HAL Id: hal-01803484
https://hal-amu.archives-ouvertes.fr/hal-01803484
Submitted on 30 May 2018
HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
Alternative splicing and endoproteolytic processing generate tissue-specific forms of pituitary
peptidylglycine alpha-amidating monooxygenase (PAM).
Betty A. Eipper, C Green, T Campbell, D Stoffers, H Keutmann, R Mains, l’Houcine Ouafik
To cite this version:
Betty A. Eipper, C Green, T Campbell, D Stoffers, H Keutmann, et al.. Alternative splicing and
endoproteolytic processing generate tissue-specific forms of pituitary peptidylglycine alpha-amidating
monooxygenase (PAM).. Journal of Biological Chemistry, American Society for Biochemistry and
Molecular Biology, 1992, 267, pp.4008-4015. �hal-01803484�
0 1992 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in
U.
S.A.
Alternative Splicing and Endoproteolytic Processing Generate Tissue-specific Forms of Pituitary Peptidylglycine a-Amidating Monooxygenase (PAM)*
(Received for publication, August 27, 1991)
Betty A. EipperS, Cristina B.-R. Green, Tracey A. Campbell, Doris A. Stoffers, Henry T. Keutmann, Richard E. Mains, and L’Houcine Ouafik
From the Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205
The pituitary is a rich source of peptidylglycine a-
amidating monooxygenase (PAM). This bifunctional protein contains peptidylglycine a-hydroxylating
monooxygenase (PHM) and peptidyl-a-hydroxyglycine a-amidating lyase (PAL) catalytic domains necessary for the two-step formation of a-amidated peptides from their peptidylglycine precursors. In addition to the
four forms of PAM mRNA identified previously, three novel forms of PAM mRNA were identified by exam- ining anterior and neurointermediate pituitary cDNA libraries. None of the PAM cDNAs found in pituitary cDNA libraries contained exon A, the 315-nucleotide (nt) segment situated between the PHM and PAL do- mains and present in rPAM-1 but absent from rPAM- 2. Although mRNAs of the rPAM-3a and -3b type
encode bifunctional PAM precursors, the proteins dif- fer significantly. rPAM-3b lacks a 54-nt segment en- coding an 18-amino acid peptide predicted to occur in the cytoplasmic domain of this integral membrane pro- tein; rPAM-3a lacks a 204-nt segment including the transmembrane domain and encodes a soluble protein.
rPAM-5 is identical to rPAM-1 through nt 1217 in the PHM domain; alternative splicing generates a novel 3”region encoding a COOH-terminal pentapeptide fol- lowed by 1.1 k b of 3”untranslated region. The soluble rPAM-5 protein lacks PAL, transmembrane, and cy- toplasmic domains. These three forms of PAM mRNA can be generated by alternative splicing. The major forms of PAM mRNA in both lobes of the pituitary are rPAM-3b and rPAM-2. Despite the fact that anterior and neurointermediate pituitary contain a similar dis- tribution of forms of PAM mRNA, the distribution of PAM proteins in the two lobes of the pituitary is quite different. Although integral membrane proteins simi- lar to rPAM-2 and rPAM-3b are major components of anterior pituitary granules, the PAM proteins in the neurointermediate lobe have undergone more exten- sive endoproteolytic processing, and a 75-kDa protein containing both PHM and PAL domains predominates.
The bifunctional PAM precursor undergoes tissue-spe-
* This work was supported by National Institutes of Health Grant DK-32949 and National Institute on Drug Abuse Grants DA-00266, DA-00097, and DA-00098. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
to the GenBankTM/EMBL Data Bank with accession number(s) The nucleotide sequence(s) reported in thispaper has been submitted M82845.
$ To whom correspondence should be addressed Rm. 902, Wood Basic Science Bldg., Dept. of Neuroscience, The Johns Hopkins University School of Medicine, 725 North Wolfe St., Baltimore, MD 21205. Tel.: 410-955-6937; Fax: 410-955-0681.
cific endoproteolytic cleavage reminiscent of the proc- essing of prohormones.
The pituitary is one of the richest sources of peptidylglycine a-amidating monooxygenase (PAM; EC 1.14.17.3)’ in the adult rat (1,2). Immunocytochemical studies indicate that the highest levels of PAM protein are found in gonadotropes, but detectable levels of PAM protein are found in each of the major pituitary cell types (3). Although none of the major anterior pituitary hormones is a-amidated, several amidated peptides are synthesized in the anterior pituitary (4, 5). Fol- lowing thyroidectomy, levels of PAM mRNA in the anterior pituitary rise severalfold, along with levels of the mRNAs encoding several a-amidated peptides (5, 6). Intermediate pituitary melanotropes produce large amounts of two a-ami- dated products from proopiomelanocortin (a-melanocyte stimulating hormone and joining peptide) (4,7), and the major peptide products stored in the neural lobe (oxytocin and vasopressin) are a-amidated.
Peptide a-amidation involves a two-step reaction with a peptidyl-a-hydroxyglycine intermediate (8-12). The PAM precursor protein encodes both of the enzymatic activities involved in peptide a-amidation (13-15). The first enzyme, peptidylglycine a-hydroxylating monooxygenase (PHM), is contained within the NH2-terminal third of the rat PAM-1 precursor (Fig. 1) and catalyzes the copper, molecular oxygen, and ascorbate-dependent formation of peptidyl-a-hydroxygly- cine. The second enzyme, peptidyl-a-hydroxyglycine a-ami- dating lyase (PAL), follows the PHM domain and precedes the putative transmembrane domain; although spontaneous conversion of the a-hydroxyglycine intermediate into a-ami- dated product occurs at high pH, conversion at physiological pH values requires the action of PAL.
By screening an adult rat atrium cDNA library, we previ- ously identified four forms of PAM mRNA that arise from the single copy PAM gene by alternative splicing (Fig. 1) (16- 18). PAM mRNAs of the rPAM-1 type are the longest; re- moval of exon A gives rise to rPAM-2, and removal of exons A and B gives rise to rPAM-3. In rPAM-4, a unique 3”region replaces the sequence of rPAM-1 following exon A; as a result, rPAM-4 encodes only the PHM domain. Based on Northern blot analysis, the anterior and neurointermediate lobes of the rat pituitary lack large amounts of rPAM-1 type mRNA and The abbreviations used are: PAM, peptidylglycine a-amidating monooxygenase; PHM, peptidylglycine a-hydroxylating monooxy- genase; PAL, peptidyl-a-hydroxyglycine a-amidating lyase; PCR, po- lymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate-poly- acrylamide gel electrophoresis; nt, nucleotide(s); bp, base pair(s); kb, kilobase pair(s).
4008
Pituitary PAM 4009
r P A M - 3
0 I ooa
i X O " 4
I t
2 7 1 1 0, % 1 0 5 0
A T C W GPAAGGGAACC
rpAp1.3 I,eLyrC""""".~""""~~~.~~"""""""...""".~"...., YLyrClySer 2 7 9 1 2 9 9 6
rPAI1-la I i e i y p l \ - - - ~ p H I r * r p ~ ~ L y . L e u C L ~ l e r S e r S e r G l y A r q V ~ i i e u G i y ~ r q P h e l r g C l y L y r G l y S e r
*TCMAC---IITCITC~CCC~~~~~~~~~~~M~~~~~~~*~~~~~~~TG~~~~~~~~CGAGG~~G~AAG~
2 7 9 1
I ) T C I U L \ C M C C C C ~ ~ C C C ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ * ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ C A ~ A ~ A T G C ~
rPAn-3Q i l e L y . C l u i i l a C ; u l l l . Y a l Y a l C l u P r o L y r Y I l C l h ~ ~ ~ ~ ~ ~ ~ G l " L ~ " G l " L y ~ ~ ~ ~ G l "
C I I C L . 9 ~ C I \ G M I I C T G I ~ ~ ~ ~ * ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ G ~ T C T C ~ ~ ~ ~ ~ ~ ~ ~ C ~ ~ C T G G T r ~ r T C ~ ~ C l " L y l C l n L y r L e " S e r I h r C l u P r o G l y S e r C l y V . r l I l P P r o
2 1 9 s 3051
C T G C T C C I C C r G C T C C C C A I ~ ~ ~ ~ ~ ~ ~ ~ ? ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ M M ~ ~ ~ * ~ ~ G ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ - - - G ~ A C C C ~ C ~
~rTleV.inpfPhe!leRrqTrpLy.I.y.Ser~ii9birPhe6ly5-LylyrCly*er
FIG. 2. Alternative splicing in the exon B region: rPAM -3a and -3b. The nucleotide and amino acid sequences of rPAM-3a and -3b in the region previously referred to as exon B are shown; the remainder of the sequence is identical to that of rPAM-2 (16, 18).
Paired basic amino acids are boldface; amino acids in the putative transmembrane domain are underlined.
instead contain PAM mRNAs smaller than those found in the atrium (2). Reverse transcription coupled to the polym- erase chain reaction using oligonucleotide primers spanning most of the protein coding region of rPAM-1 demonstrated that the forms of PAM mRNA in the anterior and neuroin- termediate lobes of the pituitary were similar to each other and included forms in addition to those characterized in adult atrium (18). By constructing and screening anterior and neu- rointermediate pituitary cDNA libraries, we were able to identify three additional novel forms of PAM mRNA.
While rPAM-1 and -2 mRNA encode PAM proteins with a signal sequence and a putative transmembrane domain near their COOH terminus, the proteins encoded by rPAM-3 and -4 mRNA lack a transmembrane domain (17, 18). Despite a similar distribution of forms of PAM mRNA in the anterior and neurointermediate lobes of the pituitary, the majority of the PAM activity in the neurointermediate lobe is soluble, whereas equivalent amounts of soluble and membrane-asso- ciated PAM activity are found in the anterior pituitary (2, 19). In this study, the major forms of PAM protein in the anterior and neurointermediate lobes of the pituitary were identified using antipeptide antibodies. In addition to tissue- specific alternative mRNA splicing, PAM proteins are subject to tissue-specific endoproteolytic processing.
MATERIALS AND METHODS AND RESULTS*
Identification of Novel rPAM cDNAs in Pituitary cDNA Libraries-cDNA libraries prepared from rat neurointerme- diate and anterior pituitary poly(A)+ RNA were screened with cDNA probes spanning the sequence of rPAM-1 (Fig. 1). Two novel types of PAM cDNA, rPAM-3a and rPAM-3b, were identified by characterizing PAM cDNA inserts from the neurointermediate pituitary library (Fig. 2). Inserts of each type were sequenced and found to represent additional splic- ing variants. cDNAs of the rPAM-3b type (Intl2) differed from rPAM-2 only by the deletion of a 54-nt segment corre- sponding to the final 54 nt of the 258-nt region referred to as exon B. cDNAs of the rPAM-3a type (Int22) differed from rPAM-2 only by the deletion of the first 204 nt of exon B.
Analysis of the gene encoding rat PAM indicates that the region previously referred to as exon B is composed of two exons: a 204-nt exon (exon B.) is situated approximately 3000 nt upstream of a 54-nt exon (exon Bb) (25). Exon Bh corre-
* Portions of this paper (including "Materials and Methods," part of "Results," and Figs. 1, 4,5, 7, and 8) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are included in the microfilm edition of the Journal that is available from Waverly Press.
sponds exactly to the 54 nt deleted from bPAM-1 (originally called APAM-1) to form bPAM-2 (XPAM-5) (24).
The 853-amino acid rPAM-3b preproprotein has a predicted molecular weight of 94,721 (PI 5.76) and lacks an 18-amino acid peptide predicted to reside in the cytoplasmic domain of rPAM-2 (Fig. 2). The deleted 2115-dalton peptide (PI 10.83) is extremely hydrophilic and includes a pair of basic amino acids (Arg903-LysSo4; amino acid positions are all numbered as for the protein encoded by rPAM-1). The 803-amino acid rPAM-3a preproprotein has a predicted molecular weight of 89,344 (PI 5.78) and lacks a 68-amino acid peptide present in rPAM-1 and -2; the deleted peptide consists of a hydrophilic domain followed by the hydrophobic 24-amino acid putative transmembrane domain and the subsequent Arg-Trp-Lys- Lys894 putative stop transfer signal. This 7492-dalton peptide has a PI of 9.06 and lacks Cys residues or potential N- glycosylation sites. Thus mRNAs of the rPAM-3b type would be expected to encode an integral membrane protein, whereas mRNAs of the rPAM-3a type would be expected to encode a soluble protein.
When the PAM containing cDNA inserts in the anterior pituitary library were subsequently examined, a novel type of PAM cDNA (Ant67, rPAM-5 type) was identified by virtue of its failure to hybridize with the cDNA probe from the 3'- third of rPAM-1 (Fig. 1). Upon sequence analysis, Ant67 was found to be identical to rPAM-1 from bp 247 through bp 1217 (bp 971 of Ant67) (Fig. 3). A novel 1.1-kb sequence followed;
this relatively AT-rich region (61% AT) did not terminate with a poly(A) tail but contained four consensus poly(A) addition signals (26, 27). The novel 3'-domain of Ant67 bore no resemblance to the novel 3"domain of rPAM-4 (18). The point of divergence of Ant67 follows amino acid Gly307 of rPAM-1; Ant67 encodes an additional pentapeptide before an in-frame stop codon is reached.
The 312-amino acid preproprotein encoded by Ant67 has a predicted molecular weight of 34,674 and a PI of 8.93. Follow- ing removal of the signal peptide, the protein encoded by Ant67 would have a molecular weight of 32,151; the Lys-Arg35 sequence following the putative propeptide is the only paired basic amino acid sequence in the protein encoded by rPAM- 5. Two cysteine residues and the - H i s - G l ~ - H i s - H i s ~ ~ ~ sequence postulated to play a role in the interaction of the PHM domain with copper are absent from the rPAM-5 protein. Transient expression of cDNA encoding rPAM-5 in human fibroblasts (hEK293) yielded expression of foreign protein but failed to yield PHM activity under the same conditions yielding PHM activity upon expression of cDNA encoding rPAM-4.
The presence of mRNAs of the rPAM-5 type in several tissues was demonstrated using reverse transcription and the polymerase chain reaction (Fig. 4). Levels of the amplified rPAM-5 specific product generated with cDNA from the various tissues mirrored total levels of PAM activity (2).
Based on its prevalence in atrial and pituitary cDNA libraries, rPAM-5 is not a major transcript and attempts to visualize rPAM-5 mRNA on Northern blots were unsuccessful. To eliminate the possibility that Ant67 was the result of a cloning artifact, the structure of this region of the PAM gene was investigated using the polymerase chain reaction (Fig. 5). The PHM exon terminating with nt 1217 is separated from the exon containing the unique 3'-end of rPAM-5 by an approx- imately 550-nt i n t r ~ n . ~ Thus mRNAs of the rPAM-5 type are the product of alternative splicing and are not generated by failure to remove the intron contiguous with nt 1217.
Comparison of PAM Proteins Found in Anterior and Neu- L'H. Ouafik, D. A. Stoffers, T. A. Campbell, R. C. Johnson, B. T.
Bloomquist, and B. A. Eipper, unpublished observation.
0
Ikh 2k
h1117 991 1243 1369 1495 1621 1747 1873 1999
H H X
1 I
1
A T A C T T T C h ' G A
990
hlet 'fhr llis Ile G I ? ['heLyr
AspThr
Phe*
312
G?GCMTTGGMGCT?GGGAGAAGA?ACAGMAG?GMGGTSA~ACAGMMAMGAGTTTTCAGMGAGTCGTGACTACGAACTAGGMCCACACTGGAGA~GAGAGAGGAAGGACAGGAGCAT AGAAGGCTGGAGAMAiCBCGTATTGACTTTCATMAGGMGATAGGACGATATATACACMTCACACTGCGTAGAGGGGACAGGCCGTGACCTCCGTGACAGTCTGTGACGCTTGGGGTT
T?GATGGAG??TTCA?AGATShTGCGrTTTCGTAGMGA~GGC~CTCCGTCTTACCTTMACTATCMTT?GTATCAMGMGAAGCTTTCMGTAGCATTCC:'AGTGTATTTGTTMATTTTTGG
TBBBCCCTTTCAGAGAGCTGCATGTAT-GATTTACMGCTCMGTGGGAGGCAGTAGAGTATTTTAnCCCCTCCAGGGCCTTCACCCTTTGGATAAGGGGGCATATTACACCCTTGGCCAGACTGTA CCACGGGGCAGAGAG-ATTGArCAGCTGCCCTCTGTTCGG?'GC'?CTTGTGTGGCCACAGGMCGGTAGTTMACGCCAGAGGTTATTCCGTTMCCTTTTCAGN\nGTMAGAATGTAGTTCAABB TCTGTGGAGGCA-iAACGGCTTGTTACAGTGCCAGMTGAG~CCGGAGTGGCCCCCAGAGATTTCTTCCGGGTTCATGAGTCTAGMTAATTCCAGCCTTTTTAMATTATACATTTTGCTTTA AMTGATACCCTAMATGAGGATATTACTCTATCCTTTCG?MCTCTCTGGTGAGATAAAGTAAACACTATTTTTMTACAGAGGAGATAGAA~GGGATTATGGCAMTTMGTTGTTGGATGAGT
C T G M T T ? T G M T G ? ~ ? A A l " ~ T A T A C ; ' A C T G T A T N \ A A C G A C ? A T h G ? T T T T T T C C A G A A G M T ~ C T A A T A A G G C A T G T T T G A T G ~ A T T T T T A T T A T G A T G C A~ATTATATATGCATATMTGTTTMTGTGCCTTTTMA?T?PGAMAAATACTGTCTACAGTGTTTCTGTGTTTTCTACMTAGCAGGTGTnCTCTCTCC
2096FIG. 3. Sequence of rPAM-5 type cDNA. The cDNA insert in Ant67 is drawn to scale with the region of identity to rPAM-1 shown by the filled bar and the new sequence shown by the open bar. The location of the initiator Met and the first in-frame Stop codon (*) are indicated. Characteristic restriction sites are shown: H, HindIII; X, XbaI. A cDNA probe specific for rPAM-5 was generated by using the fragment between the HindIII sites at 1001 and 1200 bp. The complete nucleotide sequence of the novel 1.1 kb 3"region of Ant67 is shown along with the pentapeptide sequence forming the novel COOH terminus of rPAM-5; the four consensus poly(A) addition signals are underlined.
B
AP NIL AP NIL AP NIL AP NIL AP NIL-
2053-
1 e- 105 I05 9 5 :97
-
95 8 4 .-
84 75"-a - -0-
7559-
45
.
42
.
Ant
moay.
PAL(564-582)
15- 14-
4- 0-
I-
-
28-
r*I " 1 1 7
-
97-
66PHM PHM PAL Exon Ba
(116-131) (293-515) (564-582) (842-859) (932-948)
C-term
-
45-
33FIG. 6. Comparison of PAM proteins in atrial, anterior, and neurointermediate pituitary secretory granules by Western blot analysis. A, a crude secretory granule fraction was prepared from adult rat anterior and neurointermediate pituitary and from adult rat atrium by differential centrifugation. The atrial and anterior pituitary samples each contained 20 pmol/h PAM activity (8.4 and 19.6 pg of protein, respectively); the neuroin- termediate pituitary sample contained 4 pmol/h PAM activity (15 pg of protein). The samples were visualized with PAL antibody (Ab69). B and C, a more concentrated preparation of crude pituitary granules was analyzed. Each sample of anterior pituitary granules contained 100
pgof protein (1150 pmol/h PHM activity; 3100 pmol/h PAL activity). Each sample of neurointermediate pituitary granules contained 97 pg of protein (420 pmol/h PHM activity; 2900 pmol/h PAL activity). Following transfer to Immobilon-P, blots were exposed to the PAM antibodies indicated; exposure times were adjusted to give bands of comparable intensity. The exon B. antibody (Ab26) was applied to blots that had been stripped; this antibody cross-reacts with several lower molecular weight proteins not thought to be related to PAM. The location of molecular weight markers analyzed in a separate lane are indicated on the right; apparent molecular weights of the various PAM proteins are indicated on the left.
rointermediate Pituitary-Despite the presence of similar forms of PAM mRNA in the anterior and neurointermediate lobes of the rat pituitary, previous studies indicated that membrane associated PAM was more prevalent in anterior pituitary than in neurointermediate pituitary extracts (2).
The PAM proteins found in any tissue reflect both the forms of PAM mRNA present and the co- or post-translational modifications that occur. The higher molecular weight PAM proteins in secretory granule-enriched fractions prepared from rat anterior pituitary, neurointermediate pituitary, and atrium were compared by Western blot analysis (Fig. 6A).
PAM proteins were visualized with affinity-purified rabbit polyclonal antibody to a peptide within the PAL catalytic domain. Granules from each tissue contained a distinctive collection of proteins recognized by the PAL antibody. As expected, atrial granules contained primarily intact rPAM-1
(120 kDa) and rPAM-2 (105 kDa) (28). Almost no protein the size of rPAM-1 was detected in anterior or neurointermediate pituitary granules. Both anterior and neurointermediate pi- tuitary granules contained a protein the size of rPAM-2. A characteristic set of smaller PAL proteins (95, 84, and 75 kDa) were present in both anterior and neurointermediate pituitary granules. The 75-kDa PAL protein was a major component of neurointermediate pituitary granules, whereas the 105-kDa PAL protein was more prevalent in anterior pituitary granules.
In order to investigate further the PAM proteins in pitui-
tary granules, much more concentrated aliquots of a different
preparation of anterior and neurointermediate pituitary gran-
ules were fractionated and visualized with antisera to syn-
thetic peptides from within the PHM, PAL, and COOH-
terminal domains of rPAM-1 (Fig. 6, R and C). A complex
Pituitary PAM 4011 pattern of PAM proteins was identified in secretory granules
from both tissues. Although PAM proteins of similar apparent molecular weight were detected in both anterior and neuroin- termediate pituitary granules, different forms of PAM protein predominated in anterior and neurointermediate pituitary granules.
Anterior pituitary granules contain a set of PAM proteins cross-reactive with antisera to peptides within both the PHM and PAL catalytic domains (Fig. 6B). The most prominent bands had molecular masses of 105 k 3 kDa, 95 f 3 kDa, and 75 f 3 kDa; minor and somewhat variable amounts of an 84 f 3 kDa protein detected by PHM and PAL antisera were also present. In contrast, a 75 kDa PAM protein was the major PAM protein found in neurointermediate pituitary granules; only minor amounts of a 105-kDa PAM protein were present. The same set of higher molecular weight pro- teins were visualized by antiserum to a peptide closer to the NH, terminus of P H M (rPAM(116-131)) (Fig. 6B). Although a number of smaller PHM and PAL proteins were visualized in secretory granules from both regions of the pituitary, no proteins smaller than 75 kDa were visualized by antisera to both PHM and PAL (Fig. 6B). PHM proteins of 44-45 kDa were visualized with varying intensity by both PHM antisera.
The 42-kDa protein visualized by antibody to rPAM(116- 131) was not visualized as well by antibody to rPAM(293- 315); the 59-kDa protein visualized by antibody to rPAM(293- 315) was not visualized by the other PHM antibody, and its relationship to PAM is unclear. Small amounts of PAL pro- teins of approximately 50 kDa were visualized in both anterior and neurointermediate pituitary granules.
In order to aid in identification of the various PAM pro- teins, the same samples were visualized with antisera to peptides contained within exon B, and the COOH-terminal cytoplasmic domain of rPAM-1 (Fig. 6C). Antibody to exon B, visualized the 105-kDa PAM protein, but not the 75-kDa PAM protein in the anterior pituitary granule preparation;
adequate evaluation of the cross-reactivity of the 95-kDa PAM protein(s) requires separation of soluble and membrane proteins. The COOH-terminal domain antibody detected 105- and 95-kDa PAM proteins, but not the 75-kDa PAM protein.
Since all of the PAM mRNAs encoding both PHM and PAL also encode this COOH-terminal determinant, the 75-kDa PAM protein must arise from precursor forms of PAM (rPAM-1, -2, -3a, -3b, or -3) by endoproteolytic cleavage. In the neurointermediate pituitary granules, an approximately 28-kDa protein was visualized by the COOH-terminal domain antiserum; it is not yet clear whether this protein is derived from PAM.
The 105-kDa PAM protein is found in anterior pituitary membranes washed with 0.1 M Na2C03 to remove peripheral proteins and is thought to represent rPAM-2 and -3b (Fig. 7).
Small amounts of a 95-kDa PAM protein lacking COOH- terminal antigenic determinants are also found associated with the membranes and may represent a processed form of these proteins. Neurointermediate pituitary membranes also contain small amounts of a 105-kDa PAM protein (Fig. 8B).
The soluble fraction of anterior pituitary secretory granules contains large amounts of both the 75-kDa PAM protein recognized by antisera to PHM and PAL and the monofunc- tional 44-45 kDa P H M protein (Fig. 8A). The 95-kDa PAM protein found in the soluble fraction is recognized by antisera to the COOH-terminal domain and is thought to represent intact rPAM-3/3a. Very little monofunctional PAL protein is found in the soluble fraction of anterior pituitary granules.
DISCUSSION
A single complex gene encodes PAM in the rat (25, 29).
The functional consequences of expressing the seven different forms of PAM mRNA identified in the Sprague-Dawley rat (16-18) are significant. Five of the mRNAs encode bifunc- tional PAM proteins, with three of the mRNAs encoding PAM proteins with a transmembrane domain and two encod- ing soluble bifunctional proteins (Fig. 9). Rat PAM-4 mRNA encodes a soluble form of PHM (18). Rat PAM-5 mRNA encodes only part of the PHM domain and current studies indicate that rPAM-5 is inactive; this observation is consist- ent with the fact that the protein encoded by rPAM-5 does not include the entire region of homology to dopamine p- monooxygenase (30). The importance of synthesizing an in- active truncated PHM protein is unclear; alternative splicing generates a n inactive form of glutamic acid decarboxylase that is expressed at high levels early in embryonic brain development (31).
We previously demonstrated the tissue-specific expression of different forms of PAM mRNA, thus atrium contains primarily rPAM-1 and -2 mRNA, whereas little rPAM-1 mRNA is found in the pituitary (2, 18). In this study, the anterior and neurointermediate lobes of the Sprague-Dawley rat pituitary were found to contain a very similar collection of PAM mRNAs; mRNAs of the rPAM-2 and -3b type were the most prevalent, with less rPAM-3, -3a, and -1 and very small amounts of rPAM-4 and -5. Despite the presence of similar forms of PAM mRNA, the PAM proteins found in the anterior and neurointermediate lobes of the pituitary differ.
Thus both alternative splicing and post-translational process- ing contribute to the tissue specific production of proteins derived from PAM.
When exon A is absent, no paired basic potential endopro- teolytic cleavage site separates the PHM and PAL domains.
Exons B. and Bb separate the PAL catalytic domain from the COOH-terminal region; this COOH-terminal region forms the cytoplasmic domain of rPAM-1 and -2. Exon B, contains the transmembrane domain and its stop transfer signal, whereas exon Bb contains a pair of basic amino acids (Argso3-Lysgo4).
The fact that exon Bb corresponds exactly to the 54-nt region distinguishing two forms of bovine PAM mRNA (24) suggests that it may have functional significance. The peptide encoded
PHM PAL RK RK RK ~PraPAM. predicted ~ i ~p! ~ i ~ h t
PAM-1 106 K 5.65
P A M - 2
9 4 K 5.79
PAM-3b 92 K 5.66
PAM-3a 87 K 5.69
rPAM-3
R
8 5 K 5.55rPAM-4
-
10oannno A acidsf
55 K 32 K 6.43 8.22FIG. 9. PAM proteins. The proteins encoded by each type of
PAM mRNA are drawn to scale with the signal peptide (cross-
hatched), putative transmembrane domain (filled box), exon Bb
(lightly stippled), remainder of the COOH-terminal domain (darkly
stippled), and potential paired basic amino acid endoproteolytic cleav-
age sites (K = Lys, R = Arg) and N-glycosylation sites (irregular
enclosed shape) indicated. Predicted molecular weights and isoelectric
points (PI) of the nonglycosylated proproteins are shown. Arrows,
endoproteolytic cleavage site thought to be used in the production of
the 75-kDa PAM protein from rPAM-2, -3b, -3a, and -3.
by exon BI, could perform different functions when expressed as part of rPAM-2 and rPAM-3a. In rPAM-2 this peptide forms part of the cytoplasmic domain and might affect intra- cellular routing of PAM. For example, the ligand-mediated internalization of the FcR,, receptor is governed by the pres- ence or absence of a 47-amino segment in its COOH-terminal domain (32). In rPAM-3a the exon Bt, peptide should be situated within the secretory granule; in this location it could serve as a paired basic endoproteolytic processing site.
Several other laboratories have characterized PAM mRNAs from other tissues or other species. Type A and Type B PAM cDNAs were isolated from a rat medullary thyroid carcinoma cDNA library (33); except for minor differences, the type A cDNA is identical to rPAM-3b (it lacks the 315 bp of exon A and the 54 bp of exon Bb). The Type B cDNA is essentially identical to rPAM-1 until a point close to the 3’-end of exon B,; a 3-bp insertion is followed by 47 bp of exon Bb. The sequence of the Type B cDNA then diverges completely from rPAM-1; a stop codon is reached 55 amino acids after the transmembrane domain and the 3”untranslated region is extremely purine-rich (33). No PAM cDNAs with a 3’-end resembling that of Type B PAM cDNA were identified in the PAM cDNAs examined from our atrial and pituitary libraries.
Five types of PAM cDNA were identified in libraries pre- pared from the pituitaries of adult Wistar rats (29); the five forms arise via alternative splicing at the regions referred to in this study as exons A, B,, and Bb. Unexpectedly, different forms of PAM mRNA were found to be prevalent in Sprague- Dawley and Wistar rat pituitaries. As found previously in bovine pituitary (24), PAM cDNAs retaining exon A were prevalent in libraries prepared from Wistar rat pituitary (29);
in contrast, PAM cDNAs retaining exon A were rare in libraries prepared from Sprague-Dawley pituitary. The scarc- ity of PAM mRNAs of the rPAM-1 type in Sprague-Dawley rat pituitary was confirmed by Northern blot analysis (2), reverse transcription coupled with polymerase chain reaction (18), and Western blot analysis of the PAM proteins present (Figs. 6 and 7). Differences between Sprague-Dawley and Wistar rats were not confined to the exon A region. Using an RNase protection assay the most prevalent form of PAM mRNA in the Wistar rat pituitary was found to lack exon B, and retain exon Bh (29); in the Sprague-Dawley rat this was the least prevalent splicing pattern. Forms of PAM mRNA retaining exon B, and lacking exon Bb were prevalent in the Sprague-Dawley rat and rare in the Wistar rat. Although PAM mRNAs encoding the transmembrane domain predom- inate in Sprague-Dawley rat pituitary (rPAM-2 and -3b), the major form of PAM mRNA in the Wistar rat pituitary lacks a transmembrane domain (29). Although we searched for forms of PAM mRNA retaining exon A and lacking exon B, and/or exon Bb, none were found. Comparison of the genes encoding PAM in Sprague-Dawley and Wistar rats may clar- ify the reasons for these differences.
Although PHM and PAL are active as independent soluble enzymes, and also active when part of a bifunctional mem- brane-associated protein (28), secretion of PHM and PAL along with the secretory granule content requires an endopro- teolytic cleavage to separate the PAL domain from the trans- membrane domain in forms retaining exon B,. Secretion of the proteins encoded by rPAM-3, -3a, -4, and -5 requires no endoproteolytic cleavages subsequent to signal peptide re- moval.
PAM undergoes tissue-specific endoproteolytic processing, with more extensive endoproteolytic processing of PAM oc- curring in the neurointermediate lobe. The only major integral membrane protein form of PAM seen in the anterior pituitary
is a 105-kDa doublet likely to represent rPAM-2 and -3b; very little of this 105-kDa PAM protein is found in the neuroin- termediate lobe. Small amounts of a 95-kDa PAM protein detected in anterior pituitary membranes appear to lack at least part of the COOH-terminal cytoplasmic domain. The 95-kDa PAM protein found in the soluble fraction is visual- ized by antisera to the COOH-terminal domain of rPAM-1 and is likely a combination of rPAM-3/3a. The major soluble 75-kDa PAM protein observed in both anterior and neuroin- termediate pituitary granules lacks antigenic determinants for exon B, and the COOH terminus of rPAM-1 and could be derived from rPAM-2, -3, -3a, or -3b by endoproteolytic cleavage a t one of the two paired basic amino acid sequences following the PAL domain. In CA-77 cells, processing at Lys- Lyse2* is thought to generate a soluble 75-kDa PAM protein from rPAM-3b (Type A); the PAM protein containing the peptide encoded by exon A (Type B mRNA) is cleaved to form 41- and 43-kDa proteins (33, 34). If endoproteolytic processing events generate the 58- and 44-45-kDa PHM products from rPAM-2, -3, -3a, or -3b, the cleavages must occur a t nonpaired basic sites. Alternatively, the smaller PHM proteins could represent products of rPAM-4 and rPAM-5 mRNAs. No major membrane-associated processing products were detected with antisera to exon B, or the COOH-terminal domain of rPAM-1. Biosynthetic labeling of cells expressing individual forms of PAM mRNA will be required to delineate the steps involved in processing.
We now have information on the endoproteolytic process- ing of PAM in several tissues. In the atrium, both PAM and pro-atrial natriuretic factor are stored in a largely unprocessed form; primary cultures of neonatal atrial myocytes cleave proANF at the time of secretion and also secrete large amounts of PHM and PAL activity, indicating that endopro- teolytic cleavage of the PAM precursor must occur (35, 36).
The endoproteolytic processing of PAM in the neurointer- mediate lobe of the pituitary is more extensive than that observed in the anterior lobe. The endoproteolytic processing of proopiomelanocortin is also much more extensive in the intermediate than in the anterior lobe of the pituitary. Given that the extent of PAM processing correlates with the extent of endogenous preprohormone processing, one wonders whether similar endoproteases are involved in processing PAM and its prohormone substrates. The tissue-specific en- doproteolytic processing of PAM resembles the tissue-specific processing of prohormones; instead of generating sets of bioactive peptides, various forms of active enzyme are created.
Acknowledgments-We would like to thank Richard Johnson and Eileen Katsimpiris for assistance in the experiments.
REFERENCES
1. Sakata, J., Mizuno, K., and Matsuo, H. (1986) Biochem. Biophys.
2. Braas, D. M., Stoffers, D. A., Eipper, B. A., and May, V. (1989) 3. May, V., Ouafik, L. H., Eipper, B. A., and Braas, K. M. (1990) 4. Mains R. E., and Eipper, B. A. (1990) Trends Endocrinol. Metab.
5. O’Halloran, D. J., Jones, P. M., and Bloom, S. R. (1991) Mol.
6. Ouafik, L. H., May, V., Saffen, D. W . , and Eipper, B . A. (1990) 7. Eipper, B. A., Park, L., Keutmann, H. T., and Mains, R. E. (1986) 8. Bradbury, A. F., and Smyth, D. G. (1987) Eur. J. Biochem. 169, 9. Young, S. D., and Tamburini, P. P. (1989) J . Am. Chem. SOC.
Res. Commun. 140,230-236 Mol. Endocrinol. 3,1387-1398 Endocrinology 1 2 7 , 358-364 1,388-394
Cell. Endocrinol. 7 5 , C7-Cl2 Mol. Endocrinol. 4 , 1497-1505 J . Biol. Chem. 261,8686-8694 579-584
1 1 1,1933-1934
Pituitary PAM 4013
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Suzuki, K., Shimoi, H., Iwasaki, Y., Kawahara, T., Matsuura, Y., Katapodis, A. G., Ping, D., and May, S. W. (1990) Biochemistry Tajima, M., Iida, T., Yoshida, S., Komatsu, K., Namba, R., Yanagi, M., Noguchi, M., and Okamoto, H. (1990) J. Biol.
Chem. 265,9602-9605
Perkins, S. N., Husten, E. J., and Eipper, B. A. (1990) Biochem.
Biophys. Res. Commun. 1 7 1 , 926-932
Eipper, B. A., Perkins, S. N., Husten, E. J., Johnson, R. C., Keutmann, H. T., and Mains, R. E. (1991) J . Biol. Chem. 2 6 6 , Kato, I., Yonekura, H., Tajima, M., Yanagi, M., Yamamoto, H., and Okamoto, H. (1990) Biochem. Biophys. Res. Commun. 172, Stoffers, D. A., Green, C. B.-R., and Eipper, B. A. (1989) Proc.
Stoffers, D. A., and Eipper, B. A. (1989) ICSU Short Rep. 9 , 1 2 0 Stoffers, D. A., Ouafik, L. H., and Eipper, B. A. (1991) J . Biol.
May, V., Cullen, E. I., Braas, K. M., and Eipper, B. A. (1988) J . Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. N ~ t l . Fujiki, Y., Hubbard, A. L., Fowler, S., and Lazarow, P. B. (1982) Ouafik, L. H., May, V., Keutmann, H. T., and Eipper, B. A.
Grunfeld, C., Shigenaga, J. K., Huang, B. J., Fujita-Yamaguchi, and Nishikawa, Y. (1990) EMBO J . 9,4259-4265
26,6115-6120
7827-7833
197-203
Natl. Acad. Sci. U. S. A. 8 6 , 735-739
Chem. 266,1701-1707 Biol. Chem. 263, 7550-7554 Acad. Sci. U. S. A. 74, 5463-5467 J. Cell Biol. 9 3 , 97-102
(1989) J . Biol. Chem. 264, 5839-5845
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
Y., McFarland, K. C., Burnier, J., and Ramachandran, J. (1987) Endocrinology 12 1,948-957
Eipper, B. A., Park, L. P., Dickerson, I. M., Keutmann, H. T., Thiele, E. A., Rodriquez, H., Schofield, P. R., and Mains, R. E.
(1987) Mol. Endocrinol. 1 , 777-790
Ouafik, L. H., Stoffers, D. A., Campbell, T. A., Bloomquist, B.
T., and Eipper, B. A. (1991) Endocrinology 1 2 8 , 106 (Abstr.
302)
Proudfoot, N. (1991) Cell 6 4 , 671-674
Wickens, M. (1990) Trends Biochem. Sci. 15,277-281
Husten, E. J., and Eipper, B. A. (1991) J . Biol. Chem. 2 6 6 , Kato, I., Yonekura, H., Yamamoto, H., and Okamoto, H. (1990) Southan, C., and Kruse, L. I. (1989) FEBS Lett. 2 5 5 , 116-120 Bond, R. W., Wyborski, R. J., and Gottlieb, D. I. (1990) Proc.
Miettinen, H. M., Rose, J . K., and Mellman, I. (1989) Cell 58, Bertelsen, H. H., Beaudry, G . A., Galella, E. A., Jones, B. N., Ray, M. L., and Mehta, N. (1990) Arch. Biochem. Biophys.
Beaudry, G. A., and Bertelsen, A. H. (1989) Biochem. Biophys.
Thiele, E. A,, Marek, K. L., and Eipper, B. A. (1989) Endocrinol- Needleman, P., Blaine, E. H., Greenwald, J . E., Michener, M. L., Saper, C. B., Stockmann, P. T., and Tolunay, E. (1989) Annu.
Rev. Phurmcol. Tonicol. 2 9 , 23-54 17004-17010
FEBS Lett. 269,319-323
Natl. Acad. Sci. U. S. A. 87,8771-8775 317-327
279,87-96
Res. Commun. 163,959-966 ogy 1 2 5 , 2279-2288
SUPPLEMENTARY MATERIAL T O Ailemalive Splicing and Endoproteoiytic Procesing Generate
TIuu~ Specilic Forms 01 Phitary PAM
BeW A Eipper, Criatlna B:R. Green. Tracay A Campbe.ii, Doris A stoners, Henry T. Kaulmann, R i m r d E. Mains, L'Houdne Oualik
WERIALSAND METHODS
RNA (173 pg) was prepared Irom the neurointermsdiate lobes 01 65 adult male Spragus Dawiay rat pkuitaries. Poiy(A)+ RNA (1.2 pg) was Isolated and used to synthesize cDNA with b f l i adaptors using the Pharmacia mRNA illoiation and cDNA synthesie kns. Ugation of 40% 01 me cDNA to 1 pg bRi-digeated Lambda ZAP ii arms (Stratagene) and packaging with the Gigapack Gold
In
v&packaging kH (Strstagene) yielded 1.6xlo" piu. For screening. 300,000 phage Irom the unampiilied library were plated at a density 01 50,000 phage per 1 W m m plats. Triplicate lilts were sueeened with 3 random pdmed rsslrklion fragments spanning the aequence 01 ,PAM-1 (Fig. 1).
Anterior Pituitaw cDNA Librarlep. Total
SIG PHM PAL TMDCYT
rPAM-1
m i
Met 1000 2000 3000 4000 bp
I I
I t I
rPAM-1 -2
-3 A
-4
"""_.
Exon A
Exon B
(EcoRi) Psti
I
-
PSI1 BamHi Scai-
%aiFip.1. PAM sDNAs Identified
Charanerized lrom an atrial library are shown (16.18). Exons A and B are indicsted, as are the in Adull Rat Atrium. The struc1ure1101 the 4
t y p .
of ,PAM CONI\rPAM-1 cDNA hagments wed as probes to screen the pituitary libraries: &QRI (cloning site used
bp 22293190. Key leatures 01 the PAM protein are indicated lor orientation: Met. initiator in construction 01 i i b r a r y ) / ~ i , bp 117-355; &tllBamHI fragment, bpm-1602; -i/bl fragment,
methionine; SIG. signal peptide; PHM; PAL; TMD, transmembrane domain: CYT, cytoplasmic dsm&,Ago. termination codon.
01 the 63 positive plaques, the 38 yielding the moat intense signel were plaque purilled and 34 remained posi1ive. Twenty sewn 01 these phage were rescued using R4a) helper phage (stratagene): 8 01 the resultant plasmids contained inserts I e M than 1 kb in ienglh and were not lurther characterized. end 6 lacked identiflable Inserts. The 13 PAM positive plasmids were Compared by restriction analysis and by PCR using pairs 01 oligonucleotide primers spanning the sequence of rPAM-1. Two inserts were of the ,PAM-2 type and 4 were 01 the rPAM-3 type. Seven cDNA inserts gave panerns differing from any 01 the known lormr 01 ,PAM and were subdivided
and the Sanger dideoxy chain termination method (20). sequenm information was oblained lor a into 2 types. rPAM-3a (1 Insert) and 3b (6 inserts). Using oilgonucieotlden derlved (ram rPAM-1
cDNA reprelienting the rPAM-3a (intu) and rPAM-3b (in112)
tvpe.
in112 was sequenced on 1 strand in its entirety and On both etrands over splice lunctionr i n m and inu6 @PAM-3 tvps) w e n s e q u e n d on both atrands over spiiw lunaions and at both ends.anterior pituitary and 3 r g poiv(A)+ RNA was used ea above lo synthesize cDNA packaging 01 36%
Poly(A)+ RNA (11.2 pg) was prepared horn 4CQ
w
total RNA from sduH male Sprag- Dawley rat 01 the material yielded a Lambda ZAP cDNA library containing 3.6 x 10' plu. in the first round ofwere Identified in 300,000 plu; 53 01 these remained positive through a second round 01 screening.
screening with the 1.3 kb Bji/&q Hi (35611682) rPAM cDNA probe (Flg.1). 110 posltlve phage
Eightwn were selected lor luriher charanerlzatlon; 7 were lost in the rescue slep and only 8 of the remaining 11 had cDNA inserts. Restriction mapping indicated that 1 was 01 the ,PAM-2
tvpe.
2 wore of the rPAM-3 me; 3 lei1 into the new cia88 delined by intlz @PAM-3b) and 1 Into the new class defined by intu (rPAM-3a). One plasmid (Ant67) contained a 2.1kb cDNA insert that tailedenyme analysis indicated that the insert was distinct from any of the previously characterized lo hybridize with a cDNA probe Irom the %region 01 ,PAM-1 ( & i / h i lragmenl; Fig.l): restrldion
rPAM CDNAS. An87 was sequenced on a single strand in the region identical l o ,PAM-1 and on both strands throughoul 11s novel 5"domain.
The greater prevalence 01 PAM wsnive phage nbwwed in the antnrior pituitary library compamd lo me neurointermsdlate Phltary library 1s consistent wnh tho higher IeveIs 01 PAM mRNA detected in the rat anterior pltunary by Northdm blot ~)nalysb (2). Simllar screedngs 01 atrial cDNA libraries yielded approximately 4 times as many po~itivo plaques as In the anterior pituitary (16). in both the anterior and neurointermediate pituitary libraries. almost hail 01 the PAM poSitive cDNA inserts examined were 01 the ,PAM-3b type; cDNA inserts corresponding lo ,PAM-3s were recovered least onen. No cDNA inserts retaining exon A wen Isolated I r m skhsr library.
4014 Pituitary PAM
eolvmeram chalu%?d!Qn. PCR was utllked to characterin the cDNA Inseris In phage or plasmlds and to evaluate the represenMIon 01 lorms 01 PAM cDNA In the llbrarlea Allquota 01
phage were heat denatured (5 mln, %? and wbjected to x ) ~ 25 w l w 01 PCR uslng 1 pH primer llmes r a n m from 2 mln lor plecsa smaller thsn 1 kb to 4 mln lor Me HItlre In& Products were (all were 17-mem) a0 described
(is).
Annealing temperalures were generally 52" and extension analyzed aner YIwalMIon with athldlum bromlde or after hanster to Nyiran and hybrldl2atlon wkh appropriate random primed cDNA pmbea In& Ienglh was datermlmd using T, and T, prlmsn and the torms of rPAM cDNA were determlned with prlmem spannlng exons A end B (18). cDNA was synthsslled Imm 2 . 5 pg total RNA uslng 1 pg ollgo(dT),,., (Phermacla) es primer and AMV R e v e m Transcriptase (Ute Sclenm) a0 descrlbed prevlously (IS). The amount. of cDNA from dlerent t l m e s utlllled for PCR were adjusted lo yield slgnals 01 comparable lntensitv (2).Ampllflcatlon of allquots 01 the cDNA llbrartes uslng the polymerase chaln reactlonand primer palrs spannlng exon A or exon B a h lndlcated that cDNA Inserts contalnlng exon A were ab&
lrom the neurolntsrmedlate plluiiary library and represented only a mlnW component of the anterior pllvnary Ilbrary. With prlmere spannlng exon 8. cDNA Inserls containing all 01 exon B (,PAM-1. ,PAM-2) or comspondlng to rPAM-3b predominated; cDNA inselts 01 the rPAM-3 tvpe were conelderably le89 prevalent. with cDNA Inserts 01 the rPAM-2a tvpe the Ieaat common.
Reverw bsnscriplon and amplnlcatlon by polymerase c b l n nactlonuslng primer parle spannlw exon A, exon B or both exon A and axon 8 also Indicated a predomlnanse of mRNAs of the *AM-2 and rPAM-3b
tVp..
with small amounts 01 rPAM-3 and llnle rPAM-38. The Yar!OUS wnys 01 estimating the prevalence 01 different PAM m R W all lndlcated that Me anterior and neumlntermedlate lobes 01 the pltvltary contain a slmllar mllectlon 01 lormaPnmratlon of Subwllular Fractions. For preparation 01 CCWM parllculate and soluble hadlonq lresh or I r o m t l m e s were homogenlrsd in 20 mM Na TES. pH 7.0, 10 mM mannitol (TESImannnol) mn(alnlng protease inhlbnwa (16 rs/ml bemsmldine, 10 pg/ml llma bean bVpsln Inhlbnor, 2 d m 1 larpspnn. 3 d m 1 phanqimethyiwnoqd flwrfde): aude petiiwlate and eolubls mKtlons werm pewred &er remonIol nucIsI and debria as desaiM
(2).
Periphnal membrane pmtelns were removed by washhg the membranes asquentlally wkh TESImsnnnol. TESlmannnol sonlalning 1 M W I . TESImannnol. 0.1 M Na,CO,, pH 115, and TESImannnol (21). TIfton X-100 (1%) was added to a11 parllculste hadions betore s m y m e assays were canled outA wcretory granule enrlched Iractlon was prepared from adult rat anterior and neurolntermediate pndtaries by homogenization In 20 mM Na TES. pH 7.0.025 M sucmse containing protease lnhlbltore ae a hand 20 pplml DNase I. A crude nuclear pellet was removed by wnhllugetlon at 1700 x g, lor 10 mln: crude mltochondrla were pelleted by CBnMIYgallOn at 1700 x g,for 10 mln; crude granulea/mlmsomes were pelleted together by wntrllvgatlon at
35S.ooO
x 9.. lor 15 mln. Where Indlcated. me granule and/or mlcmsome contents were asparated hom membranes by nwsp+nslon In 0.1 M Na,CO, (21); tollowing a 30 mln Incubation on Ice. carbonate washed granule/mlcroeoms membranes were pelleted end soluble contents were neu(rei2ledby addnlon 01 one tenth volume 2 M TES.paaava ot m e
sa&&.
PAM ectivnq was mwwred as desdbed using ['"IJ-PT~~-v~IGI~ and 0 5 pM DTyr-Vel-Gly at pH 85 Inme
prewncm 01 0 5 mM semriaafs and 5 pMCuSO.
(2.22); at pH8 5 the paptldyl..-hydrokyglqclne lntmedlate created by PHM is comltedInto wmldated produd nonamymatlwlly. PHM adlvlh, was measwed uslng ['"l]-a-N-sw~i.Tyr-V~I.Gly; the
=N.aceh,l-Ty-Val-~.~dmkyglyclne created by PHM wae wnverted Into e-amldated product by the addnlon 01 base at the end 01 the Incubation (14). PAL adlvRq was measured uslng ['"l]-o-N- acstyl.Tyr-Val~-hydroxVglyclne as wbstrate (14). Samples were aaaayed In dupllcats at two or blclnchonlnlc =Id S M a y uslng bovlnd s e N m albumln 0s standard (Plerce Chsmlcal
Co.,
Rocklord, more consenbl)(lons 01 protein. The proteln content of samples was determlned wlth the IL). Dupllcatw agreed wimln 5% and reacllon ratas were linear In proteln.fracllonaled on 10% p o w a m l d e , 025% N , N ' - m ~ l e n e b l s - ~ a m l d e SDS gels 0s dssaibed vlsuallrsd with CoomaMle Brtlllanl B I w R-250. Followlng dsatalnlng In memanol. the membrane (22). Protelns mn hanstsned ( m 0 mAmp for 4 h) to Immobllon9 membranes (Mllllpore) and was blocked by lncubatlon wlth 50 mM Trls HCI, pH 75.150 mM NaCI. 02% Tween-20.10 mplml bovine S0Nm albumln and then lmubated with MinHy purllled antlbodq diluted In blocklng buWer Allquola contslnlng known am,ounts of pmtsln and emyme ectivnq were
anher wernigM at 4' or for 2-3 h at mom tempsralure. Aner washlng, bound antlbodq was vlsuallled by Incubation whh io"spmlml ['nl)-Proteln A (ICN) in 50 mM Tris HCI. pH 75, 150 mM NaCI. 0.2% Tween-20.25 mplml W n e M N m albumb tor 2 h at r w m temperature. In eartler sx!mrlments. bound antibody wae vlsuallrsd wlth alkallne phos+hatase coupled to goat antl-rebbn lmmunoglobulln as described (22). MoIecuIer welgM standard0 (myosln, #.@actosldase, anelwed In a separate lane. Prestalned o,-macmglobulln and Iumarase (Slgma Chsmlwl Co.) phosphorylase b, bovlne albumin. ovalbumln, carbonlc anhydrase; Sigma Chemical Co.) mn were Included In me standard to allow lmmedlata evaluation of transter Mlclennl; use 01 Prestalned standards (Rainbow, Amersham Corp.) lor molecular welgM determlnatlon gave sllgMly dlllarenl molecular welgM estlmatea All molecular welgM data presented warm derlvsd by cornpaarl to the unlabeled pmteln standards.
conjugated The polyclonal to soybean trypsin rabbit antlbodles lnhlbltor through uwd In thle study Its Cqs Include several ralsed resldues (Ab59.
Ab60. AbW.
to bPAM(2W-310) Ab0i0)(23);bPAM(288-310) 118s In the PHM domain and dlnera from rPAM(293-315) at 1 resldue. Two AMs); MIS peplde 1160 In the PAL domaln and dlnsra from rPAM(564-582) at 2 reslduea Antlsera antlbQdles were generated to bPAM(561-579) conlugated to hemoysnln wnh glutaraldehyde (W.
opecnlc to exon 8. were generated to rPAM(842a9) conlugated Io hemonlanln with glutaraldehyde (Ab%. Ab=). Redwtlon 01 non-specmc background wkh
Ab=
roqulndmplacsrnsnt of the normal blocklng solullon with 100 mM Na phosphate. pH 7.4.5% non-altdry mllk, 02% T*nen-20,0.02% NaN, (the turbld ealutlon was clari(led by cenmtylatlon bstwa use).
Antlssra to COOH-termInaI domaln of rPAM-1 were gsnerated to rPAM(932-948) linked to keyhole llmpa hemocpnln with glulsraldehyde. Mlpaptlde a n t l m w m Mlnilq
wrliled
uslng the appropriate p p t l d b n s l n (22). Preparation and &lnny purlflcatlon 01 antlbodq tow r "
bovine PAM A plus PAM B (Ab%) was as described M o r a (24). Anlnliy purnled anllbodles were uwd at a dllullon ot 1:100 except for Ab100. which was used at a dllutlon 01 1:300. SpecHlcNy was established by including the epproprlate peptlde
(io
pplml) during Incuballon of the blot wkh anllbody: using ['"l]-Proteln A lor vlwalMlon. the appearam of all bands was blocked In thls manner. Blots were stripped by IncuWIon In 0.2 M glyclne HCI. 0.05% Trilon X-100 at 80'for two 30 mln perlode and were then hybrldlzed wim emmer prlmary entlbdq as a h . EczSuLEP l i ~ l t a ~ PAM mRN& PAM4 mRNA could not be detected by Nmihem blot analysls 01 pnUltary RNPL Thsrewlsr e v e m transaiptlon-PCR was used to deledPAW5 m R M Duplicate IsmPIss of cDNA piepared hom various tlaawa were wyeaed to amplnlcatlon uslng primers common to PAM-i,-2,-3,-3s and -3b m R W or udng primers -Hit to m R N h 01 the rPAM-5
tvpe.
Amplnled pmducls 6erlved hom PAM mRNAs of the rPAM-5 tvpe were tound In each t l w .
0 I 2
4
kb8E5) t 8 E 1 9 rPAM-
I
" 8El I
* - - - *
8E22rPAM-5
hn A t r sunm s t r HYOO NIL Ant Plasmid Zero P r m r s
bD A i r Subm S t r HYPO N I L A n t P1asm:d Zero Prlrners
IO89
1281
3E5/ I9
BE1 1/22
Flg.4. Oetectlon of rPAM-5 mRNA bv RT-PC-. Reverse hansnlbed cDNA horn the N W e S lndlcated (Atr, atrlum; Subm. submaxillary gland: Str. strlalum; Hypo. hypothalamus; NIL neurolntermedlate pnuitanl;
M.
anterlor pnunary) was amplified using a pair 01 oligonucleotides common to rPAM-i,.2,-3,-3a,-3b and 4 (BE5iBE19) or a p a t 01 ollgonuclwtldes specilk to rPAM.5 (BElliBEP); edenslon t h e was 3 mln and number ot cqclw was 30. Appropriate plasmld conbo1s (io pg ZAP8 for BE5/8Ei9 and 10 pg Ant67 IW BEliIBEP) sewed as standards along with me blank The Isms amount 01 hpY( cDNA was used lor both primer palm: amounts were selected basad on Me prevalsnse of tolal PAM mRNA In each ~IIYUH, (Brae0 at 01.. I=). W.The location of the ollgonucleotlde primers usad la Indlcated.
M!&&.
Ethldium bromide Mined gela W . Soumem blots: the 1.3 kb pmbe dwlved from the PHM domaln (flg.1) wee uwd to detect the pmduds amplnled wlm BE5119 and the 0.2 kb pmb. derlved horn Anm7 (Flg.3) W e used to detndproduds amoilfled wlm B E i i m .These poMlbllltbs were dis(lngu1shed by amplnlcatlon 01 genomic DNA prepared from spragw Transcripts of the rPAM-5 type could arise by elternalive aplklng or by ratentlon of an lnbon.
Dawley ret llver with a sense ollgonucleotlde prlmar sltuated Immedlately p d i n g me polnt S I
whlch rPAM-5 diverges (BE39) palred with elther of two antisense ollgonucleotlde primem sltuated wnhln the nova1 3~saquenca 01 PAM-^ ( ~ ~ 2 3 . BEP) (FIg5). while bom pain 01 primera generated the expested produds when used to analyn me Anm7 plasmid (334 and 1170 bp.
respealvely). analysle 01 genomlc DNA yielded larger fragments (0.87 and 1.75 kb hagments.
contalnlng BE39 lrom the exon contalnlng the unique ?-end ot rPAM-5.
respealvely). These data lndlcate mat an appmxlmately 550 bp lnlron separates me PHM exon
