar area than control rats.exposure neither in spleen nor in kidney. Such lack of changes
after chronic exposure to DU was not quite surprising, because
previous study demonstrated a transient induction of HO1
between 24 and 48 h after ischemia (Villanueva
et al., 2007).
Paradoxally, the mRNA level of the constitutively expressed
isoform HO2 was increased in spleen after DU contamination.
This augmentation was not associated with similar increase in
protein level of HO2, suggesting an additional post-transcriptional
change. Contrary to EPOR, CP mRNA levels were
dramat-ically augmented after 9-month DU contamination. The CP
antioxidant role is known to mimic super oxide dismutase
activity (Goldstein
et al., 1982). Owing to CP higher
expression in developing kidney than in mature kidney, it
was proposed that CP protected kidney from growth-induced
oxidative damages (Gupta
et al., 1999). Hence, it can be
assumed that CP is enhanced in the present study to protect
kidney from DU-induced permanent oxidative stress. The
primordial role of CP in case of uranium contamination was
confirmed
by
recent
in
vitro
blood
experiments
that
demonstrated the capacity of CP to bind 2 mol of uranium
per mole of protein (Vidaud
et al., 2005). It can be thus
hypothesized that CP plays a protector role with regard to DU
nephrotoxicity via uranium sequestration. The presence of
DU-triggered oxidative stress in kidney is demonstrated in
previous reports showing an induction of oxidative stress
markers in rat kidney after chronic uranium treatment (Linares
et al., 2006; Taulan et al., 2004). For instance, 3-month
chronic exposure to 10, 20, or 40 mg uranium/kg/day
increased
levels
of
oxidative
stress
markers
such
as
thiobarbituric acid–reactive substances content, super oxide
dismutase and oxidized glutathione activities in rat kidney
(Linares
et al., 2006). These various lines of evidence show
thus the induction of several oxidative stress markers
following uranium exposure.
It is well known that iron catalyzes the Fenton reaction,
which generates highly reactive cytotoxic hydroxyl radicals. In
rat kidney, it has been proved that iron accumulation obtained
by experimental chronic hemosiderosis leads to oxidative stress
generation whereas iron-depleted rats showed normal levels of
oxidative stress markers (Zhou
et al., 2000). Iron deposition in
DU-contaminated rats presented more ‘‘hemosiderosis-like’’
figures of iron deposition that is, they had extended and
numerous iron deposits. Iron deposition was already recorded
in a similar experiment with DU (Donnadieu-Claraz
et al.,
2007). Iron induced oxidative stress is a pathway incriminated
in chronic renal disease (Nath
et al., 1994). Furthermore, recent
advances showed that excess iron inhibited cell proliferation
and increased apoptosis (Carlini
et al., 2006). In addition, the
tissue iron accumulation has been shown
in vivo and in vitro to
lead to tubular damages (Agarwal
et al., 2004; Sponsel et al.,
1996). These data suggests that iron accumulation plays a direct
key role in renal apoptosis and injury. Furthermore, these data
indicate that disturbances of iron metabolism may be reflected
by changes in iron accumulation rather than by tissue iron
content. These underlying iron mechanisms may explain the
effects of chronic exposure to DU on rat kidney.
As reviewed by Nurko (2006), anemia in kidney disease
include: RBC loss, decreased RBC life span, EPO deficiency,
altered iron transport, iron deficiency and inflammation. In the
present study, a reduction in RBC content, a deficiency in EPO
pathway and kidney iron disorders were observed after chronic
exposure to DU. Thus we propose the following scheme to
interpret the effects of 9-month DU ingestion (Fig. 7): in rat
kidney, DU leads to perturbation of iron transport, inducing
iron accumulation, which itself generates an oxidative stress.
This may trigger excess apoptosis responsible for renal injury.
This renal dysfunction may be the reason for the RBC loss
observed in DU-treated rats. The repeated DU insult to kidney
may at least lead to chronic kidney disease which would lead to
early renal anemia. Iron transport and accumulation seem thus
to be the first link that results in renal injury. This would mean
that iron metabolism is a critical target of DU exposure.
However, it is difficult to estimate if the perturbations of iron
metabolism were responsible for kidney deterioration or, in the
contrary, if the uranium nephrotoxicity led to the alteration of
FIG. 8. Proposed pathway for DU mediated progressive kidney injury.Summarized diagram out of DU effects in kidney. Presence of DU induced the alteration of iron transport and deposition in renal tissue. This may thus lead to oxidative stress confirmed by the increased CP mRNA levels. This oxidative stress, as well as the reduction of EPOR expression, antiapoptosis factor in the kidney, may be the causes of the increase observed in apoptosis level after DU contamination. This conducts to kidney injury which would explain the reduction in blood red cell content.
tissue iron homeostasis. To answer this question, it would be
necessary to develop further experiments with time-course of
DU exposure in rats. In conclusion, the findings of the present
work indicate that chronic exposure to DU may induce subtle
effects on kidney with hematological consequences. The
effects observed in spleen (increased erythroid progenitors
and increased iron transport) suggest the setting up of
a compensatory process in this tissue. Thus, the results of this
investigation contribute to understanding the consequences and
the mechanisms underlying the biological effects of DU on the
kidney function.
FUNDING
ENVIRHOM research program supported by the Institut de
Radioprotection et de Suˆrete´ Nucle´aire (IRSN, Institute for
Radioprotection and Nuclear Safety, FRA).
ACKNOWLEDGMENTS
We are thankful to T. Loiseau and F. Voyer for providing the
animal care.
REFERENCES
Abu-Qare, A. W., and Abou-Donia, M. B. (2002). Depleted uranium—The growing concern.J. Appl. Toxicol. 22, 149–152.
Agarwal, R., Vasavada, N., Sachs, N. G., and Chase, S. (2004). Oxidative stress and renal injury with intravenous iron in patients with chronic kidney disease.Kidney Int. 65, 2279–2289.
Alfrey, A. C., and Hammond, W. S. (1990). Renal iron handling in the nephrotic syndrome.Kidney Int. 37, 1409–1413.
Beaumont, C., and Canonne-Hergaux, F. (2005). Erythrophagocytosis and recycling of heme iron in normal and pathological conditions; regulation by hepcidin.Transfus. Clin. Biol. 12, 123–130.
Bencosme, S. A., Stone, R. S., Latta, H., and Madden, S. C. (1960). Acute tubular and glomerular lesions in rat kidneys after uranium injury.Arch. Pathol. 69, 470–476.
Brzoska, M. M., Kaminski, M., Supernak-Bobko, D., Zwierz, K., and Moniuszko-Jakoniuk, J. (2003). Changes in the structure and function of the kidney of rats chronically exposed to cadmium. I. Biochemical and histopathological studies.Arch. Toxicol. 77, 344–352.
Carlini, R. G., Alonzo, E., Bellorin-Font, E., and Weisinger, J. R. (2006). Apoptotic stress pathway activation mediated by iron on endothelial cells in vitro.Nephrol. Dial. Transplant 21, 3055–3061.
Collins, J. F., Franck, C. A., Kowdley, K. V., and Ghishan, F. K. (2005). Identification of differentially expressed genes in response to dietary iron deprivation in rat duodenum.Am. J. Physiol. Gastrointest. Liver Physiol. 288,G964–G971.
Dickson, E. C. (1909). A report on the experimental production of chronic nephritis in animals by use of uranium nitrate.Arch. Int. Med. 30, 375–341. Donnadieu-Claraz, M., Bonnehorgne, M., Dhieux, B., Maubert, C., Cheynet, M., Paquet, F., and Gourmelon, P. (2007). Chronic exposure to uranium leads to iron accumulation in rat kidney cells.Radiat. Res. 167, 454–464.
Dublineau, I., Grandcolas, L., Grison, S., Baudelin, C., Paquet, F., Voisin, P., Aigueperse, J., and Gourmelon, P. (2007). Modifications of inflammatory pathways in rat intestine following chronic ingestion of depleted uranium. Toxicol. Sci. 98, 458–468.
Fujigaki, Y., Sun, D. F., Goto, T., and Hishida, A. (2003). Temporary changes in macrophages and MHC class-II molecule-expressing cells in the tubulointerstitium in response to uranyl acetate-induced acute renal failure in rats.Virchows Arch. 443, 206–216.
Giglio, M. J., Brandan, N., Leal, T. L., and Bozzini, C. E. (1989). The mechanism of the transient depression of the erythropoietic rate induced in the rat by a single injection of uranyl nitrate.Toxicol. Appl. Pharmacol. 99, 260–265. Gilman, A. P., Villeneuve, D. C., Secours, V. E., Yagminas, A. P., Tracy, B. L.,
Quinn, J. M., Valli, V. E., Willes, R. J., and Moss, M. A. (1998). Uranyl nitrate: 28-day and 91-day toxicity studies in the Sprague-Dawley rat. Toxicol. Sci. 41, 117–128.
Goldman, M., Yaari, A., Doshnitzki, Z., Cohen-Luria, R., and Moran, A. (2006). Nephrotoxicity of uranyl acetate: Effect on rat kidney brush border membrane vesicles.Arch. Toxicol. 80, 387–393.
Goldstein, I. M., Kaplan, H. B., Edelson, H. S., and Weissmann, G. (1982). Ceruloplasmin: An acute phase reactant that scavenges oxygen-derived free radicals.Ann. N. Y. Acad. Sci. 389, 368–379.
Gupta, A., Gupta, A., Nigam, D., Shukla, G. S., and Agarwal, A. K. (1999). Profile of reactive oxygen species generation and antioxidative mechanisms in the maturing rat kidney.J. Appl. Toxicol. 19, 55–59.
Juntunen, R. (1991). Uranium and radon in wells drilled into bedrock in Southern Finland. Report of investigation 98, InGeological Survey of Finland. Lestaevel, P., Bussy, C., Paquet, F., Dhieux, B., Clarencon, D., Houpert, P., and Gourmelon, P. (2005). Changes in sleep-wake cycle after chronic exposure to uranium in rats.Neurotoxicol. Teratol. 27, 835–840.
Linares, V., Belles, M., Albina, M. L., Sirvent, J. J., Sanchez, D. J., and Domingo, J. L. (2006). Assessment of the pro-oxidant activity of uranium in kidney and testis of rats.Toxicol. Lett. 167, 152–161.
Magdo, H. S., Forman, J., Graber, N., Newman, B., Klein, K., Satlin, L., Amler, R. W., Winston, J. A., and Landrigan, P. J. (2007). Grand rounds: Nephrotoxicity in a young child exposed to uranium from contaminated well water.Environ. Health Perspect. 115, 1237–1241.
Maines, M. D., and Panahian, N. (2001). The heme oxygenase system and cellular defense mechanisms. Do HO-1 and HO-2 have different functions? Adv. Exp. Med. Biol. 502, 249–272.
Mok, H., Mendoza, M., Prchal, J. T., Balogh, P., and Schumacher, A. (2004). Dysregulation of ferroportin 1 interferes with spleen organogenesis in polycythaemia mice.Development 131, 4871–4881.
Nath, K. A., Fischereder, M., and Hostetter, T. H. (1994). The role of oxidants in progressive renal injury.Kidney Int. Suppl. 45, S111–S115.
Nurko, S. (2006). Anemia in chronic kidney disease: Causes, diagnosis, treatment.Cleve Clin. J. Med. 73, 289–297.
Oliver, J. (1915). The histogenesis of chronic uranium nephritis with especial reference to epithelial regeneration.J. Exp. Med. xxi, 4.
Patrick, L. (2006). Lead toxicity part II: The role of free radical damage and the use of antioxidants in the pathology and treatment of lead toxicity.Altern. Med. Rev. 11, 114–127.
Pellmar, T. C., Fuciarelli, A. F., Ejnik, J. W., Hamilton, M., Hogan, J., Strocko, S., Emond, C., Mottaz, H. M., and Landauer, M. R. (1999a). Distribution of uranium in rats implanted with depleted uranium pellets. Toxicol. Sci. 49, 29–39.
Pellmar, T. C., Keyser, D. O., Emery, C., and Hogan, J. B. (1999b). Electrophysiological changes in hippocampal slices isolated from rats embedded with depleted uranium fragments.Neurotoxicology 20, 785–792. Pinney, S. M., Freyberg, R. W., Levine, G. E., Brannen, D. E., Mark, L. S., Nasuta, J. M., Tebbe, C. D., Buckholz, J. M., and Wones, R. (2003). Health
effects in community residents near a uranium plant at Fernald, Ohio, USA. Int. J. Occup. Med. Environ. Health 16, 139–153.
Pontikoglou, C., Liapakis, G., Pyrovolaki, K., Papadakis, M., Bux, J., Eliopoulos, G. D., and Papadaki, H. A. (2006). Evidence for downregulation of erythropoietin receptor in bone marrow erythroid cells of patients with chronic idiopathic neutropenia.Exp. Hematol. 34, 1312–1322.
Prat, O., Berenguer, F., Malard, V., Tavan, E., Sage, N., Steinmetz, G., and Quemeneur, E. (2005). Transcriptomic and proteomic responses of human renal HEK293 cells to uranium toxicity.Proteomics 5, 297–306.
Risdon, R. A., Sloper, J. C., and De Wardener, H. E. (1968). Relationship between renal function and histological changes found in renal-biopsy specimens from patients with persistent glomerular nephritis.Lancet 2, 363–366.
Rossert, J., and Eckardt, K. U. (2005). Erythropoietin receptors: Their role beyond erythropoiesis.Nephrol. Dial. Transplant. 20, 1025–1028. Satarug, S., and Moore, M. R. (2004). Adverse health effects of chronic
exposure to low-level cadmium in foodstuffs and cigarette smoke.Environ. Health Perspect. 112, 1099–1103.
Savill, J. (1994). Apoptosis and the kidney.J. Am. Soc. Nephrol. 5, 12–21. Sharples, E. J., and Yaqoob, M. M. (2006). Erythropoietin and acute renal
failure.Semin. Nephrol. 26, 325–331.
Shawky, S., Amer, H. A., Hussein, M. I., el-Mahdy, Z., and Mustafa, M. (2002). Uranium bioassay and radioactive dust measurements at some uranium processing sites in Egypt—Health effects.J. Environ. Monit. 4, 588–591. Souidi, M., Gueguen, Y., Linard, C., Dudoignon, N., Grison, S., Baudelin, C.,
Marquette, C., Gourmelon, P., Aigueperse, J., and Dublineau, I. (2005). In vivo effects of chronic contamination with depleted uranium on CYP3A and associated nuclear receptors PXR and CAR in the rat.Toxicology 214, 113–122. Sponsel, H. T., Alfrey, A. C., Hammond, W. S., Durr, J. A., Ray, C., and Anderson, R. J. (1996). Effect of iron on renal tubular epithelial cells.Kidney Int. 50, 436–444.
Squibb, K. S., and McDiarmid, M. A. (2006). Depleted uranium exposure and health effects in Gulf War veterans.Philos. Trans. R. Soc. Lond. B Biol. Sci. 361,639–648.
Taulan, M., Paquet, F., Maubert, C., Delissen, O., Demaille, J., and Romey, M. C. (2004). Renal toxicogenomic response to chronic uranyl nitrate insult in mice.Environ. Health Perspect. 112, 1628–1635. Thiebault, C., Carriere, M., Milgram, S., Simon, A., Avoscan, L., and
Gouget, B. (2007). Uranium induces apoptosis and is genotoxic to normal rat kidney (NRK-52E) proximal cells.Toxicol. Sci. 98, 479–487.
Tissandie, E., Gueguen, Y., Lobaccaro, J. M., Grandcolas, L., Voisin, P., Aigueperse, J., Gourmelon, P., and Souidi, M. (2007). In vivo effects of chronic contamination with depleted uranium on vitamin D3 metabolism in rat.Biochim. Biophys. Acta 1770, 266–272.
Vidaud, C., Dedieu, A., Basset, C., Plantevin, S., Dany, I., Pible, O., and Que´me´neur, E. (2005). Screening of human serum proteins for uranium binding.Chem. Res. Toxicol. 18, 946–953.
Villanueva, S., Cespedes, C., Gonzalez, A. A., Vio, C. P., and Velarde, V. (2007). Effect of ischemic acute renal damage on the expression of COX-2 and oxidative stress-related elements in rat kidney.Am. J. Physiol. Renal. Physiol. 292, F1364–F1371.
Wang, X., Li, G. J., and Zheng, W. (2006). Upregulation of DMT1 expression in choroidal epithelia of the blood-CSF barrier following manganese exposure in vitro.Brain Res. 1097, 1–10.
Wedeen, R. P., and Qian, L. F. (1991). Chromium-induced kidney disease. Environ. Health Perspect. 92, 71–74.
Westenfelder, C. (2002). Unexpected renal actions of erythropoietin. Exp. Nephrol. 10, 294–298.
Yoon, D., Pastore, Y. D., Divoky, V., Liu, E., Mlodnicka, A. E., Rainey, K., Ponka, P., Semenza, G. L., Schumacher, A., and Prchal, J. T. (2006). Hypoxia-inducible factor-1 deficiency results in dysregulated erythropoiesis signaling and iron homeostasis in mouse development.J. Biol. Chem. 281, 25703–25711.
Zhou, X. J., Laszik, Z., Wang, X. Q., Silva, F. G., and Vaziri, N. D. (2000). Association of renal injury with increased oxygen free radical activity and altered nitric oxide metabolism in chronic experimental hemosiderosis.Lab. Invest. 80, 1905–1914.
