First global approach: Morphological and biological variability in a genetically homogeneous population of the European pilchard Sardina pilchardus (Walbaum 1792) in the North Atlantic coast

(1)

R E V I E W S

First global approach: morphological and biological variability in a genetically homogeneous population of the European pilchard, Sardina pilchardus

(Walbaum, 1792) in the North Atlantic coast

Tarik Baibai^• Laila Oukhattar^•

Javier Vasquez Quinteiro ^•Abdelhakim Mesfioui^• Manuel Rey-Mendez^•Abdelaziz soukri

Received: 29 December 2010 / Accepted: 6 May 2011 / Published online: 24 May 2011 ÓSpringer Science+Business Media B.V. 2011

Abstract

The European pilchard

Sardina pilchardus

represents the most commercially relevant fisher- ies resource in many countries bordering north Atlantic coasts and the Mediterranean Sea, being especially significant along the coast of Morocco. The continuous exploitation of this pelagic species for several decades places Morocco as the leader in sardine production. However, the conditions of exploitation of this resource underwent a great change during the last recent years. In order to identify the populations of the European pilchard sardine (Sardina

pilchardus, Walbaum, 1792) in the Atlantic coast of

Morocco and Spain, we have combined the truss

network data to conduct multivariate analysis with biologic parameters and genetic analysis based on Microsatellite and mitochondrial control region data.

Sardine morphometrics data truss variables from 10 samples spanning the Atlantic coast of Morocco were analysed by multivariate analysis. Thirteen morpho- metric measurements and some biological parameters such as the sex and the age of fishes were made for each individual. Discriminant analysis on size-cor- rected truss variables and cluster analysis of mean fishes shape using landmark data indicate, that the shape of north Moroccan sardines is distinct from the shape of sardines from south Morocco. However the analysis of the mitochondrial region and four microsatellites loci (Sp2,

Sp7,Sp8

and

SpI5) demon-

strated an homogeneity population in the Moroccan Atlantic coast, with a low but significant genetic differentiation, which followed an isolation-by- distance pattern according to Mantel test.

Keywords Sardina pilchardus

Atlantic coast Morophometric analysis Microsatellite Mitochondrial DNA

Introduction

The study of the population structure of commer- cially important marine fishes is one of the theoretical interest to evolutionary biologists and of practical

T. Baibai (&)L. OukhattarA. soukri (&)

Laboratoire de Physiologie et de ge´ne´tique mole´culaire, Faculte´ des Sciences, Universite´ Hassan II, Aı¨n Chock.

Km 8 Route d’El Jadida, BP. 5366, Maˆarif, Casablanca, Morrocco

e-mail: baiman21@yahoo.fr A. soukri

e-mail: abdelazizsoukri@yahoo.fr

T. BaibaiJ. V. QuinteiroM. Rey-Mendez

Laboratorio de Sistema´tica Molecular, Dpto. Bioquı´mica e Bioloxıá Molecular, Facultade de Bioloxıá, Avda. Das Ciencias s/n, Campus Sur, 15782 Santiago de Compostela, A Corunã, Galicia, Spain

A. Mesfioui

Centre Re´gional de l’Institut National Recherche Halieutique, Laaˆyoune, Morrocco

DOI 10.1007/s11160-011-9223-9

(2)

value to fishery managers. The interpretation of population structure is largely influenced by the definition of ‘‘population’’ being used by the inves- tigator. In the broadest sense, fish populations can be defined from biological perspective, which implies some level of reproductive isolation, or from a fishery perspective, which concerns a practical description of a group of fish exploited in a specific area (Smith and Jamieson

1986). In either case, the number and the

level of discreteness of the populations are of primary concern.

The European sardine (Sardina pilchardus, Wal- baum 1792) is an important, pelagic fish specie with a wide distribution area in the Mediterranean Sea, and the north eastern Atlantic Ocean from the North Sea to Senegal (Parrish et al.

1989). Northern and

southern limits seem to be related to the average water temperature, being located within 10 and 20°C isotherm (Furnestin

1945). Adults usually swim close

to the littoral zone, and display daily vertical movement capacity (Whitehead

1985; Olivar et al.

2001). Spawning occurs in open waters and larvae

remain in plankton for long periods of time (Olivar et al.

2001). Nevertheless, several authors have

hypothesized that sardine distribution and abundance are dependent on the oceanographic regime (Barkova et al.

2001; Kifani 1998). High abundance, wide

geographic distributions, feeding/spawning/migra- tions and high catches in the commercial fishery are all associated with favourable ‘‘regimes’’ (Lluch-Belda et al.

1992; Schwartzlose et al.1999).

In the Morocco area off African coast, the fishery started in the 1950 . Landings peaked in the 1970 , declined in the 1980s and rose again in the 1990s to about 1 million tons per year (Kifani

1998). The

constant exploitation of this resource for several decades places Morocco as the leader of the sardine producer countries, but the myth of the existence of the inexhaustible resources, formerly maintained by the availability of easily exploitable sardine stocks, gives place nowadays to an awakening danger of fisheries collapse and even, population extinction.

The collapse of sardine stock in California in the 1950s, anchovy in Peru in the 1970s or cod in the Nord Atlantic Ocean since 1991, suggest the impor- tance of knowledge about the intimate link which unites the exploited populations.

Sardine was earlier separated into three stocks units in this area. However, recent studies stated that

only two populations are distributed in Moroccan waters, which can be distinguished by different growth rates and longevity characters (Barkova et al.

2001).In an attempt to differentiate sardine

populations, several methods were used separately, dated from the 1920s (Andreu

1969; Parrish et al.

1989), with most studies using univariate analyses of

meristic characters. Differences in mean vertebral counts and the cephalic index were studied from restricted geographic areas, being sardine length considered as the most appropriate index to differen- tiate populations. This analysis could only distinguish between sardine from the Atlantic continental shelf and those in the Mediterranean, and around Madeira and Canary Islands (Andreu

1969). Within the

Atlantic, the most widely accepted subdivision is based on the early vertebral count study of Fage (1920), which considers the existence of four sardine groups: the septentrional Atlantic group, distributed from the North Sea 57°N to the Cantabrian coast of Spain 43°N, the Iberian or meridional Atlantic group, distributed off the Spanish and Portuguese coasts from 43°N to 36°N, the Moroccan group, distributed from Cap Spartel 36°N to Cap Juby 28°N, and the Saharian group, distributed from Cap Juby to Levrier Bay 21°N (Parrish et al.

1989). Some recent studies

of the genetic analysis of mitochondrial region (Atarhouch et al.

2007) or microsatellite analysis

(Gonzalez and Zardoya

2007) revealed the presence

of only one specie of sardine throughout Atlantic coast and support the existence of a past genetic bottleneck.

In this work, we examined the population structure of sardine off the North Atlantic waters, mainly off the Moroccan coast, by a new approach including the study of morphometric and biologic parameters combined, with the analysis of powerful genetic markers, as microsatellites and analysis of the mitochondrial control region, and attempt to adopt a new plan of fisheries management in this area for this important commercial specie.

Materials and methods

Sampling

A total of 7 samples of sardine were collected during

the research cruise N/R of Dr. Fridtjof Nansen in the

(3)

period of (November–December 2006) at different locations along the continental shelf of Morocco, within an area between the Cap Blanc (21°N) and Cap Cantin (32°N), in addition we have added a sample from Casablanca (33°N), which was obtained from commercial vessels at the landing port from fisherman. Moreover samples from spanish coast used for microsatellite analysis and mitochondrial analysis were purchased in October 2008, from commercials vessels. The sampling location, geo- graphic information, and analysis type are presented in Table

1

and Fig.

1.

In these cases, samples were collected about 6 h after capture, but were kept in a good condition.

Samples were frozen soon after collection, and defrosted for analysis about 2 months later, to ensure that all fish were analysed following a similar period of freezing. Fifty animals were collected at each site, based on Reist’s (1985) recommendation that at least 25 animals must be used for morphological analyses.

All samples were collected strictly following species classification standards (Cheng and Zheng

1987).

Digital photographs were taken with a Nikon Coolpix 850 (image resolution: 28.3 pixels cm

^-1

) on the right side of each fish, and 10 landmarks were defined and recorded as body size coordinates. Landmarks were selected to provide a homogeneous coverage of the whole shape, but their homology and clarity in each fish were also taken into account. Thirteen morpho- logical measurements were made on each specimen following the Truss method, they consisted of 13

morphological distances between the 10 truss network landmark points plus standard length (SL). The morphological measurements were collected accord- ing to the method described by Elliott et al. (1995) and all landmarks were used to calculate body distances on a truss network (Strauss and Bookstein

1982). Truss

network of

Sardina pilchardus

is shown in Fig.

2.

Total length and biological parameters (sex, stage of sexual maturity, and age) were recorded for each photographed sardine. Macroscopic maturity was

Table 1 Sampling locations, Geographique informations and analysis type of Sardina pilchardus,belong the Atlantic coast of Morocco and Spain

Sample Population Abbreviation Sampling locations Number Analysis type

Morpho-biol Microsat mtDNA

1 Cap Blanc CAB 21°50 N 17°27 W 50 ? ? ?

2 Cap Barbas CAR 23°15 N 16°19 W 50 ? – –

3 Dakhla DAK 24°30 N 15°10 W 48 ? ? ?

4 Boujdor BOJ 26°38 N 14°02 W 50 ? ? ?

5 Tarfaya TAR 28°20 N 13°48 W 50 ? ? ?

6 Agadir AGA 30°30 N 09°80 W 50 ? – –

7 Safi SAF 32°28 N 09°20 W 48 ? ? ?

8 Casablanca CAS 33°20 N 08°35 W 40 ? ? ?

9 Ca´diz CAD 36°°60 N 04°25 W 30 – ? ?

10 Ma´laga MAL 36°50 N 06°70 W 30 – ? ?

11 Galicia GAL 42°20 N 08°80 W 38 – ? ?

Fig. 1 Locations of sampling sites of Sardina pilchardus in the Atlantic coast and Mediterranean Sea of Morocco and Spain

(4)

classified according to a five stage scales (Belveze

1984), which includes five stages of sexual maturity

for both sexes, as follows: stage I, immature; stage II, maturing or in resting phase; stage III, pre-spawning;

stage IV, spawning; stage V, post-spawning. Otoliths were extracted from each fish and the age was subsequently estimated using standard methods and criteria of ICES (1997) and the FAO (2001). Sagittae otoliths for age determination were selected from fishes already collected and archived, until to be reading by counting the number of alternating opaque and translucent increments in each otolith in binoc- ular loupe (age estimation). To examine the consis- tency of readings, a sample of 10% of the otoliths were read twice by a secondary otolith reader. All readings were conducted without reference to the size of the fish; date of capture, or to previous readings.

The simplest approach for obtaining estimates of proportions at age in each zone is the standard nonparametric age-length key (ALK) approach (FAO (2001). The size at first sexual maturity was estimated in both sexes applying the criterion of (L

_50%

), which represents the length at which 50% of the individuals were found to be mature (stage III, IV and V), using the logistic function model:

P=

100/1

?

e

^(a?b9L)

with P is the proportion of mature individuals in the size interval, and (a) and (b) are position coefficients of the above defined logistic function.

To remove size-dependent variation, data were adjusted prior to the analysis using the formula by

Elliott et al. (1995): M

_adj=

M(L

_S

/L

_o

)

^b

, where M is the original morphometric measurement, M

_adj

is the size adjusted measurement, L

o

the standard length of fish, and L

_S

the overall mean of standard length for all fishes from all samples and for each measurements.

The parameter b was estimated for each character from the observed data as the slope of the regression of log M on log L

_o

, using all specimens. Principal component analysis (FCA) was used, to remove the size effect from the shape measures and to determine the morphometric characters which contribute to the distinction of the groups, respectively.

A discriminating factorial analysis (DFA), was carried out using SPSS software V10.0 (Norusis

1997)

(SPSS Inc., Chicago, IL, USA), by groupings the stations in zones: zone A or Northern zone, has (Safi and Casablanca), zone B or central stock (Boujdor, Tarfaya and Agadir) and zone C or Southern region (Cap Blanc, Cap Barbas and Dakhla) according to fisheries division (FAO

2001). Discriminant function

analysis combines a selection of body measures in a linear fashion to produce a mathematical function that can be used to classify individuals into different groups. Individuals were assigned to their groups, and the percentage of correctly assigned fish was an additional measure of differentiation among stocks.

Multivariate analysis of variance (MANOVA) was carried out to test the significance of morphological differences.

DNA extraction

For each individual, a piece of muscle was stored in 80% ethanol. Total genomic DNA of analyzed specimens was extracted using a modified Kocher protocol (Kocher et al.

1989). Prior to extraction, the

ethanol was evaporated at ambient temperature from the muscle sample. Approximately 5 mm

³

of muscle tissue was incubated for 2 h at 65°C in 500

ll

extraction buffer (100 mM Tris HCl, 50 mM NaCl, 20 mM EDTA, 1% SDS), 2

ll b-mercaptoethanol

and 6 units of Proteinase K (Promega), followed by phenol–chloroform–isoamyl alcohol (25:24:1) and chloroform–isoamyl alcohol (24:1) phase separations.

DNA was precipitated with 700

ll of ice cold

absolute ethanol followed by storage at

-20°C for

1 h, and centrifugation (13,000g) for 10 min at 4°C.

The DNA pellet was washed with 70% ethanol, air dried and resuspended in 50

ll of sterile filtered H

O.

Fig. 2 Morphometric measurements and landmarks taken on each individual ofSardina pilchardus. 1Distance from tip of snout to operculum. 2 Vertical distances of the head. 3 Distance from mandible to operculum.4Distance from tip of snout to mandible.5Distance from operculum to insertion of dorsal fin.6 Distance between dorsal and insertion of pelvic fins. 7Distance from operculum to insertion of pelvic fin. 8 Base length of dorsal fin.9Distance between dorsal and anal fins.10Distance from pelvic to anal fins.11Distance between dorsal and caudal fins. 12height of caudal fin. 13 Distance from anal to caudal fins.LSstandard length.LFfork length and LTtotal length

(5)

Microsatellites amplification and genotyping Specific polymorphic microsatellites: Sp2, Sp7, Sp8 and SpI5 with accession number (AJ639616, AJ639618, AJ639619, HM031962), respectively, were amplified by PCR for each samples and characterized (Table

2). PCR amplification con-

sisted of 35 cycles of denaturation at 95°C for 30 s, annealing at 54–63°C for 30 s and extension at 72°C for 30 s. Cycles were followed by a final extension at 72°C for 5 min. PCRs contained approximately 10 ng of sample DNA, 0.7 units of Amplitaq DNA polymerase (Applied Biosystem, California, USA), 0.4

lM of each primer, 0.15 mM of

each dNTP, and 1.5

ll of Taq buffer (10 mM Tris–

HCl, pH 8.3, 50 mM KCl, and 1.5 mM MgCl

₂

) in a total volume of 15

ll. Each forward primer was

labelled with fluorescent dye (FAM, TET, HEX and TAMRA) (Invitrogen, Carlsbad, USA). PCR ampli- fied products were first controlled in an agarose gel (2%), and then genotyped on an ABI Prism 377 automated sequencer (Applied Biosystems, Califor- nia, USA). Data collection and sizing of alleles were carried out using Genotyper v2.5 software (Applied Biosystems, California, USA). Approxi- mately 10% of the samples were re-run to assess repeatability in scoring.

Microsatellite analysis

The software Microcheker (Van Oosterhout et al.

2004)

was used to identify possible genotyping errors (i.e.

stuttering, large allele dropout, or null alleles) within the microsatellite dataset by performing maximum likelihood estimation of the null allele frequency.

All others computations were performed using the program packages GENETIX v. 4.02 (Belkhir et al.

2000), GENEPOP v.4.0.6 (Raymond and Rousset 1995) and ARLEQUIN v. 3.1 (Excoffier et al.2005).

Microsatellite polymorphism within samples was measured as the mean number of alleles (N

_a

) per locus; observed and expected heterozygosities accord- ing to Nei (1978). Allelic richness was computed for each locus individually (N

_A

) as well as a multi-locus estimation for each of the nine locations (Table

3). The

statistical significance of heterozygote excess or deficit was tested using the Fisher’s exact test, with the level of significance determined by a Markov chain method. Single and multilocus F

_IS

were estimated using Weir and Cockerham’s

f

(Weir and Cockerham

1984). Allele frequency and linkage disequilibrium

were performed for all populations and for each locus using GENEPOP 3.3 software. Population differenti- ation was analysed using Wright’s F

_ST

(Wright

1969)

rather than Slatkin’s R

ST

(Slatkin

1995) because, FST

Table 2 Characterization of specific polymorphic microsatellites ofSardina pilchardus Locus Size

range

Repeat T_A MgCl₂

(mM)

Primers 5⁰–3⁰ Accession number

Sp2 112–262 (AG)₈/(TG)₁₆ 54 2 Sp2F 5⁰-CGA GGC CTG ATA GAA ACC C-3⁰

Sp2R 5⁰-AAC CAC GGT CAG TTC TCC AG-3⁰

AJ639619

Sp7 112–262 (AC)₁₄ 61 2.5 Sp7F 5⁰-GCA CAG GCG CTT ACA CAC-3⁰

Sp7R 5⁰-TGT GAC ACC AGG CAG AGC-3⁰

AJ639618

Sp8 111–327 (CA)₂₂ 63 2.5 Sp8F 5⁰-ACG TCG CAG TTC CCC ACT

G-3⁰

Sp8R 5⁰-ACT GGC TGA GGA GGA TGA TG-3⁰

AJ639619

SpI5 117–193 (TATC)₈TC(TATC)₂ 56 3 SpI5F 5⁰-TGG CTG TGC ATG TAA GTC TGT 3⁰

SpI5R 5⁰-TGC CAG TTG TTT AGT CTT TCC 3⁰

HM031962

(6)

based estimates of differentiation are considered more reliable when

B20 loci are used (Gaggiotti and Vetter 1999). Consequently, we estimated the pairwise

genetic differentiation among samples using genetic distance F

_ST

(Weir

1996) with GENETIX software

package. Exact tests of population differentiation were also performed for each locus and for each pair of samples using GENEPOP. This approach gives more weight to rare alleles and can be, therefore, more sensitive to the detection of weak population

differentiation. The Fisher’s exact test implemented in the GENEPOP 3.3 software package was used to estimate genetic differentiation among samples, con- sidering allele frequency differentiation between pairs of samples. The correlation coefficient between the matrix of F

_ST

genetic distances and geographical distances was calculated and its significance estimated by a Mantel test. Both genetic distances and the Mantel test were calculated using the GENETIX 4.02 software package (Belkhir et al.

2000). Significant differences Table 3 Levels of genetic variations observed at four micro-

satellite DNA loci within Atlantic and MediterraneanSardina pilchardus samples: allele size (in base pairs), number of

alleles (N_a), observed heterozygosity (H_o), expected heterozygosity and unbiased (H_e), coefficient of inbreeding (F_IS) and means across all samples and loci

Cap Blanc Dakhla Boujdor Tarfaya Safi Casablanca Galicia Malaga Cadiz LocusSp7

Alleles size 128–162 128–162 124–164 128–172 128–166 124–166 128–164 122–166 128–174

Number of alleles 15 17 15 17 17 19 14 17 13

H_e 0.8906 0.9010 0.8962 0.9047 0.9192 0.9093 0.8941 0.9033 0.8839

H_enb 0.9025 0.9111 0.9100 0.9171 0.9297 0.9211 0.9063 0.9186 0.8989

H_o 0.9211 0.9111 0.8788 0.8919 0.6818 0.8462 0.9189 0.8000 0.8667

F_ISW&C 0.021 0.000 0.035 0.028 0.269 0.072 0.014 0.130 0.036

LocusSp2

Allele size 120–242 120–230 146–230 112–262 142–218 154–252 150–214 148–250 148–248

H_e 0.9415 0.9400 0.9412 0.9483 0.9489 0.9513 0.9467 0.9472 0.9372

H_enb 0.9540 0.9506 0.9557 0.9617 0.9598 0.9637 0.9596 0.9633 0.9531

H_o 0.9211 0.8667 0.8788 0.8889 0.8182 0.8462 1.0000 0.9333 0.8667

F_ISW&C 0.035 0.089 0.082 0.077 0.149 0.123 0.043 0.032 0.092

LocusSp8

Allele size 115–197 121–179 121–313 115–327 113–183 111–187 119–183 113–181 113–185

H_e 0.9470 0.9430 0.9431 0.9255 0.9362 0.9316 0.9375 0.9411 0.9272

H_enb 0.9596 0.9536 0.9576 0.9382 0.9470 0.9437 0.9504 0.9571 0.9429

H_o 0.8947 0.8667 0.9091 0.8108 0.9773 0.8974 0.8378 0.8333 0.7667

F_ISW&C 0.068 0.092 0.051 0.137 0.032 0.050 0.120 0.131 0.190

LocusSpI5

Allele size 133–173 125–173 125–169 133–189 117–177 121–181 133–193 117–181 133–173

H_e 0.8470 0.8314 0.7815 0.8608 0.8701 0.8501 0.8134 0.8472 0.8656

H_enb 0.8582 0.8407 0.7935 0.8726 0.8801 0.8611 0.8245 0.8616 0.8802

Ho 0.8158 0.7333 0.6667 0.8919 0.6818 0.8718 0.7568 0.6667 0.7667

F_ISW&C 0.050 0.129 0.162 0.022 0.227 0.013 0.083 0.229 0.131

Mean N_a 19.5 19.5 18.25 20 21 20.5 18.75 19.75 18

Mean H_o 0.8882 0.8444 0.8333 0.8709 0.7898 0.8654 0.8784 0.8083 0.8167

Mean H_e 0.9186 0.9140 0.9042 0.9224 0.9291 0.9224 0.9102 0.9251 0.9188

MeanF_ISW&C 0.033 0.077 0.082 0.055 0.152 0.060 0.036 0.130 0.112

(7)

of genetic diversity measures between S. pilchardus subspecies were tested using the AMOVA test using ARLEQUIN v. 3.1 software packages (Excoffier et al.

2005).

Mitochondrial control region analysis

A mitochondrial DNA segment was amplified by PCR using specific primers designed in our laboratory.

Xouba

1F (ACGTCATCATTGGGCAAGTG) and

Xouba

2R (GGACTCGCCAGATGCAAAGT), located in tRNA-pro and the central domain of the control region, witch flank a poly-T rich region and a variable number of repetition (TATGTCATTATATCACGC ATAT). Approximately 50 ng of template DNA was used for amplification in 20

ll reaction mixture using

a GeneAmp 9700 thermocycler (Applied Biosystems, California, USA), in 19 Pomega buffer containing 2.5 mM MgCl

2

, 200

lM dNTP, 0.4 Unit of Taq

polymerase (Promega, Madison, USA), 0.1

lM of

each primer and 0.5

ll of DNA solution. The PCR

profile was 94°C for 3 min then 35 x (94°C for 45 s, 54°C for 45 s, 72°C for 45 s), followed by a final extension holding (72°C for 5 min). An aliquot of 5

ll

of PCR products was firstly controlled in 1.5% agarose gel, with a range marker and the rest of PCR products were enzymatically treated with ExoSAP-It (GE HealthCare) for primer digestion and deactivation of free dNTPs. DNA sequencing of PCR products was performed with the BigDye 3.1 sequencing kit (Applied Biosystems, California, USA) using the

Xouba

Forward and reverse primer. The extension products were purified with DyeEx-96 kit (Qiagen, Maryland, USA) and electrophoretically separated and detected in an ABI PRISM 377XL automated sequencer (Applied Biosystems, California, USA).

Electrophoregrams were revised and sequences edited and aligned with BioEdit 7.0.1 (Hall

1999).

DNA sequence analysis

Statistical parsimony was used to analyze the intra specific phylogeny of mtDNA haplotypes using the software DAMBE v5.2.6. (Xia and Xie

2001).Nucle-

otide sequences were aligned using Clustal X v2.0.10 (Thompson et al.

1997), and further revised by eye.

Population genetic statistics were estimated using Arlequin 3.01 (Excoffier et al.

2005) and DnaSP 4.0

(Rozas et al.

2003). Descriptive statistics such as the

number of polymorphic sites (S), haplotype (Hd, Nei

1987) and nucleotide diversity (p, Nei1987) and the

average number of pairwise nucleotide differences (k, Tajima

1983) were determined for each population.

Phylogenetic relationships using the neighbor-joining (NJ) method (Saitou and Nei

1987) and molecular

evolutionary analyses were conducted using MEGA V.

4 (Tamura et al.

2007). Because of the singularity of the

sardine 5- end control region, no homologous sequence were detected from other clupeids, and the NJ tree was rooted using the midpoint rooting option. Pairwise haplotype divergences were estimated with Arlequin 3.01 (Excoffier et al.

2005), including information on

mitochondrial haplotype frequency (Weir and Cock- erham

1984), and genetic distances (Tamura and Nei 1993). Significance of pairwise population compari-

sons was tested by 20,000 permutations. To determine the amount of partitioned genetic variability within and among populations, an analysis of molecular variance (AMOVA) was performed in Arlequin 3.01 (Excoffier et al.

2005). Permutations (N=

20,000) were used to construct null distributions and to test the significance of variance components (Guo and Thompson

1992).

The demographic history of sardine populations was investigated via the distribution of the observed number of differences between pairs of haplotypes (mismatch distributions), as implemented in Arlequin 2001 (Schneider et al.

2000) and DnaSP 4.0 (Rozas

et al.

2003), which is typically unimodal in samples

from recently expanded populations (Rogers and Harpending

1992; Schneider and Excoffier 1999;

Slatkin and Hudson

1991). To test deviations from

neutrality we used Tajima’s (1989) and Fu and Li’s tests (1997), as implemented in DnaSP 4.0 (Rozas et al.

2003). The isolation-by-distance (IBD) scenario was

evaluated by testing the significance of the correlation between the matrices containing the F

_ST

/(1

-

F

_ST

) values and geographic distances between populations, by a permutation approach (1,000 permutations) using the Mantel test as implemented in Arlequin 3.01 (Excoffier et al.

2005). A median-joining network was

constructed using NetWork 4.1.1.2 (Bandelt et al.

1999) to represent the intra-specific relationships

among haplotypes and their relative frequencies in

the sampled populations. The resulting network is a

combination of minimum spanning trees, with median

vectors added by a parsimony criterion. These vectors

represent extant unsampled or extinct ancestral

haplotypes.

(8)

Results

Morphometric results

After size correction, none of the standardized truss measurements showed significant correlation with standard length. These indicate that the effect of size had been successfully removed with the allometric transformation. The effect of sex on the truss measurements was not tested since

Sardina pilchardus

is a gonochoric species without sexual dimor- phism and samples were collected during the feeding season (Ettahiri et al.

2003; Amenzoui et al.2006).

The MANOVA enable us to appreciate the effect of a qualitative variable (the geographical area) on the quantitative variables (morphometric parameters) by comparison of the means of groups. The results show a highly significant effect of the area on the all morphometric parameters, except the IT11 measure- ment, thus we can exclude it from the other analysis, because it does not contribute to the separation or the characterization of the sardine populations in the various zones (data not shown).

The principal components analysis of size-cor- rected truss variables showed that the first two principal components (PC) account for 87% of the total variance. The first PC is essentially a contrast between the dimensions of the fish head (IT1), and of the fish body (IT7 and IT13), corresponding respec- tively to: the side length of the head, the distance from operculum to insertion of pelvic fin and the distance from anal to caudal fins, which characterize the north samples (Fig.

3).The group of south sam-

ples having a larger head and smaller body

dimensions than the group of north samples. PC2 is dominated by variables IT6 and IT12, indicating differences in the length of the dorsal fin base. The samples from zone B are not well individualized, and consequently, it can be regarded as a zone of overlapping between the two populations of samples off the north of morocco and those of the south.

The classification functions of the samples were listed in Table

4. Corresponding morphometric char-

acters of

Sardina pilchardus

fish were substituted into three classification functions respectively, the func- tion with the largest resulting value is the population to which the sample belongs. The most well-defined samples are from the south region of Moroccan Atlantic, with six misclassified individual (9%). The 13 and 37% of misclassifications were yielded separately for the North samples and the central samples respectively. The high success rate of reclassification shown by individuals from samples of Cap Blanc (CAB

=

94%) from the south regions and Safi and Casablanca (SAF

=

89%, CAS

=

91%)

Fig. 3 Principal and factorial component analysis of diverse samples ofSardina pilchardusin the Moroccan Atlantic coast

Table 4 Percentage of new individuals re-allocated in each group in validation of the discriminant function

Original group

North stock (%)

Central stock (%)

South stock (%) Re-allocation group

North stock 87 9 4

Central stock 18 63 19

South stock 5 4 91

Group North: samples (SAF-CAS); Group southern (CAB, CAR DAK) and Group of central stock (BOJ, TAR, AGA)

(9)

from the North, indicates that these samples were the most singular and clearly differentiated of the set.

Biological parameters

Sardine in the North of morocco samples (Casablanca and Safi) were overall the smallest (mean lengths around 15.5 cm). The largest sardines were caught close to the South stock area, with a mean length of 22.5 cm in Dakhla and 23 cm in Cap Blanc. Spec- imens were aged by a direct lecture of growth rings in the sagittal otoliths, the study of the age of the different samples; gives more information about the rate of growth in the different regions, in our case we note the existence of net separation between two groups of fish aged in the south with an average of 3–4 years, and young fishes (1–2 years) grouped in the North of the studied region, we note also that the length and the age distributions generally overlapped considerably among samples (data not shown).

Size at first maturity

The values of the length at first maturity (L

₅₀

) estimated for Sardines in the different regions of Moroccan Atlantic are varied depending of the area studied, with a values of 15 cm (± 0.29) for males and 15.2 cm (± 0.35) for females in the Nord region and (L

₅₀

) reached at 16.6

±

0.31 cm and 17.2

±

0.3 cm respectively for the males and the females in the south for the same year. No significant differences were found in the (L

₅₀

) between sexes by ANOVA.

Microsatellite diversity among loci and genetic diversity

Estimates of variability at the four microsatellites DNA loci within all population samples, heterozy- gosity (H

_o

and H

_e

) within and means across loci and samples, size distributions and mean number of alleles (N

_a

) across loci, and tests for deviation from Hardy–Weinberg out crossing expectations within loci are listed in Table

3. All samples revealed a

moderate to high level of genetic variability in all loci studied with 19 to 50 alleles per locus (mean N

_A

value

±

standard deviation was 19.5

±

2.5), mean observed and expected heterozygosities was uni- formly high across all locations multilocus of H

_o=

0.843

±

0.11 and H

_e=

0.905

±

0.12, respectively.

The locus

Sp2

had the most alleles (50) and the locus

SpI5

had the least ones (19). Within-sample, vari- ability was uniformly high across all samples: the mean Na ranged between 18.25 from Boujdor and 21 from Safi. The mean observed (H

_o

) and unbiased expected heterozygosity (H

_e

) ranged between 0.789 and 0.888, and between 0.904 and 0.929 respectively.

The inbreeding coefficient varied between 0.061 at locus

Sp7

and 0.153 at locus

SpI5

(mean F

_IS=

0.100

±

0.02). All loci (Sp2,

Sp7, Sp8

and

SpI5) were in Hardy–Weinberg (HW) disequilibrium

over all population samples. Tests for linkage disequilibrium showed a very low (4.2%) number of significant pairwise comparisons, which suggests independence of all examined loci.

The amount of genetic variability was homoge- neous among sardine population samples as indicated by the low standard deviations associated to the estimated mean number of alleles (N

A=

19.5

±

1.4), by mean allelic richness (N

_S=

33

±

1.95), and by mean observed (H

_o=

0.843

±

0.04) and expected heterozygosities (H

e=

0.905

±

0.02) (Table

3). The

overall proportion of private alleles for the analyzed population samples was considerably high (16.3%), especially for the locus

Sp2

and

Sp8.

The inbreeding coefficient F

_IS

within population samples across all loci was on average of 0.082

±

0.01. Sardine population samples at three locations Safi, Malaga, and Cadiz (SAF, MAL and CAD) showed significant mean F

_IS

values, indicating significant departures from HW equilibrium due to homozygote excess (Table

3). These deviations were always attrib-

utable to a significant deficit of heterozygote with respect to those under hardy–Weinberg conditions.

The presence of null alleles was detected for the population of Safi in all studied loci, and for locus Sp8 and

SpI5

in the populations of Cadiz and Malaga.

All samples from Atlantic coast of Morocco and

samples from coast of Spain were genetically com-

pared by pairwise estimating the genetic distance

(F

_ST

) over the four microsatellite loci, the divergence

between populations from each group ranged

between 0.0017 and 0.014. The samples from Cap

blanc, Tarfaya and Cadiz (CAB, TAR and CAD)

were distinct from all other population samples, as

indicated by high F

_ST

values between these popula-

tions and all others, with an F

ST

values ranging from

0.010 to 0.013 (Table

5). The significant global F_ST

test over all loci suggested population structuring in

(10)

sardines. A Mantel test was elaborated without Malaga samples considered as Mediterranean specie and showed significant correlation between genetic and geographic distances among the Atlantic coast samples of Morocco and Spain. According to the Mantel test, correlation between genetic dis- tance determined as F

_ST

and geographical distance Ln(Kms) was significant (correlation coefficient, r

=

0.26,

P=

0.05) (Fig.

4).

For genetic structure differentiation, several assemblies were tested to identify the structuring of populations below the Atlantic coast, based in the distribution of allele frequencies. Hierarchical AMOVA revealed overall significant genetic struc- turing of the analyzed samples (P

\

0.00) (Table

6).

A possible a priori hypothesis of geographic struc- turing (organized as Atlantic Ocean versus Mediter- ranean Sea sample presented by Malaga) was supported by the AMOVA (% of variation

=

0.07,

P\

0.00), other significant value of geographic structuring was determined (strong-minded) by regroupement of the Moroccan samples together and the North samples from Spanish coast, confirm- ing the isolation by distance (% of variation

=

0.174, and

P\

0.00).

Mitochondrial analysis

Phylogenetic relationships and genetic differentiation

The mitochondrial DNA control region of

Sardina pilchardus

located between (tRNA-pro and central domain) was amplified by PCR amplification and two regions were sequenced. The mtDNA control region of the teleost fishes could be separated into three domains, namely, the terminal associated sequence domain, the central conserved sequence domain that can be aligned with other fish mitochondrial control regions (Lee et al.

1995) and the conserved sequence

block domain. The two sequences of 460 and 700 pb respectively for the forward and the reverse primer extensions were regrouped to perform sequence anal- ysis with a single fragment of 1,160 pb. An insertion of 13 bp was found in the position 64 of the sardine mitochondrial control region in many individuals of all populations. The frequency of this insertion is variable in the different populations (Fig.

5).

Table 5 Microsatellites Multilocus estimates for F_ST(below diagonal) and mitochondrial F_ST(above diagonal) between different sample pairs inSardina pilchardus

CAB DAK BOJ TAR SAF CAS GAL MAL CAD

CAB – 0.0104 0.0235 0.0092 0.0075 0.0267 0.0107 0.0139 0.0392*

DAK -0.0061 – – – – – – – –

BOJ 0.0104 -0.0031 – 0.0311* 0.0233 0.0318 0.0149 0.0213 0.0761*

TAR 0.0114 0.0101 0.0107* – -0.0044 0.0127 0.0109 0.0286 0.0243*

SAF 0.0057 0.0045 0.0054 0.0056 – 0.0157 0.0076 0.0223 0.0453*

CAS 0.0073 0.0058 0.0059 0.0036 0.0039 – 0.0160 0.0432* 0.0592*

GAL 0.0128* 0.0088 0.0044 0.0101* 0.0017 0.0068 – 0.0073 0.0389*

MAL 0.0065 0.0017 -0.0016 0.0100 0.0000 0.0041 -0.0010 – 0.0383*

CAD 0.0101* 0.0095 0.0140 0.0113 0.0107 0.0079 0.0089 0.0042 –

* Significant atp\0.05

Fig. 4 Genetic isolation by distance of Atlantic Sardina pilchardus population samples inferred from multilocus microsatellites estimates of F_ST genetic distances (blue solid squares) and mitochondrial FST versus geographical distance (Mantel test). Correlation coefficients: for microsatellites F_ST, R²=0.07,P=0.05

(11)

For each region, sequence samples were aligned and compared, after gap exclusion, the alignment was reduced to 1,036 sites. Of these, 585 were polymor- phic, 268 were parsimony informative, and 232 singleton variable sites. Polymorphic sites defined a total of 200 different haplotypes. The result of overall hapltotype diversity was very high (0.999

±

0.001).

Nucleotide diversity was between 0.026 and 0.029 in all populations except in Cap Blanc and Galicia witch was around 0.031, and in Boujdor witch was 0.020.

Population genetic statistics are listed in Table

7.

The constructed NJ phylogeny tree showed a limited resolution, and a low phylogeographic struc- turing, specially the grouping of individuals sharing the 13-bp gap at position 64 of their sequences together, to the exclusion of those having an insertion at the same position (Fig.

5), the presence of this two

main types of haplotypes (with and without gap) may represent retention of an ancestral polymorphism. On

another side we note the presence of 12 out 30 individuals from Safi were recovered together in the same clade, and 13 individuals from sample of Mediterranean sea (Malaga) grouped together in the another clade (Fig.

5). Genetic differentiation among

sardine populations was assessed using F

_ST

pairwise comparisons. F

_ST

values were in general moderate to high. Of the 28 possible comparisons, only those involving Cadiz and Boujdor showed statistically significant values (Table

5). The pairwise compari-

sons between Safi and Cap Blanc, Galicia and Cap Blanc, Malaga and Cap Blanc, and Malaga and Galicia were not significant. These results were further confirmed using hierarchical AMOVA tests (Table

6). The analyzed populations showed overall

significant levels of genetic structuring. A three-gene pool comparison that separated the population of Cadiz from that of Galicia and from the rest resulted in significant values.

Table 6 Analysis of molecular variance (AMOVA) of spatial variation in Sardina pilchardus for microsatellites loci and the mitochondrial sequences analysis (* Significant values)

Structure tested Source of % variation F statistics Variance % of variation P Microsatellites

1 group

(CAB, DAK, BOJ, TAR, SAF, CAS CAD, GAL, MAL) Among groups F_ST=0.005 0.011 0.6* 0.00*

3 groups

(CAB, DAK, BOJ, TAR, SAF, CAS) Among groups F_CT=0.000 0.001 0.07* 0.00*

vs (CAD, GAL) Within groups F_SC=0.006 0.012 0.67 0.00*

vs (MAL) Within populations F_ST=0.007 1.834 99.26 0.33

3 groups

(CAB, DAK, BOJ, TAR, SAF) Among groups F_CT=0.001 0.003 0.174* 0.00*

vs (CAD, MAL) Within groups F_SC=0.006 0.011 0.614 0.00*

vs (GAL) Within populations F_ST=0.007 1.836 99.24 0.33

Mitochondrial analysis 1 group

(CAB, DAK, BOJ, TAR, SAF, CAS CAD, GAL, MAL) Among groups F_ST=0.036 0.72 3.67* 0.00*

3 groups

(CAB, DAK, BOJ, TAR, SAF, CAS) Among groups F_CT=0.001 0.026 0.13* 0.00*

vs (CAD, MAL) Within groups F_SC=0.037 0.071 3.59 0.00*

vs (GAL) Within populations F_ST=0.035 19.06 96.28 0.44

2 groups

(CAB, DAK, BOJ, TAR, SAF, CAS, Among groups F_CT=0.044 0.901 4.42* 0.00*

MAL, GAL) Within groups F_SC=0.024 0.480 2.35* 0.00*

vs (CAD) Within populations F_ST=0.067 19.06 93.23 0.00*

(12)

Historical demography

The mismatch distribution including all samples was unimodal (Fig.

6), and perfectly typical to the

distribution predicted by the growth–decline popula- tion model. Fu’s Fs and Tajima’s D statistics rendered negative values that indicated an excess of low frequency haplotypes, and hence, a significant

deviation from neutrality. Reported mutation rates for the fish mitochondrial control region vary between 1.1

9

10

^-7

(McMillan and Palumbi

1997) and

3.6

9

10

^-8

(Donaldson and Wilson,

1999) per site

per year. Overall, the Galician population seems to show signs of strong genetic drift. The means (s) of the different mismatch distributions are nearly iden- tical with the exception of that of Cap blanc that

Fig. 5 The evolutionary history was inferred using the

Neighbor-Joining method. The evolutionary distances were computed using the Maximum Composite Likelihood method.

All positions containing alignment gaps were eliminated only in

pairwise sequence comparisons (Pairwise deletion) (A) and complete deletion in (B). Phylogenetic analyses were conducted in MEGA4

Table 7 mtDNA parameters of population genetic analysis

Population CAB BOJ TAR SAF CAS CAD Mal GAL

Nb Hplotype 36 30 30 30 36 30 38 30

S 196 144 107 176 159 196 225* 216

Hd 1 1 1 1 1 1 1 1

k 35.22* 23.47* 28.77 30.85 29.90 31.79 28.98 34.05*

p 0.031* 0.020* 0.026 0.027 0.026 0.029 0.026 0.031*

h 56.17 42.57 40.05 51.75 46.63 57.99 54.22 62.66

Tajima’s D -1.805 -1.836 -1.322 -1.632 -1.459 -1.835 -1.776 -1.802

Fu’s F_s -4.160 -7.098 -1.137 -6.716 -6.341 -7.657 -9.324 -6.698

Snumber of polymorphic sites,Hd haplotype (gene) diversity (Nei1987),kmean pairwise nucleotide differences (Tajima1993), pnucleotide diversity (Nei1987),hexpected heterozygosity per site (Watterson1975),nsample size

* Significant atp\0.05

(13)

suggests an recent onset of its population growth and the population of Galicia displaced to the right, reflecting the estimated older expansion time.

Discussion

Biologic and morphometric parameters in relation to environmental conditions

In the present study, highly significant variation of morphometric distance and biological parameters were detected among

Sardina pilchardus

stocks of Moroccan Atlantic. The results supply the identifica- tion of two morphological types, with geographic separation within the Northwest African coast, and the South region of Morocco. Morphometric method indicated that sardines from southern region (Cap Blanc, Cap Barbas, Dakhla and Boujdor) have a morphotype distinct from the samples of the North (Safi and Casablanca) area. The discrimination of the two morphotypes was confirmed statistically by the

significant difference between group and by the high percentage of correct classification (

[

90%) of fishes.

Sardine from the north of Morocco area had a smaller head, and head-to-body ratio than those from south of Morocco. These differences reinforce the results of a recent multivariate study of sardine morphometry in Iberian waters that suggested a southerly increasing latitudinal gradient in the absolute and relative size of the head (ICES

2000). Earlier uni-variate analyses on

the cephalic index (Andreu

1969; Freon and Stequert 1982) also indicated an increase in the head-to-body

ratio from north to south within the Atlantic. Apart from the identification of two morphotypes based on head-to-body ratios, there is also some evidence for the identification of distinct morphological groups, mainly on the basis of the position of the pelvic and anal fins (Fig.

2). These characters contributed to the

distinction and separation between shape of sardine from the north and those from the south region, this result is consistent with several studies that have identified phenotypic differences based on these measurements (Parrish et al.

1989; Silva 2003;

Fig. 6 Mismatch distributions for each individual population sample ofSardina pilchardus.Pointsindicate observed values, while the lineof the corresponding colour indicates the mismatch distribution expected from a sudden expansion model

(14)

Tudela

1999; Turan et al.2004a,b). It should also be

noted that the samples from the central region (Boujdor, Tarfaya and Agadir) are overlap between the two morphotypes of the North and the South regions, based on the classification of fishes in this area. The total number of external individuals classified to North or South samples can reflect the degree of affinity between these two samples. More- over analysis of biologic parameters as age compo- sitions and the size of first maturity sexual have confirmed the discrimination between these groups.

Several studies of reproduction cycle Analysis of

Sardina pilchardus

off the Moroccan Atlantic coast, Galician coast and Alboran Sea, demonstrated an increasing latitudinal gradient of the first maturity size from the North to the South of the Atlantic, furthermore recent studies stated that only two populations are distributed in Moroccan waters, which can be distinguished by different growth rates and longevity characters (Abad and Giraldez

1993;

Barkova et al.

2001; Amenzoui et al. 2006). The

detected pattern of phenotypic and Biologic discrete- ness suggests a direct relationship between the extent of phenotypic divergence or hydrodynamic influ- ences, indicating that geographic separation is a limiting factor to migration among stocks along the Moroccan Atlantic coast. The major limitation of morphological characters at the intra-specific level is that phenotypic variation is not directly under genetic control but is subjected to environmental modifica- tion (Clayton

1986). The phenotypic plasticity of fish

allows them to respond adaptively to environmental change by modifications in their physiology and behaviour, which lead to changes in their morphol- ogy, reproduction or survival that mitigate the effects of environmental change (Turan et al.

2004b).

Genetic analysis: contribution of nuclear and mitochondrial molecular marker

The pronounced phenotypic differentiation was not supported by genetic data, the genetic analysis combined two powerful genetic markers microsatel- lites and the analysis of the mitochondrial control region has demonstrated a low but a significant genetic differentiation, from distant region of the Atlantic coast, and an homogeneity of the samples off Moroccan coast. The use of these two types of molecular markers seems to be interesting if we note

that mitochondrial DNA is haploid maternally inher- ited, lacks recombination, with smaller effective population size and shows relatively fast evolutionary rates, which make this molecular marker particularly suitable for inferring phylogeographic patterns (Avise

2000). This molecular marker is particularly appro-

priate for detecting historical relations or genetic bottleneck events, and has been very useful in describing present day phylogeography of taxa with relatively low dispersal capacity (Avise

2000; Atarh-

ouch et al.

2006). However, mitochondrial genetic

variation is less helpful when tackling questions on present-day genetic structuring of taxa with large population sizes and high levels of gene flow within their distribution such as marine pelagic fishes (Hauser et al.

2001; Buonaccorsi et al.2001; Naciri

et al.

1999). Moreover microsatellites are nuclear

markers with higher mutation rates (Goldstein et al.

1999) that have proved to be more efficient and

informative for detecting fine-scale population struc- ture in marine pelagic fishes (Durand et al.

2005;

Buonaccorsi et al.

2001; Ruzzante et al. 2006).

Overall, comparative analyses of nuclear and mito- chondrial data should be very informative, as evolu- tionary forces will differentially affect each class of marker and to determine the factors involved in shaping contemporary population genetic structure of marine pelagic fishes (Buonaccorsi et al.

2001;

Gonzalez and Zardoya

2007).

The four microsatelittes loci used in this study showed high levels of polymorphism and no signif- icant linkage disequilibrium which suggests indepen- dence of all examined loci. Two of the analyzed loci (Sp

₂

and

Sp₈

) showed high number of private alleles but at the same level reported for other marine fishes.

Significant values of inbreeding coefficient (F

_is

) were

also demonstrated in Safi, Malaga and Cadiz, due to

homozygote excess. The null allele test indicated that

these departures could be due to the presence of null

alleles especially in samples off Safi coast. We note

that several studies of population genetic and histor-

ical demographic analyses of sardines from Safi

based on mitochondrial sequence data showed strong

genetic differentiation of this population sample, and

the signature of an early genetic bottleneck (Atarh-

ouch et al.

2006). The genetic singularity of sardines

at Safi was also detected with allozyme data (Chlaida

et al.

2006), that could have enhanced the effects of

the historical collapse of the sardine stock in the same

(15)

region during the 1970s (Belveze and Erzini

1983;

Kifani

1995; Chlaida et al. 2006). Overall F_ST

detected significant genetic structuring among all sardine population samples. Pairwise estimates of (Fst) varied between 0.0017 and 0.014, and were of the same level of magnitude to those reported for other pelagic fishes with a high dispersal activity (Naciri et al.

1999; Knutsen et al.2003; O’Reilly et al.

2004). These relatively low Fst values could be

attributed to high levels of size homoplasy, as expected when using polymorphic microsatellites with high mutation rates in species with large effective population sizes (O’Reilly et al.

2004; Hey

et al.

2004; Carreras-Carbonell et al.2006). However,

the observed relatively high number of private alleles (&20%), and their even distribution among popula- tion samples indicate that alleles shared between sardines at the different locations is rather limited and thus, that the effects of size homoplasy are minimal.

Alternatively, we note that the high levels of locus polymorphism (Sp

₂

and

Sp₈

) are the ones responsible of detecting the weak significant genetic structuring like in others studies (O’Reilly et al.,

2004; Carreras-

Carbonell et al.

2006). Molecular variance analyses

supported genetic differentiation between the popu- lation of Atlantic Moroccan coast, and those of the Spanish coast of Galicia (supported by the analysis of mantel test and the isolation by distance), with a probably a contact zone around Cadiz in the Atlantic coast and Malaga for Mediterranean Sea.

The length of the mitochondrial region is highly variable among even closely related species of teleost fish due to the presence of tandemly repeated sequences and large insertions (Lee et al.

1995).

The variable structure of these control regions suggests that particular care should be taken to identify the most appropriate segment for studies of intraspecific variation. The entire mitochondrial con- trol region of

Sardina pilchardus

is approximately 1,650 bp in length, and as in most fishes, it is localized between the tRNAPro and the tRNAPhe genes (Atarhouch et al.

2006). The mitochondrial

analysis of partial fragments of mitochondrial control region of sardine (1,160 pb), showed that the phylogenetic and population genetic analyses reveal significant genetic structuring in contrast to previous genetic analyses of sardines stocks (Ramon and Castro

1997; Spanakis et al.1989; Tinti et al.2002).

Both in the recovered NJ phylogeny as well as in the

population genetic analyses, Cap Blanc and Galician samples showed a significantly different pairwise nucleotide differences coupled with higher nucleotide diversity. These results reflect some degree of isolation of these populations that prevents its admixture with the surrounding ones, and suggest the enhancement of an independent demographic history. Although speculative, the causes for the isolation of these populations may be related to oceanographic barriers (e.g., gyres) or environmental barriers like the presence of several emergence of upwelling in the south of Morocco, and associated also to the isolation by distance between the two samples of approximately 2,500 km, a hypothesis that was confirmed also with the microsatellite analyse. The same result was supported by the profile of the mismatch distribution indicating a clear distinction between the population of Cab Blanc and Galicia and from samples of Mediterranean Sea and the most Atlantic Moroccan populations.

Moreover it seems that there is a gene flow between the population of the Mediterranean Sea and those of the Moroccan Atlantic Ocean coast with a low separation as revealed by the high number of polymorphic sites of Malaga in comparison with the other samples. This result is essential for a differen- tial fishery management of sardine populations from European Atlantic Ocean coasts and those from the Mediterranean Sea and the Northwest African coast.

Conclusion

Sardines are an economically very important Fishery in the Atlantic coasts of North African region and Western Europe, as well as in the Mediterranean Sea.

We have determined biologic and genetic variability

of sardine stocks in the Atlantic Ocean–Mediterra-

nean Sea with particular emphasis on one of the most

important landings areas, the upwellings of Morocco

coasts. In general, fishes demonstrate greater variance

in morphometric traits both within and between

populations than other vertebrates, and are more

susceptible to environmentally induced morphologi-

cal variation (Allendorf et al.

1987; Wimberger 1992). The potential capacity of populations, to adapt

and evolve as independent biological entities in

different environmental conditions, is restricted by

the exchange of individuals between populations. A

(16)

sufficient degree of isolation may result in notable phenotypic and genetic differentiation among fish populations within species, which may be recogniz- able as a basis for separation and management of distinct populations. Such phenotypic adaptations may not result in genetic changes in the stock and thus detection of such phenotypic differences among stocks cannot usually be taken as evidence of genetic differentiation. For this reason we have used two powerful genetic markers based on mitochondrial and microsatellite data to reflect different and comple- mentary aspects of the evolutionary history of sardine. Mitochondrial data, with a different muta- tional dynamics might be reflecting past isolation of sardine populations into two distinct groupings during Pleistocene, whereas microsatellite data with its greater resolution reveal the existence of present day gene flow among populations, and a model of isolation by distance between samples from Morocco and Spain. The results obtained are not only relevant for the biology and phylo-geography of the species but also for a planning an adapted fishery manage- ment in this area.

References

Abad R, Giraldez A (1993) Reproduccion, factor de condicion y talla de primer madurez de la sardina, Sardina pilchardus(Walb.), del litoral de Malaga, mar de Alboran (1989 a 1992). Bol Inst Esp Oceano 9(1):145–155 Allendorf FW, Ryman N, Utter F (1987) Genetics and fishery

management: past, present and future in population genetics and fisheries management. In: Ryman N, Utter F (eds) University of Washington Press, Seattle and Lon- don, pp 1–20

Amenzoui K, Ferhan-Tachinante F, Yahyaoui A, Kifani S, Mesfioui AH (2006) Analysis of the cycle of reproduction ofSardina pilchardus(Walbaum, 1792) off the Moroccan Atlantic coast. C R Biol 329(11):892–901

Andreu B (1969) Las branquiespinas en la caracterizacio´n de las poblaciones de Sardina pilchardus. Invest Pesq Bar 33:425–607

Atarhouch T, Ru¨ber L, Gonzalez EG, Albert EM, Rami M, Dakkak A, Zardoya R (2006) Signature of an early genetic bottleneck in a population of Moroccan sardines (Sardina pilchardus). Mol Phylogenet Evol 39:373–383

Atarhouch T, Rami M, Naciri M, Dakkak A (2007) Genetic population structure of sardine (Sardina pilchardus) off Morocco detected with intron polymorphism (EPIC- PCR). Mar Biol 150:521–528

Avise JC (2000) Phylogeography: the history and formation of species. Harvard University Press, Cambridge

Bandelt H-J, Forster P, Rohl A (1999) Median-joining net- works for inferring intraspecific phylogenies. Mol Biol Evol 16:37–48

Barkova NA, Chukhgalter OA, Scherbitch LV (2001) Proble`- mes structuraux des populations de sardines (Sardina pilcardus, Walbaum, 1792) habitant au large des coˆtes de l’Afrique du Nord-Ouest. In: Groupe de Travail de la FAO sur l’e´valuation des petits pe´lagiques au large de l’Afrique Nord-Occidentale Nouadhibou, Mauritanie, 24–31 mars 2001 (657):120–133

Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F, Genetix version 4.02. (2000) un logiciel pour l’analyse des donne´es en ge´ne´tique des populations, universite´

Montpellier-2, France, 2000, http://www.univmontp2.fr/

*genetix/genetix.htm

Belveze H (1984) Biologie et dynamique des populations de la sardine (Sardina pilchardus Walb.) peuplant les coˆtes atlantiques marocaines et proposition pour un ame´nagement des peˆcheries pour un ame´nagement des peˆcheries.

The`se. Doct. Univ. Bret. Occident

Belveze H, Erzini K (1983) The influence of hyroclimatic factors on the availability of the sardine (Sardina pilchardus, Walbaum) in the Moroccan Atlantic fishery.

FAO Fish Rep 291:285–328

Buonaccorsi VP, McDowell JR, Graves JE (2001) Reconciling patterns of inter-ocean molecular variance from four classes of molecular markers in blue marlin (Makaira nigricans). Mol Ecol 10:1179–1196

Carreras-Carbonell J, Macpherson E, Pascual M (2006) Pop- ulation structure within and between subspecies of the Mediterranean triplefin fishTripterygion delaisirevealed by highly polymorphic microsatellite loci. Mol Ecol 15:3527–3539

Cheng QT, Zheng BS (1987) Systematic searches of fishes in China. Science Press, Beijing

Chlaida M, Kifani S, Lenfant P, Ouragh L (2006) First approach for the identification of sardine populations Sardina pilchardus (Walbaum 1792) in the Moroccan Atlantic by allozymes. Marine Biol 149(2):169–175 Clayton JW (1986) The stock concept and the uncoupling of

organismal and molecular evolution. Can J Fish Aquat Sci 38:1515–1522

Donaldson KA, Wilson RR (1999) Amphi-panamaic gemi- nates of snook (Percoidei-Centropomidae) provide a calibration of divergence rates in the mitochondrial DNA control region of fishes. Mol Phylogenet Evol 13:

208–213

Durand JD, Collet A, Chow S, Guinand B, Borsa P (2005) Nuclear and mitochondrial DNA markers indicate unidi- rectional gene flow of Indo-Pacific to Atlantic bigeye tuna (Thunnus obesus) populations, and their admixture off southern Africa. Mar Biol 147:313–322

Elliott NG, Haskard K, Koslow JA (1995) Morphometric analysis of orange roughy (Hoplostethus atlanticus) off the continental slope of southern Australia. J Fish Biol 46:202–220

Ettahiri O, Berraho A, Vidy G, Ramdani M, Do Chi T (2003) Observation on the spawning of Sardina and Sardinella off the south Moroccan Atlantic coast (21–26°N). Fish Res 60:207–222

(17)

Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol Bioinform Online 1:47–50

Fage L (1920) Engraulidaee Clupeidae. Report on the Danish oceanographic expeditions 1908 and 1910 to Mediterra- nean and Adjacent Seas. 2. Biology

FAO (2001) Report of the FAO working group on the assessment of small pelagic fish off North-west Africa.

FAO Fisheries Report, 657

Freon P, Stequert B (1982) Note sur la pre´sence deSardina pilchardus(Walb.) au Se´ne´gal: e´tude de la biome´trie et interpre´tation. Rapports et Proce`s-verbaux des Re´unions du Conseil Internationale de l’Exploration de la Mer.

180:345–349

Fu Y-X (1997) Statistical tests of neutrality against population growth, hitchhiking and background selection. Genetics 147:915–925

Furnestin J (1945) Contribution a` l’e´tude biologique de la Sardine atlantique (Sardina pilchardusWALB). Rev Trav Off Peˆches Marit 13(1–4):221–386

Gaggiotti OE, Vetter RD (1999) Effect of life history strategy, environmental variability, and over-exploitation on the genetic diversity of pelagic fish populations. Can J Fish Aquat Sci 56:1376–1388

Goldstein DB, Roemer GW, Smith DA, Reich DE, Bergman A, Wayne R (1999) The use of microsatellite variation to infer population structure and demographic history in a natural model system. Genetics 151:797–801

Gonzalez EG, Zardoya R (2007) Isolation and characterization of polymorphic microsatellites for the sardine, Sardina pilchardus(Clupleidae). Mol Ecol Notes 7:519–521 Guo S, Thompson E (1992) Performing the exact test of

Hardy–Weinberg proportion for multiple alleles. Bio- metrics 48:361–372

Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98

Hauser L, Turan C, Carvalho GR (2001) Haplotype frequency distribution and discriminatory power of two mtDNA fragments in a marine pelagic teleost (Atlantic herring, Clupea harengus). Heredity 87:1–10

Hey J, Won YJ, Sivasundar A, Nielsen R, Markert JA (2004) Using nuclear haplotypes with microsatellites to study gene flow between recently separated Cichlid species.

Mol Ecol 13:909–919

ICES (1997) Report of the workshop on Sardine Otolith age reading. ICES C.M. 1997/H: 7

ICES (2000) Report of the working group on the assessment of Mackerel, Horse Mackerel, Sardine, and Anchovy. ICES C.M./ACFM

Kifani S (1995) Approche spatio-temporelle des relations hy- droclimat- dynamique des espe´ces pe´lagiques en re´gion d’upwelling: cas de la sardine du stock central marocain.

Universite´ de Bretagne Occidentale, France

Kifani S (1998) Climate dependent fluctuations of the Moroccan sardine and their impact on fisheries. In: Durand Marie- He´le`ne, Cury Philippe, Mendelssohn R, Roy Claude, Bakun A, Pauly D (eds) Global versus local changes in upwelling system. ORSTOM, Paris, pp 235–248 (Colloques et Se´minaires). ISBN 2-7099-1389-5

Knutsen H, Jorde PE, Andre´ C, Stenseth NC (2003) Fine- scaled geographical population structuring in a highly mobile marine species: the Atlantic cod. Mol Ecol 12:385–394

Kocher TD, Thomas WK, Meyer A, Edwards SV, Pa¨a¨bo S, Villablanca FX, Wilson AC (1989) Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci 86(16):6196–6200

Lee W-J, Conroy W, Howell H, Kocher TD (1995) Structure and evolution of teleost mitochondrial control regions.

J Mol Evol 41:54–66

Lluch-Belda D, Lluch-Cota DB, Hernandez-Vaskez arid S, Salinas-Zavala CA (1992) Sardine population expansion in eastern boundary systems of the Pacific Ocean as related to sea surface temperature. 1n: Payne AIL, Brink KH, Mann KH, Hilboni R (eds) Benguela trophic fuiic- tioning. S. gfi: J. Mar. Sci, vol 12, pp 147–155

McMillan WO, Palumbi SR (1997) Rapid rate of control- region evolution in Pacific butterfly fishes (Chaetodonti- dae). J Mol Evol 45:473–484

Naciri M, Lemaire C, Borsa P, Bonhomme F (1999) Genetic study of the Atlantic/Mediterranean transition in sea bass (Dicentrarchus labrax). J Hered 90:591–596

Nei M (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals.

Genetics 89:583–590

Nei M (1987) Molecular evolutionary genetics. Columbia University Press, New York

Norusis MJ (1997) SPSS Base7.5 for windows user’s guide.

SPSS Inc., Chicago, p 463

Olivar MP, Salat J, Palomera I (2001) Comparative study of spatial distribution patterns of the early stages of anchovy and pilchard in the NW Mediterranean Sea. Mar Ecol Prog Ser 217:111–120

O’Reilly PT, Canino MF, Bailey KM, Bentzen P (2004) Inverse relationship between FST and microsatellite polymorphism in the marine fish, walleye pollock (Ther- agra chalcogramma): implications for resolving weak population structure. Mol Ecol 13:1799–1814

Parrish RH, Serra R, Grant WS (1989) The monotypic sardines, Sardina and Sardinops: their taxonomy, distribution, stock structure, and zoogeography. Can J Fish Aquat Sci 41:414–422

Ramon MM, Castro JA (1997) Genetic variation in natural stocks ofSardina pilchardus(sardines) from the western Mediterranean Sea. Heredity 78:520–528

Raymond M, Rousset F (1995) An exact test for population differentiation. Evolution 49:1280–1283

Reist J (1985) An empirical evaluation of several univariate methods that adjust for size variation in morphometric data. Can J Zool 63:1429–1439

Rogers AR, Harpending H (1992) Population growth makes waves in the distribution of pairwise genetic diverences.

Mol Biol Evol 9:552–569

Rozas J, Sa´nchez-DelBarrio JC, Messeguer X, Rozas R (2003) DnaSP DNA polymorphism analysis by the coalescent and other methods. Bioinformatics 19:2496–2497 Ruzzante DE, Mariani S, Bekkevold D, Andre C, Mosegaard

H, Clausen LAW, Dahlgren TG, Hutchinson WF, Hatfield