• Aucun résultat trouvé

Long-term effects of prenatal stress and diazepam on D2 receptor expression in the nucleus accumbens of adult rats

N/A
N/A
Protected

Academic year: 2021

Partager "Long-term effects of prenatal stress and diazepam on D2 receptor expression in the nucleus accumbens of adult rats"

Copied!
4
0
0

Texte intégral

(1)

Neuroscience Letters 594 (2015) 133–136

Contents lists available at ScienceDirect

Neuroscience Letters

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / n e u l e t

Research article

Long-term effects of prenatal stress and diazepam on D2 receptor expression in the nucleus accumbens of adult rats

S. Lakehayli a,∗ , N. Said a , M. El Khachibi b , M. El Ouahli c , S. Nadifi b , F. Hakkou a , A. Tazi a

a

Laboratory of Pharmacology, Faculty of Medicine and Pharmacy of Casablanca, 19 Rue Tarik Bnou Ziad, Casablanca, Morocco

b

Genetics and Molecular Pathology Laboratory, Faculty of Medicine and Pharmacy of Casablanca, 19 Rue Tarik Bnou Ziad, Casablanca, Morocco

c

Sultan My Slimane University, Fac Sciences & Tecniques Beni-Mellal, Life Sciences, Morocco

h i g h l i g h t s

• Prenatal stress has long lasting effects on the dopaminergic system in the nucleus accumbens.

• Offspring from prenatally stressed dams exhibited significantly elevated Drd2 mRNA expression.

• Repeated adult diazepam exposure down-regulated Drd2 expression and prevented the effect of prenatal stress.

a r t i c l e i n f o

Article history:

Received 13 February 2015

Received in revised form 27 March 2015 Accepted 30 March 2015

Available online 1 April 2015

Keywords:

Drd2 expression Prenatal stress Nucleus accumbens Mesocorticolimbic pathway Diazepam

a b s t r a c t

Early life stress during the gestational period alters specific neuronal circuits leading to behavioral alterations later in life. In the present study, we assessed the effects of prenatal stress and repeated benzodiazepine administration on dopamine receptor 2 expression in the nucleus accumbens of adult offspring.

Our results show elevated Drd2 expression levels in the nucleus accumbens (NAcc) of prenatally stressed rats compared to control subjects, while repeated diazepam administration in adulthood down- regulated Drd2 expression and prevented the effect of prenatal stress. These observations suggest that prenatal stress may induce permanent alterations in the corticolimbic pathway implicated in drug- seeking behavior.

© 2015 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

It is well known that dopamine exerts its functions via binding to DA receptors, which are divided into two classes (D1-like and D2-like receptors) on the basis of their biochemical and physiolog- ical effects [1]. The D2 receptors are the most abundant subtypes of D2-like receptors critically involved in drug addiction and the reward pathway [2]. Many studies have shown that stress alters dopaminergic function and elicits specific responses depending on the type and duration of aversive stimulation [3–5].

Benzodiazepines are some of the most commonly prescribed medications used to treat anxiety and insomnia. Despite the strong anxiolytic potential, chronic benzodiazepine treatment

∗ Corresponding author. Tel.: +212 22471289; fax: +212 22267091.

E-mail address: [email protected] (S. Lakehayli).

elicits adaptive responses in the central nervous system, seen behaviorally as functional tolerance and physical dependence [6].

Furthermore, benzodiazepines modulate chloride ion flux through GABA

A

receptor channels leading to an overall hyperpolarization of GABA interneurons and a decrease in their activity. As a conse- quence, a reduction in the release of GABA induces a disinhibition of dopamine (DA) neurons and produces a strong increase in extra- cellular DA in the mesolimbic reward circuit [7].

Based on the specific involvement of DA system in drug-seeking behavior, it was important to evaluate the long-lasting effects of prenatal stress on this system in adult life. In this report, we aimed to examine whether prenatal stress exposure may have a detrimen- tal impact on the dopamine receptor 2 expression and its response to chronic benzodiazepine administration. We therefore, exposed female rats to chronic stress during their last ten days of pregnancy and measured the levels of D2-like receptors by real time PCR in the nucleus accumbens of adult offspring.

http://dx.doi.org/10.1016/j.neulet.2015.03.065

0304-3940/© 2015 Elsevier Ireland Ltd. All rights reserved.

(2)

134 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136

Table 1

Primer sequences used for semi-quantitative real-time PCR.

Gene Gene bank Primer sequences (5

–3

) Amplification size

Hprt NM 012583.2 Fwd: GACCGGTTCTGTCATGTCG 61

Rev:ACCTGGTTCATCATCACTAATCAC

Drd2 NM 012547 Fwd AAGCGCCGAGTTACTGTCAT 111

Rev GGCAATGATACACTCATTCTGGT

2. Materials and methods 2.1. Animals

Experiments were carried out in male and female Wistar rats (Laboratory of Pharmacology Casablanca), weighing 200–250 g.

Rats were housed three per cage and allowed free access to food and water. Animals were handled daily for 7 days before each experi- ment. Constant temperature (22 ± 1

C) and lighting conditions (12 L:12 D cycle) were maintained in the housing room. All experiments were approved by the Ethical Committee for biomedical research of the Faculty of Medicine and Pharmacy of Casablanca, Morocco (Comité d’Éthique pour la Recherche Biomédicale de Casablanca:

CERBC).

2.2. Drugs

Diazepam (Roche, Morocco), was obtained as solution (1 g/100 ml) and diluted in 0.9% NaCl. Animals received saline (0.9%

NaCl) or drug (Diazepam: 2.5 mg/kg) injections, as appropriate in a volume of 5 ml/kg body weight of animal.

2.3. Prenatal stress procedure

Prenatal stress was conducted as previously described [8]: Preg- nant female rats were assigned randomly to prenatal stress (PS) and control (Ctrl) groups. Stress was performed each day of the last ten days of pregnancy in which the neural development of the fetus is supposed to occur in rats [9].

Stressed dams were taken to an experimental box with a grid floor that allowed delivering daily 80 electric shocks (0.5 mA, for 5 s, 1–2 min apart) on a random basis during 100-min sessions carried out between 08:00 and 16:00 h. Control females were left undisturbed in their home cages. After birth, the litter sizes were recorded and adjusted to the same litter size (8 pups per litter).

All offspring were fostered by their own mothers. The pups were weaned at 21 days of age and housed in groups of three per cage. A total of 5 randomly selected litters per group was used in this study.

A maximum of three pups per litter was used for each experimental group to avoid any litter effect [10]. The experiments were carried out during the light phase of the light-dark cycle.

2.4. Injection treatments

Adult control (Ctrl) and PS offspring (80 days of age) were weighed and randomly assigned to either a saline or diazepam (DZP) group (n = 6 for each group). Saline groups received four daily intraperitoneal (i.p) injections of NaCl 0.9%, while the DZP groups received four daily i.p injections of diazepam (2.5 mg/kg).

2.5. Tissue collection

Adult treated and untreated rats were euthanized by decapita- tion 24 h after the last injection. Brains were quickly removed and placed on ice. The nucleus accumbens was dissected out from this section, a rat brain atlas [11] being used for reference. Two coronal cuts were made at right angles to the axis of the brain. The first

cut was made 1 mm anterior to the optic chiasma while the second cut was 1.5 mm anterior to the first cut. The nucleus accumbens (NAcc) was dissected, frozen on dry ice and stored at − 80

C until molecular analysis.

2.6. Real-time PCR analysis

Total RNA was extracted from frozen tissues using Tri- zol (Invitrogen) according to manufacturer’s instructions. RNA concentration and quantified using the NanoVue

TM

Plus Spec- trophotometer (GE Healthcare, UK). RNA extracts were kept frozen until use.

For RT-PCR, cDNAs were obtained by reverse transcription from 2 ␮ g of RNA using 4 ␮ l of M-MLV reverse transcriptase (Invitrogen), 1 ␮ l random Examer (Invitrogen), 10 nM dNTP (Invitrogen) and 1 ␮ l de RT Superscript at 200 U/ ␮ l (Invitrogen, Morocco).

From resulting cDNAs (2 ␮ l per sample), each sequence of inter- est was amplified in a final volume of 25 ␮ l of a commercial reaction mixture, containing: 5 × reaction buffer, 1.5 mM MgCl2, 50 ␮ M primers, 0.25 U Taq polymerase (BIOLINE, LONDON, UK) and 50 ng of cDNA.

Thermal cycling parameters were: 35 cycles of DNA denatura- tion (5 min at 95

C), primer hybridization (30 s at 95

C), elongation (30 s at 72

C) and a final elongation step (7 min at 72

C). PCR products were separated by electrophoresis on 2% agarose gel and visualized by ethidium bromide staining. Each sample was ana- lyzed in triplicate and to ensure measurements form different PCR runs were cross-comparable. Real time PCR was performed using real time PCR Applied Biosystem FAST 7500 apparatus and Syber Green according to manufacturer’s protocol.

Relative quantification was used to determine fold changes (control vs PS), using the CT method. Primer sequences are shown in Table 1. Hprt was used as a housekeeping gene.

2.7. Statistical analysis

Data were analyzed using parametric analysis of variance (ANOVA), with group (control vs PS) and treatment (vehicle vs diazepam) as between-subject variables, followed by student’s t- test. Significance was set at p < 0.05.

3. Results

As shown in Table 2, no differences in litter sizes, number of males and females per litter and male/female ratio were found between prenatally stressed and non-stressed animals (p > 0.05).

Two-way analysis of variance showed a significant stress/treatment interaction (Fig 1: F

(3,20)

= 32.108; p < 0.001).

Table 2

Litter parameters analyzed in control and prenatally stressed litters.

Parameter Control Prenatal stress

Litter size 9.6 ± 0.74 10.2 ± 0.37

Number of males per litter 5.2 ± 0.31 5.0 ± 0.22 Number of females per litter 4.4 ± 0.51 5.2 ± 0.37

Male/female ratio 1.17 ± 0.08 0.99 ± 0.11

Data are expressed as mean± SEM of PS (n = 10) and control (n= 10) litters.

(3)

S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136 135

.0 .5 1.0 1.5 2.0 2.5

Ctrl-Saline PS-Saline Ctrl-DZP PS-DZP

***

** ≠≠≠

+

D R D 2 re la v e F o ld ch a n g e

Fig. 1. Real-time quantitative RT-PCR analysis of the effect of prenatal stress and diazepam (2.5 mg/kg) injections on Drd2 mRNA level in the NAcc.

Data are expressed as mean± SEM of Drd2 levels in the NAc (n= 6 for each group). **p< 0.01 and ***p< 0.001 vs Ctrl-Saline. +p< 0.05 vs Ctrl-DZP group, = / = / = / p< 0.001 vs PS-Saline group.

Statistical analyses of the group means revealed a significant upregulation of Drd2 mRNA (p < 0.001) in the NAcc of PS animals compared with Ctrl-Saline group. Moreover, repeated exposure to diazepam in control and prenatally stressed adult rats led to a significant decrease in the expression of Drd2 mRNA in the NAcc in the control rats (p < 0.01, compared with Ctrl-saline group) and the PS-DZP treated group (p < 0.001, compared with PS-Saline group). Strikingly, a significant downregulation of Drd2 mRNA was observed in the NAcc of PS group treated with DZP compared to control rats treated with the same drug.

4. Discussion

Stress exposure during early life has long been considered as an etiological factor in psychiatric disorders and enhanced drug- seeking behavior later in life [12–16]. These effects are mediated by exposure to elevated levels of glucocorticoids which can readily traverse the placental barrier and influence brain development in utero, leading to behavioral alterations and dysfunction of specific neural substrates [17,18,14]. We previously showed that adult rats that had been exposed to prenatal stress display increased place preference for the diazepam-paired side and are more sensitive to the anxiolytic actions of benzodiazepines compared with controls [8]. Furthermore, many studies have shown that prenatal stress influenced dopamine receptor expression in the nucleus accum- bens of adult offspring [19,20], which were more responsive to stress and cocaine [21,22,14,15], suggesting that early life events can program the mesolimbic circuit.

Since the mesolimbic dopaminergic system is strongly impli- cated in motivational and reward aspects of addictive behaviors [23,24], the present investigation was undertaken to determine the long-term effects of prenatal stress exposure on D2 receptors expression.

Our results indicate that prenatal stress induced changes in the nucleus accumbens (NAcc) of adult offspring. Drd2 mRNA expres- sion levels were markedly upregulated in the NAcc of prenatally stressed rats. Moreover, repeated diazepam exposure significantly down-regulated Drd2 expression in adult PS rats compared with controls.

These findings are in agreement with other studies which reported a similar increase in D2 receptors and a decrease in D3 receptors in the nucleus accumbens of adult male offspring sub- jected to prenatal restraint stress [12]. Another study has found similar results in Drd2 overexpression following prenatal dexam- ethasone exposure within the NAcc of adult offspring associated with low intra-NAcc levels of dopamine and an impoverishment

in dopaminergic inputs in the NAcc indicating a hypodopamin- ergic state [16]. Other investigators have reported that PS rats had reduced neuronal numbers in the NAcc and fewer dopamine inputs from the VTA [25]. In addition, PS rats displayed a higher DA turnover in prefrontal cortex and a lower turnover in corpus striatum and nucleus accumbens [26,27].

All these findings suggests that the increased mRNA levels of Drd2 in the NAc of prenatal stress exposed animals may appear as a compensatory mechanism due to the low dopamine levels observed in this structure. The alteration of dopaminergic system due to the prenatal stress may provide a biochemical basis for the behavioral abnormalities previously reported in adult rats sub- jected to prenatal stress which demonstrate that prenatal stress enhanced the abuse potential of benzodiazepines in the offspring during adulthood [8].

The mesolimbic dopaminergic system is known to be involved in motivational and reward aspects of addictive behaviors [23,24].

Furthermore, chronic administration of benzodiazepine stimulated dopamine levels in the NAcc by reducing the inhibition of dopamin- ergic neurons [28]. Moreover, a previous study in rats suggested that ventral tegmental area (VTA) DA neurons are disinhibited after diazepam injection [29]. Besides, activation of GABA

A

receptors by direct administration of muscimol (GABA

A

receptor agonist) into the VTA significantly increased dopamine release in the NAcc [30].

High levels of dopamine within the nucleus accumbens mediate the rewarding effects of drug of abuse [31].

The results of the present study showed that repeated diazepam administration down-regulated Drd2 expression in the nucleus accumbens of PS and control animals treated with diazepam.

This down-regulation seems to be an adaptive mechanism in response to the potential increased dopamine levels following such treatment. Moreover, the down-regulation of D2 receptors following diazepam administration was more marked in adult prenatally stressed animals compared with non-stressed ani- mals, suggesting a hypersensitivity of dopamine receptors due to the hypo-dopaminergic state induced by prenatal stress. There- fore, prenatal stress exposure changed the sensitivity of the mesencephalic dopaminergic transmission to benzodiazepine in adulthood.

Interestingly, a recent study has shown that L-DOPA admin- istration normalized the hypodopaminergic state and the Drd2 responses to subsequent morphine and ethanol exposure of prenatal DEX exposed animals [16] suggesting that a simple rein- statement of dopaminergic homeostasis may prevent drug abuse in vulnerable individuals.

More studies are needed to determine the precise mechanisms underlying the susceptibility to later substance abuse.

5. Conclusion

In summary, we demonstrate that prenatal stress has long last- ing effects in prenatally stressed offsprings that extend into the adulthood. Prenatally stressed rats displayed an increased Drd2 mRNA expression levels in the nucleus accumbens which was sig- nificantly down-regulated after repeated adult administration of diazepam.

References

[1] J.M. Beaulieu, R.R. Gainetdinov, The physiology, signaling, and pharmacology of dopamine receptors, Pharmacol. Rev. 63 (2011) 182–217.

[2] H.S. Bateup, E. Santini, W. Shen, S. Birnbaum, E. Valjent, D.J. Surmeier, et al., Distinct subclasses of medium spiny neurons differentially regulate striatal motor behaviors, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 14845–14850.

[3] S. Puglisi-Allegra, E. Kempf, C. Schleef, S. Cabib, Repeated stressful

experiences differently affect brain dopamine receptor subtypes, Life Sci. 48

(1991) 1263–1268.

(4)

136 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136

[4] S. Cabib, S. Puglisi-Allegra, F.R. D’Amato, Effects of postnatal stress on dopamine mesolimbic system responses to aversive experiences in adult life, Brain Res. 604 (1993) 232–239.

[5] J.M. Finlay, M.J. Zigmond, The effect of stress on central dopaminergic neurons: possible clinical implications, Neurochem. Res. 22 (1997) 1387–1394.

[6] J.H. Woods, J.L. Katz, G. Winger, Benzodiazepines: use, abuse, and consequences, Pharmacol. Rev. 4 (1992) 151–347.

[7] K.R. Tan, M. Brown, G. Labouèbe, C. Yvon, C. Creton, J.M. Fritschy, U. Rudolph, C. Lüscher, Neural bases for addictive properties of benzodiazepines, Nature 463 (2010) 769–774.

[8] S. Lakehayli, N. Said, O. Battas, F. Hakkou, A. Tazi, Prenatal stress alters place conditioning and sensitivity to benzodiazepines in adult rats, Neurosci. Lett.

591 (2015) 187–191.

[9] B. Clancy, R.B. Darlington, B.L. Finlay, Translating developmental time across mammalian species, Neuroscience 105 (2001) 7–17.

[10] R. Chapman, J. Stern, Failure of severe maternal stress or ACTH during pregnancy to affect emotionality of male rat offspring: implications of litter effects for prenatal studies, Dev. Psychobiol. 12 (1979) 255–269.

[11] G. Paxinos, C. Watson, The Rat Brain, sixth ed., Elsevier academic Press, Burlington, MA, USA, 2007.

[12] C. Henry, G. Guegant, M. Cador, E. Arnauld, J. Arsaut, M. Le Moal, J.

Demotes-Mainard, Prenatal stress in rats facilitates amphetamine-induced sensitization and induces long lasting changes in dopamine receptors in the nucleus accumbens, Brain Res. 685 (1995) 179–186.

[13] M. Vallée, S. Maccari, F. Dellu, H. Simon, M. Le Moal, Long term effects of prenatal stress and postnatal handling on age-related glucocorticoid secretion and cognitive performance: a longitudinal study in the rat, Eur. J. Neurosci. 11 (1999) 2906–2916.

[14] P.V. Piazza, M. Le Moal, Pathophysiological basis of vulnerability to drug abuse: role of an interaction between stress, glucocorticoids, and dopaminergic neurons, Annu. Rev. Pharmacol. Toxicol. 36 (1996) 359–378.

[15] R. Sinha, Chronic stress, drug use, and vulnerability to addiction, Ann. N.Y.

Acad. Sci. 1141 (2008) 105–130.

[16] A.J. Rodrigues, P. Leao, J.M. Pego, D. Cardona, M.M. Carvalho, M. Oliveira, et al., Mechanisms of initiation and reversal of drug-seeking behavior induced by prenatal exposure to glucocorticoids, Mol. Psychiatry 17 (2012)

1295–1305.

[17] A.J. Rodrigues, P. Leao, M. Carvalho, O.F. Almeida, N. Sousa, Potential programming of dopaminergic circuits by early life stress, Psychopharmacology 214 (2010) 107–120.

[18] J.J. Cerqueira, J.M. Pego, R. Taipa, J.M. Bessa, O.F. Almeida, N. Sousa, Morphological correlates of corticosteroid-induced changes in prefrontal cortex-dependent behaviors, J. Neurosci. 25 (2005) 7792–7800.

[19] A.L. Jongen-Relo, G.J. Docter, A.J. Jonker, E. Vreugdenhil, H.J. Groenewegen, P.

Voorn, Differential effects of dopamine depletion on the binding and mRNA levels of dopamine receptors in the shell and core of the rat nucleus accumbens, Brain Res. Mol. Brain Res. 25 (1994) 333–343.

[20] M.A. Berger, V.G. Barros, M.I. Sarchi, F.I. Tarazi, M.C. Antonelli, Long-term effects of prenatal stress on dopamine and glutamate receptors in adult rat brain, Neurochem. Res. 27 (2002) 1525–1533.

[21] T.E. Kippin, K.K. Szumlinski, Z. Kapasova, B. Rezner, R.E. See, Prenatal stress enhances responsiveness to cocaine, Neuropsychopharmacology 33 (2008) 769–782.

[22] P.V. Piazza, J.M. Deminiere, M. Le Moal, H. Simon, Factors that predict individual vulnerability to amphetamine self-administration, Science 245 (1989) 1511–1513.

[23] G.F. Koob, N.D. Volkow, Neurocircuitry of addiction, Neuropsychopharmacology 35 (2010) 217–238.

[24] M.J. Meaney, W. Brake, A. Gratton, Environmental regulation of the development of mesolimbic dopamine systems: a neurobiological mechanism for vulnerability to drug abuse? Psychoneuroendocrinology 27 (2002) 127–138.

[25] M. Carlsson, A. Carlsson, Interactions between glutamatergic and monoaminergic systems within the basal ganglia implications for schizophrenia and Parkinson’s disease, Trends Neurosci. 13 (1990) 272–276.

[26] S.J. Alonso, E. Navarro, C. Santana, M. Rodríguez, Motor lateralization behavioral despair and dopaminergic brain asymmetry after prenatal stress, Pharmacol. Biochem. Behav. 58 (2) (1997) 443–448.

[27] E. Fride, M. Weinstock, Prenatal stress increases anxiety related behavior and alters cerebral lateralization of dopamine activity, Life Sci. 42 (1988) 1059–1065.

[28] K.R. Tan, U. Rudolph, C. Luscher, Hooked on benzodiazepines: GABA

A

receptor subtypes and addiction, Trends Neurosci. 34 (4) (2011) 188–197.

[29] D.P. O’Brien, F.J. White, Inhibition of non-dopamine cells in the ventral tegmental area by benzodiazepines: relationship to A10 dopamine cell activity, Eur. J. Pharmacol. 142 (1987) 343–354.

[30] Z.X. Xi, E.A. Stein, Nucleus accumbens dopamine release modulation by mesolimbic GABAA receptors-an in vivo electrochemical study, Brain Res. 798 (1998) 156–165.

[31] G.F. Koob, M. Le Moal, Drug addiction, dysregulation of reward, and allostasis,

Neuropsychopharmacology 24 (2) (2001) 97–129.

Références

Documents relatifs

Infusion of α-flupenthixol into the ventral nucleus accumbens (NAcc) shell inhibited the acquisition of cocaine self-administration, reduced responding for the drug under FR-1 and

However, in the presence of cholinergic input (i.e. in the absence of nAChR antagonist DHβE), these direct effects of NO at the level of the dopamine terminal to increase release

Une programmation budgétaire pluriannuelle pourrait être adossée à la prochaine loi LOP-DSI qui doit être révisée en 2019 pour la période 2019- 2022, afin de traduire dans la

It Improving Abdomen Tumor Low-dose CT Images Using A Fast Dictionary Learning Based Processing... should be noted that results of clinical value in abdomen LDCT have been

La sec- tion 4 concerne notre contribution et donne des préci- sions sur la démarche que nous proposons de développer pour obtenir une mesure globale de la

Since the contours of constant B are the trajectories of equatorial particles conserving their mag- netic moment, the fact that they are not contours of constant Alfv´enic wave

In this paper we describe the results obtained from the analysis of ULF geomagnetic field vari- ations and ionospheric measurements at low latitude during the campaign, and,

That relationship, certainly from the point of view of this reviewer, had all the appearances of an interesting point made during after -dinner conversation butlittle