• Aucun résultat trouvé

Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity

N/A
N/A
Protected

Academic year: 2021

Partager "Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity"

Copied!
14
0
0

Texte intégral

(1)

N O O O O Pr Pr M+ 170 H+ N H + + N O O H N H O O O O Pr Pr N H O O Pr Lys O O O O Pr Pr N 156 H+ N H + N O O H + Pro N H O O O O Pr Pr N H O O Pr Orn

B

A

C

D

M+

E

authentic Pip M+ M+ Supplemental Figure 1 

http://doc.rero.ch

(2)

(A) Mass spectrum of the unknown substance after derivatization with propyl chloroformate converting amino groups into propyl carbamate and carboxyl groups into propyl ester derivatives. The mass spectrum was not present in our mass spectral library containing 45 standard amino acids and amines. Containing the fragment series m/z 198, 170, 128, and 84, the spectrum showed similarities to the spectrum of the lysine derivative (B). Moreover, the m/z 257 ion appeared to be the molecular ion (M+) of the unknown substance. We

recognized that a homologous relationship existed to the spectrum of the proline derivative (C) in a way that each of the fragments m/z 257 (M+), 198, 170, 128, and 84 of the unknown

substance spectrum (A) was replaced by a fragment reduced by 14 mass units: m/z 243 (M+), 184, 156, 114, and 72, respectively (C). The spectra of the derivatives of lysine

(“homoornithine”) (B) and ornithine (D) exhibited a similar 14 mass unit fragment shift, which is consistent with the presence of an additional methylene group in lysine compared to ornithine. These observations and deduced structures of fragment ions (A, C) were consistent with the assumption that the unknown compound is pipecolic acid (homoproline), the methylene homologue of proline. (E) Authentic pipecolic acid yielded an identical mass spectrum than the extracted substance (A) after propyl chloroformate derivatization.



(3)

Supplemental Figure 2. The plant-derived substance identified as Pip and authentic Pip have identical GC retention times.

Overlay of GC ion chromatograms (m/z 158, before t = 10.6 min; m/z 170 after t = 10.6 min) derived from a pure plant extract sample (blue) and the same sample supplemented with 5 ng of authentic Pip demonstrate co-elution of extract peak and authentic Pip standard (retention time = 11.5 min). Note that NorVal (m/z 158, retention time = 10.4 min), which is used as an internal standard and was added to the plant extract before the work-up procedure, has similar abundance in the supplemented and original sample.



(4)

NH2 N H2 CO2H Lys D-ketoglutarate NH2 N H CO2H HO2C CO2H Glu LKR/SDH saccharopine LKR/SDH lysine ketoglutarate reductase saccharopine dehydrogenase NH2 O CO2H D-amino adipic semialdehyde D-aminoadipic acid (Aad) N H2 CO2H O H-amino-D-keto caproic acid N CO2H pipecolic acid (Pip) N CO2H NH2 CO2H HO2C '1 -piperideine-2-carboxylic acid ' 1 -piperideine-6-carboxylic acid reduction dehydrogenation N H CO2H amino-transferase sarcosine oxidase

Supplemental Figure 3. Proposed scheme for pathogen-inducible Pip and Aad biosynthesis in plants via lysine catabolism.

The scheme is based on earlier (e.g. Galili et al., 2001; Gupta and Spenser, 1969; Song et al., 2004b; Goyer et al., 2004) and present findings (e.g. Fig. 3). Our presented findings demonstrate that the lysine aminotransferase ALD1 mediates pathogen-induced pipecolic acid biosynthesis. Whether H-amino-D-ketocaproic acid and/or '1-piperideine-2-carboxylic acid are direct reaction products of an ALD1-catalysed transamination reaction still needs experimental verification.



(5)

0,0 1,0 2,0 3,0 4,0 5,0 6,0

A

Pip (˜ g g -1FW) 2° leaves, 2 dpi

B

MgCl2 Psm Psm avrRpm1 ** *** treatment of 1° leaves MgCl2 Psm avrRpm1 Pip (˜ g g -1FW) 1° leaves, 1 dpi

Col-0 ald1 fmo1 ics1 npr1 pad4

0 5 10 15 20 25 30 35 40 * °° ••• ••• *** *** ** **

Supplemental Figure 4. Psm avrRpm1-induced Pip accumulation in inoculated and distal leaves.

(A) Accumulation of Pip in Psm avrRpm1-inoculated leaves of wild-type Col-0 and different defense mutant plants at 1 dpi. Details as described in the legend to Fig. 2.

(B) Pip accumulation in upper (2°) leaves following inoculation of lower (1°) leaves with Psm or Psm avrRpm1 at 2 dpi. Details as described in the legend to Fig. 3.



(6)

0 5 10 15 20 25 30 35 40 45 0 5 10 15 20 25 30 35 40 45 50 0,0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 1,0

A

MgCl2 Psm MgCl2 Psm MgCl2 Psm SA (ng m l -1 leaf -1) MgCl2 Psm

B

C

D

MgCl2 Psm MgCl2 Psm MgCl2 Psm MgCl2 Psm

E

F

G

H

* *** ** * *

I

MgCl2 Psm 0,0 0,2 0,4 0,6 0,8 1,0 1,2 0,0 0,5 1,0 1,5 2,0 2,5 3,0 3,5 4,0 SAG (ng m l -1 leaf -1) 0,0 0,2 0,4 0,6 0,8 1,0 1,2 1,4 1,6 1,8 MeSA (ng m l -1 leaf -1) 0,0 0,1 0,2 0,3 0,4 0,5 0,6 AZA (ng m l -1 leaf -1) 0,0 0,2 0,4 0,6 0,8 1,0 1,2 1,4 1,6 JA (ng m l -1 leaf -1) 0,0 0,5 1,0 1,5 2,0 2,5 3,0 3,5 Camalexin (ng m l -1 leaf -1) Aad (ng ml -1 leaf -1) Lys (ng m l -1 leaf -1) Phe (ng ml -1 leaf -1) 

http://doc.rero.ch

(7)

2

Mean values are given in ng ml-1exudate leaf-1± SD from at least three replicate samples.

Asterisks denote statistically significant differences between P. syringae- and MgCl2 -samples (***: P < 0.001; **: P < 0.01; *: P < 0.05; two-tailed t test). The corresponding values for Pip are depicted in Fig. 3D.

(A)D-Amino adipic acid (Aad). (B) Lysine. (C) Phenylalanine. (D) Free salicylic acid (SA). (E) Conjugated salicylic acid (SAG). (F) Methyl salicylate (MeSA). (G) Azelaic acid (AZA). (H) Jasmonic acid (JA). (I) Camalexin.



(8)

0 1 2 3 4 5 6 0 50 100 150 200 250

A

B

Col-0 ald1 lkr-1 lkr-2 Relative ALD1 ex pr ess ion Relative LKR ex pr es sion MgCl2 Psm MgCl2 Psm

C

Relative ALD1 expre ssio n in 2° leave s

Col-0 fmo1 ald1

1° leaves: MgCl2 1° leaves: Psm * 0 5 10 15 20 25 Col-0 ald1 lkr-1 lkr-2 *** *** *** *** *** ***

Supplemental Figure 6. Pathogen-induced ALD1 and LKR expression in wild-type Col-0 and different mutant plants.

(A) and (B) Psm-induced ALD1 (A) and LKR (B) expression in inoculated leaves of Col-0,

ald1, lkr-1 and lkr-2 plants at 24 hpi.

(C) Relative expression of ALD1 in upper (2°) leaves upon Psm-inoculation of lower (1°) leaves (2 dpi).

Transcript levels were assessed and data analyses were performed as described in the legend to Fig. 4A.



(9)

0 2 4 6 8 10 12 0 1 2 3 4 5 6 7 8 Leaf content (˜g g -1 FW)

Pip Aad Lys

*** * * 0 50 100 150 200 250 BABA 0 4 8 12 16 *** H2O 10 ˜mol BABA Soil application

Pip leaf cont

ent (˜ g g -1 FW) H2O 10 ˜mol Pip Soil application

A

D

Col-0 ald1 ** *** ° 0,0 0,5 1,0 1,5 2,0 2,5

B

H2O 10 ˜mol Pip Soil application Aad leaf cont en t (˜ g g -1 FW) Col-0 ald1 ** *** °° •

C

H2O 10 ˜mol Aad Soil application Leaf c ontent (˜ g g -1 FW) Pip Aad *** 0,0 0,2 0,4 0,6 0,8 1,0 1,2 1,4 1,6 1,8 

http://doc.rero.ch

(10)

(A) and (B) Exogenous pipecolic acid supplied via the root is transported to the shoot and leads to an enhancement of Aad levels. Leaf contents of Pip (A) and Aad (B) in Col-0 and

ald1 plants one day after supplying 10—mol Pip via the roots (as outlined in Fig. 5).

(C) Leaf contents of Aad and Pip in Col-0 plants one day after supplying 10 —mol Aad via the roots.

(D) BABA treatment induces Pip accumulation in Col-0 plants.

Leaf contents of BABA, Pip, Aad, and Lys one day after supplying plant pots with 10 —mol BABA. Mean values are given in—g g-1fresh weight (FW) ± SD from at least three replicate

samples. Asterisks denote statistically significant differences between samples from Pip-, Aad-, or BABA-fed and non-fed control plants (***: P < 0.001; **: P < 0.01; *: P < 0.05, two-tailed t test). In (A) and (B), open (closed) circles indicate statistically significant differences of a H2O- (Pip-) supplied ald1 sample to the H2O- (Pip-) supplied wild-type sample (two-tailed t test).



(11)

1 10 100 1000 10 100 1000 10 100 1000 1 10 100 1000 H2O D,L-Pip Bacterial numbers 3 dpi Psm (cfu cm -2 * 10 -4) L-Pip D-Pip

C

500 5000 5 ˜mol 10 ˜mol B ac ter ia ln um ber s 3 d pi Psm (cfu cm -2 * 10 -4) 0 0.1 1 10 0 0.1 1 10 ˜mol Pip Col-0 ald1 5000 *** *** *** *** 500 *** ***

D

B ac ter ial nu m ber s 3 d pi Psm (cfu cm -2 * 10 -4) H2O Pip Aad c Bacte ria lnumb ers 3 dpi Psm (cfu cm -2 * 10 -4) Pip leaf infiltration root application Bacterial numbers 3 dpi Psm (cfu cm -2 * 10 -4) s: H2O; 1°: MgCl2 s: Pip; 1°: MgCl2 s: H2O; 1°: Psm avrRpm1 s: Pip; 1°: Psm avrRpm1 Col-0 ald1

E

** *** ** * ** ns b a 1 10 100 1000 

http://doc.rero.ch

(12)

complementation of ald1 defects in Psm avrRpm1-induced SAR by exogenous Pip.

(A) Leaf resistance to Psm after application of 1 mM Pip via the root (as outlined in Fig. 5) or after infiltration into leaves. Bacterial inoculation was performed one day after Pip treatment.

(B) Concentration dependency of resistance induction by exogenous pipecolic acid in Col-0 and ald1 plants.

Plant pots were supplied with different amounts of D,L-Pip one day prior to inoculation. Experimental details were as outlined in the legend to Fig. 5. Asterisks denote statistically significant differences relative to the water control within each genotype (***: P < 0.001; two-tailed t test).

(C) Resistance-enhancing activity of L- but not D-Pip.

Indicated amounts of racemic D,L-Pip, D-Pip, or L-Pip were fed to plants one day prior to

Psm inoculation, and bacterial numbers were scored at 3 dpi. Details as described in the

legend to Fig. 5. Asterisks denote statistically significant differences relative to the water control (***: P < 0.001; two-tailed t test).

(D) Psm growth in upper leaves following SAR induction by Psm avrRpm1 in lower leaves one day after exogenous Pip or water treatments via the root. Experimental details were as described in Fig. 6A, except that incompatible Psm avrRpm1 instead of compatible Psm was used as the SAR-inducing pathogen.

(E) Col-0 resistance to Psm upon root application of water, 5 —mol L-Pip or 5 —mol L-Aad. Details as described in the legend to Fig. 5. Different letters above the bars denote statistically significant differences between pairwise compared samples (P < 0.05, two-tailed t test).



(13)

0 500 1000 1500 2000 2500 3000 3500 4000 4500 0,0 0,5 1,0 1,5 2,0 2,5 3,0 3,5 4,0 4,5 0 2 4 6 8 10 12 14 16 18 20

A

Pip (˜ g g -1FW) H2O SA 8 hpi 24 hpi *** Psm 24 hpi *

B

H2O SA ** ** H 2O SA ***

4 hpi 24 hpi 4 hpi 24 hpi

Relative ALD1 expre ssio n Relative PR-1 expression

Supplemental Figure 9. Effect of exogenous SA on leaf Pip levels, ALD1-transcript levels, and PR-1-transcript levels.

(A) Pip levels in leaves at indicated times after infiltration with water, 0.5 mM SA, or a suspension of Psm (OD 0.005). Details as indicated in the legend to Fig. 2.

(B) Relative expression of ALD1 and PR-1 in Col-0 leaves at indicated times after infiltration with water or 0.5 mM SA. Transcript levels were assessed and data analyses were performed as described in the legend to Fig. 4A.



(14)

Supplemental Table 1. Primers used in this study.

Primername Primersequence(5’to3’) Usage

ald1Ͳfw TTACGATGCATTTGCTATGACC GenotypingofTͲDNAlines

ald1Ͳrv TTTTAAATGGAACGCAAGGAG GenotypingofTͲDNAlines

lkrͲ1Ͳfw TCATTCTGCCTTCTCCATCAG GenotypingofTͲDNAlines lkrͲ1Ͳrv AGCAACAACGATATTTCGTGG GenotypingofTͲDNAlines lkrͲ2Ͳfw CGCTTCGATCATATCAAGAGC GenotypingofTͲDNAlines lkrͲ2Ͳrv CCCCTATGACTTTCTGTGCAG GenotypingofTͲDNAlines ALD1ͲFW GTGCAAGATCCTACCTTCCCGGC qRTͲPCR ALD1ͲRV CGGTCCTTGGGGTCATAGCCAGA qRTͲPCR LKRͲFW CATGTTGATGGGAAGAATCTC qRTͲPCR LKRͲRV AATATCGTTGTTGCTTCGCT qRTͲPCR FMO1ͲFW TCTTCTGCGTGCCGTAGTTTC qRTͲPCR FMO1ͲRV CGCCATTTGACAAGAAGCATAG qRTͲPCR PRͲ1ͲFW GTGCTCTTGTTCTTCCCTCG qRTͲPCR PRͲ1ͲRV GCCTGGTTGTGAACCCTTAG qRTͲPCR PTBͲFW GATCTGAATGTTAAGGCTTTTAGCG qRTͲPCR;referencegene PTBͲRV GGCTTAGATCAGGAAGTGTATAGTCTCTG qRTͲPCR;referencegene 

http://doc.rero.ch

Références

Documents relatifs