• Aucun résultat trouvé

Novel Mn–Cu-Containing CeO2 Nanopolyhedra for the Oxidation of CO and Diesel Soot (Part II): Effect of Oygen Concentration on the Catalytic Activity

N/A
N/A
Info
Télécharger
Protected

Academic year: 2021

Partager "Novel Mn–Cu-Containing CeO2 Nanopolyhedra for the Oxidation of CO and Diesel Soot (Part II): Effect of Oygen Concentration on the Catalytic Activity"

Copied!
1
0
0

Chargement.... (Voir le texte intégral maintenant)

Texte intégral

(1)

Novel Mn–Cu-Containing CeO

2

Nanopolyhedra for the

Oxidation of CO and Diesel Soot (Part II): Effect of Oxygen

Concentration on the Catalytic Activity

Authors

Melodj Dosa, Marco Piumetti, Samir Bensaid, Nunzio Russo, Debora Fino

Publication date 2019/1/15 Journal Catalysis Letters Volume 149 Issue 1 Pages 107-118 Publisher Springer US Description

In this work, ceria-based nanocatalysts mixed with copper and manganese were studied. All the catalysts were synthesized via the hydrothermal procedure. Four samples were prepared here denoted through the atomic ratios of the metals in the mixed oxide: Ce0.95Mn0.05,

Ce0.95Cu0.05, Ce0.95Mn0.025Cu0.025 and CeO2. The samples were tested for the CO and soot

oxidation reactions with different gas-phase oxygen concentrations (10, 1.0, 0.5 and 0.02 vol% O2). As a whole, the most promising catalysts for the CO oxidation reaction are the

Ce0.95Cu0.05 and Ce0.95Mn0.025Cu0.025 samples. Indeed, the presence of Cu species in the solid

enhances the surface redox mechanism for the CO oxidation. High vol% O2 values lead to

competitive CO and O2 adsorption on the catalyst surface thus reducing the catalytic

Références

Télécharger maintenant ( PDF - 1 Page - 244.26 KB )

Documents relatifs

3D finite element simulation of TIG weld pool

Figure 4 show the temperature and velocity field with heat transfer and fluid flow model taking into account the free surface, as shown in this figure, the base metal ahead of the

Hair Growth Activity of Three Plants of the Polynesian Cosmetopoeia and Their Regulatory Effect on Dermal Papilla Cells

These findings are similar to several extracts reported in the literature for stimulating hair growth via proliferation of DP cells such as the marine alga Ishige sinicola

Is exposure to night-time traffic noise a risk factor for purchase of anxiolytic–hypnotic medication? A cohort study

1 Besides the auditory and cardiovascular effects, 2 neither of which are studied here, the published studies suggest that chronic exposure to environmental aircraft noise increases

Access to antiretroviral drugs and AIDS management in Senegal

Persons qualifying for antiretroviral (ARV) therapy are selected on the basis of immunological and clinical criteria, regardless of economic and social considerations. A system

The pyrogeography of eastern boreal Canada from 1901 to 2012 simulated with the LPJ-LMfire model

The objectives of this study were (1) to calibrate the LPJ-LMfire model for boreal forests in eastern Canada; (2) to assess the predictive skills of the model with independent data

Cross-reactivity between tumor MHC class I-restricted antigens and an enterococcal bacteriophage

TRBV13-2 TRBJ2-7 CASGDFYEQYF TGTGCCAGCGGGGACTTTTATGAACAGTACTTC TRBV13-2 CASGDFYEQYF TRBJ2-7 TRBV13-2 TRBJ2-7 16 TRBV13-2 TRBJ2-7 CASGDFYEQYF TGTGCCAGCGGTGATTTCTATGAACAGTACTTC

تمفصل الفضاء في رباعية الخسوف لإبراهيم الكوني مقاربة سيميائية

فوسخلا ةيعابر يف ءاضفلا تايلجت يناثلا لصفلا هلصفمتو 190 ةقيقلحا نلأ ،نيوكلا ميهاربإ دنع ةراشلإا ( ةنونيكلا  رهاظلا ) في ةينبم يذلا

C. elegans MCM-4 is a general DNA replication and checkpoint component with an epidermis-specific requirement for growth and viability

In contrast to somatic cells in mcm-4 mutants, the gonad continues DNA replication and cell division until late larval development.. Expression of MCM-4 in the epidermis (also known