MolecularSystc-ma c Ics ofPlicari .l and F'e;:i :;.1 (1".ZiY..H·.'...·:
As c o my c etes): Taxo no mi c ImplLc at Ione andpett.or-u ot Ada ptationtorostt trcHolbital; ll
BY
John E. Norrsan
A thesissubmi t t e d to the Department of nt oloqv in part i alfulf il mcnt ofthe i-equlr-eme n tn
for the de gre e of Mastel"of Scien c e
DepartmentofBi o l og y Memori al Un i v e r s i t y ofNewfound land
1995
St.John ' s New f ound l and
1...1
Ni.lhonallib,ary oICaflada Ar.qoSllOOl'lS Wld rJlJlog raphlcSCrvcesBranchBlbllOlMQue oalionale duCanada Ouect lOfldes!lC quisl l/OI'ISel dessetVices blbljogla~es m.IUOWelnjlOn
~~
The autho r has grant ed an irrev ocable non-exclu sivelicence allo wi ng the Nationallibrary of
Can ada to reproduce, loan,
distribute or sell copies of his/herthesisbyany means and in any form or format,making thisthesi s available toInte res ted perso ns.The author retainsownershipof the copyright in his/her thesis.
Neith erthethesisnor subs tan tial extracts fro m it maybeprintedor otherwise reproduced without his/t,erpermission .
L'auteuraacco rdeune licence irrevo cable at non exclu siv e permett ant it la Blbjlotheque nationale du Canada de reproduire,
preter,
distribuerou vendredes copiesde sa these de quelque rnanlere et sous quelqueforme queeesalt pour mettr edesexempl airesdecette thesea
la disposition des perscn neslntere ssees.L'auteurconservela proprlet edu droit d'auteur qui protege sa these.Ni la thesenidesextraits subs tantiels de celle-ci ne doiv ent etre lmprlrnes au autrement reproduits sans son autorisation.
ISBN 0-612-17628- 2
Canada
Morphologicalsimilarity betweenPlicarin, whi c h has sphericalspores, andPeziza, which has elliptical cpo re e , has lead to a gr e a t deal of disagreement over the recognitionof Plicariaas a validgenua. The first objective of this studyW. ' ~l to determineif Plicariare p r e s e nt e d a phylogeneticgrouping of ta xa distinct fromPeziza. Both taxaalso showsimilarity in hewing adaptedto occur inburnedhabitatsfollowing fires. The second componentof this studywa s to compare the patte ru at adap t a t i on tobur n e d habitats inPlicariaandce a a aa .
To determine the phylogenetic relationshipsoftn iceriuto Pezizaandselectedmembers of reeLecc c c e, DNAsequences we r e obtai ned fromthe Small Subunit (SSU) gene,)' Internal Transc ribedSpacer region (ITS-l) and Large Subunit (LSUl gene of the nuclear-encoded ribosomal DNA.
Parsimonyanalysis ofnu c l e o t i d e characters showed that Plicariaand elliptic al-spored Pezizaspecieswith a s Lmi.La r suite ofmo r p ho l o g i ca l ch aract e rs fPlicaria-like-Peziza) formeda close ly-related mo no p h y le t i cgr o updi s t i n c t from otherPC;:iZil sp ecies. This makes Pezizaparaphyletic, wh i c h can be dealt with byallowing Peziza to subsume Plicaria,mergingPlicaria-llkr"!- Pez iza specieswi t hPlicaria, or assigning memb e r s of the Pli c ari a -l ikeMPe z i za gro u p to a separate genu s.
Mappin gof burnasso cia t i o n cha r acteronthe inferred phyloge ny re v e ale d thatsevera l mo n ophy l e t i c groupshaveevol vcd
.ii
if]e sso ctactcn~lithpostfire sites. Al l taxa th a t branchbasal l y within the PlicariaIP licar ia-like -Pezizaclade arepostfire npccicu . This suggests that the ancestral cond it ion is aaeocfat.Lonwith burns.Asimilar relationship was fo u nd wi t hin rhe Pe7.i7.i.I c l adebut onlya sma ll numbe r of ta xa we r e samp l ed [r o m this group.
ii i
Ac kn owledgemen t s
I th a n k Dr. Keith N. Egger fo r supe r vis i ng th is the si sand forin t r o d u c i n g me to the in t rigui ngwor ldof fu n g i . Throughout my thesis,Dr.Egger has showna greatdeal of patienc eand enth u s i a s m for my work. I al so apprec iatedthe stimul<lt ing discussion , the helpin dataanalysis and interpr e ta t i on ill'wejI asth e fi n a n ci a l support that he prov ided.
I alsoth a n k Dr. Steve Carr forhis help fu l adviceand for theuse ofequipment and materials .Aswe ll, I th a n kth e member s of myth e s i s committee Dr.KeithEgger, ur. SteveCa n: andDr".
Da v i d Innes, for helping tosteer my project in a prod uc tiv e direct ionandfo r providingconstru c t ive cri t ic i s m of my thos is.
I tha nk Dr. R.P. Korf, Dr.D.H. Pfister, Dr. K. D. O'DOIlIlClJ andMs. Trude Vralstadfor generouslyprovidingspe c i me n s. Special th a n k s are addreeecd to Mr. QuentinBal d win forexcellen t te c h n i c a l as s i stan c e and Ms.Joanne Gi llamfor helpin revising my th e s i s .Wi tho ut their help, this project wo u l dha ve taken much longer to complete. I also thankMs. Michele Normore and Dr. .tohn Go o d ier for moral support and encouragement.
I thank the Depa r tment of Biology and Graduate Studies [or their financialsupport. I also th a n kDr. Keith Egger, the Departmentof Biology, the Dean of Science andGraduate Studirw for providing financialassistance to attend two acade mic conferences.
iv
Abnt r act; •
Acknowl edg eme nt s .
Tableof Contents.
Llst;ofTa b l e s. Lt ct;of ["ig u res.
tncro d uctLcn•
1. 1Gene ral In t r o du ctio n.
1.2 Hi s t o ry and ClassificationofPezizaand
Plicari a .
Page i i iv
viii ix
1. 3Why PostfireFu ngiOccu r Af t er Bu r n s.. 1.4 Ecological role ofPli cariaand Peziza. 12
1. 5Nuclear RibosomalDNA. 13
1.6 Po l y me r a s e Ch a i n Reactio nand DNA Sequencing. 17
1.7Study ob j e ctiv e.... 20
Na t e rLaI andMethods. 23
2.1 Isol a te s Studiedand DNA Extractions. 23
2.2 Amp l if ica t i onofDNA. 26
2.3 pen Pr oduct Purifi ca tion. 30
2. 4DNA Sequencing... . . ... . . . ... ....•. 2.5 Data Entryand Analysis.
2.6 scanningElectron Mic r oscopy (SEM).
31 32 33
Results .
3.1 Sequence Alignmen t for PLicarLa, pezLza and se lec t me mbe r s of Pe z i zac e a e Util izi ngSSlJ2 , SSU1 and LSURegions.
3. 2Phylog enet i cAnalys is of Pl i cariil , pezI aa andselectmembers of sezIaaceae Util i z i ng SSU1 ,SSU2 andLS U..
3.3SequenceAlign mentAmong Plicariaand Pl i caria · like · Pez i za Species for ITS·l an d LSU Regions.
3.4 Phy l ogeneti cRela:i on s hi p s of Pl icariato Pl i ca r i a~ li k e ·Peziza ..
3. 5 In t r a s p e c i fi c and Interspec i f icVaria t ion Within Pl i c ar i a ...
3.6 Spore Morphology comparisons wi thin Pl i ea ri a
andPIicaria~like~Peziza .
Page 35
35
5 .
GO
3.7 Patternof Adaptation toBurned Habita ts . G"
ois cu s s ion .
4.1 Phyl o g e ne t i c relati onsh ip of Pliearia to Peziza.
4.2 Taxomonic Implications fo r Pli c a r i aand Peziza• ....•. • .
oj.3 Relationship of Plicar iaand Pezizato other genera with in Pezizaceae.
'/1
Page '1.'1
xe
l cuedne su ofPlicariataxa.. . . ....• .•.. 79 'I.SReLatedne s s ofPli ca ria-like ·Pezizataxa 81 '1.6Adaptati ona.nr!Sp eci ationonBurnedandDis t u rbe d 51 te s.. ...
conclus ion s.
t.jternture Cited ...•. . . .
vi i
••
B6
as
Ijgt Of Tables
Table 1:species, Lec f a eee , sub st r a t e s and locat i o nof Peziza. Plicariaandsel ecteeeee ra of Pezi zaceile... 2-1
Table2: Olig o nu c l e otide PCR andsequencingprI ee re.. ...
viii
;Uet of Figures
Page Fi g u r e1. (A) Schematic deue Lleddiagram of a single185- 28S repeat unit. ITS" internal transcribed spacer region.
external transcribed spacer" ETS and IGS " intergenic spacer. (8) Schematic representationof a tandem array of
rONA repeats. 15
figure 2. Temperat ures and time during which denaturation, annealing and extension occurduring a PolymeraseCha i n Rea c ti o n tsc e i . Zero to eight.minutes equals 1 cycle {ba s e d on Perkins Elmer Cetus) ..
figure 3. Schematicdiagramof 18S-28S repeat unit showing PeR primer location. ssua designates the r-eq i.on flankedby primers NSll-12. SSUI designates the 3' end of the SSU amplified using primers 1TS9-10, 1T5 - 1 designates the 5' ITS region amplified using primers TS9-l0 and LSU designates the region flanked by primers NL5-8. Highly conserved regions are indicatedbyYPA, moderately conserved r ec Lons are indicatedby~and highly variable regions are indicated by _ .•. . . •.. . . .. • . . . ...
Figure 4.Aligned sequences for all 23 taxa for SSul.
Isolate reference numbers follow the sallie coding as found in table1. Base positions are indicated every 50 bp . Gaps
I.
27
are representedbydasnes . ... •. .•.
Ix
..• 36
1'. 1<1<' Figure 5.Al ig nedseq ue n c e s f"H-alL:U t.,l :<:dC,' IIL,l i llin,),l portio nofthe T. SUrD1'<Arepe.r t . J~;()l.Il·I' l"~,r l~l -'~I\< -t'\l\UlI!>"!' '' foLf cwthe same -ocuncas foundintobte J.aaoc-P(.,~j liOII':
figure6. Al igne dsequence's for 2:; I'.d :'c1r-ontaiuiuq,I1"' 11i''11 of the SSU2rONAi-epeat. rs oLw.."t..ts-rr-nc c Il\l!U!leol ';1,, 1 10\,' thesamecod i ng asfound intclb lcL. Bel'-'I.'P",\jIi,11\' :.11,- indicatedevery50 bp . Gap sarerepte,;e ntl-d by dd,:lrf·~~ . .1. ~
Figure7.One of 3 tr e esmo s tpars imoniouuIn'('~:'I('III ' l oI!.,·t!
of 595 stropsinferring t.be phyLou enetic l'f-!ldtioll,;ll il'{II plicariatoPlicaria- l i k~-Pez i::d, Pe z iz,».1Ild,\( ·11.,,:1 1,(1111" 1111,,"' \ of sea daeceae. Max.imumpars ImonycllkltYSl Hw.rnPl-'IIl"IlI(·t1'H) the ss u i • SSu2and LSU data set.'1'he numh,·!"" .rho vr-t.ln- branchesindicatethe number ofm.cleouidodlo1t '-" ;\ 1.'1cJ:.' I H JC'~ ; per nod e .Th e o I adoqt-sm vres qener at.eduninqt.he-JWlll ;~;I-i(' optionof PAUP3.1 q ..
Pdq e
lei 'I 'II "k. fI,,',1 :;1 1" 1' [). ' I ::i ll1',rf! ,.,ndlysi:o;tor 22 ta;':21 'd,ilIZin'!:::;111. :;:;11:-..m'l L:~Ud.lt,l :;", 1:f"t"Pliceri.r,
IUlIn!"..,:;.,1,,, "" tI,,· L: .;.11,1"1..-:-;i:,'.1Lc ,' t(, r:[H::l"centdqe!of support .' ,fn I", h,....hn,,']r.d'·1(·llhinr.·drromiOGboot.s.urapre-plicates . -rt«, c[.,'I"( JI·J II,'J/. , ::'Je·n', r" te d II.i nq rheboutst rap ana Lyei s
.. . ... 48
J'lI IT~;-I rr-qirinlillI/I Il·P l.·dt. TsnLH8 rererence numb er s
j"IJ'M11,, ·:;01111" ,·,,' l i n ,!,'~.; found in table1. BiI~E:po a Lrio n e
I'iq\l l '~ 10.Onr-or 3mosr oarsIeontoustreesof173steps
II)[Olrinu lhe!pby l o G"'Il",tic rsjarionsnip of sn iceri-rto /'1ic',ll"
i.'"
I ike-Pc'"i z-s, Na:·; i mliltl pars imony dnalys iswasPPI(OJ1I1-~doncombine-d nucleotidecharacter s utiLi zinq ITS- l
,"lliJ1,5 1JrDiJAddt,!uete .1'1.",numb er s abov ethe bra nc h es in,l i(' ,'l \(-~r.honumbe-r-of nuc leori decharact-erchange s per nod e . TheclLld o <Jl"d lU ,",'<1 5ue ri ero red usi n g thebran c h and bound
"p l.ioI L(l[ PAUr 3.1q. 53
1\ \11('
figure 11, acors crepp,l Ts i mony .1Mly~i $ftl. F'li,-,I:"i..,lmi Plicario - li ke ·rC'.:i=,f raxaliti Iizinq ("'lInt-in.>,1 IIllo"i . ',lli,l<' cha r a c t.e r s from11'5-1 and1.SI1.-00"'\dara~: "l::, rn..1l111nh."'I""
abo ve the bra nc hes Indicarepe rceuraqe uf ::uPf'l"n ..',0:'.
'0.
ea c h nod e dece rmfned (t-Oln10 0 0boot.atre pIt'p \ i",llc-u. "l'h p cl a dog ra mwas 9l'<net"ilt edtlsin<)thebootntrap.1ll.Ll y: ;i~ :hl". \Ilc h and bound opti o n ofPAUP J. l q, •.,.
Fig u r e12, Bo ot s trap parsimonyanuLys LsrOI rtic.ni.,,Inri plicari a - l i ke- Peziz.itd,;.:cl utiLizlnqco mb i nedllll e l l! , )lldr- ch a rect er s fromIT::;- l en d LSU l"DNf'.d,lt,lHf'-t.::rUI
r,
'.',
diff e rents<lmplino s.Al Pt'!Zi Zdvec inii"mi t t.f'Li. Il) Pli".,r i ..
endocarpoidesomittp.d. C'JPe;:i ;:.~ostr,I C()(}('t1IUomitt.r-rl , ,11).1 DJPezizaetrovino seand eezizo b..1di.1 omilt l,d. 'rm-wu"I..-.'!'!;
abov e the brercn es indi cates pe rcen t.a qeo(~1I J.'[IUf t. .·',U', 1m eachnode decere.Ln edfr orn 10 0 0boot.at rapp:-r, lj .; ..at.ou."l1e cla d09 r am was cener ecec usrnq t.heboctsn rap.-\n<'llYf;i~:h,.ll10:11 and boundopti o n of PAUP3.lq ." , ..,.•,. , ." ".." . ,.,',"
Page Figure 14. Aligne d Plicaria sequencesfor ITS-l regionofthe rONA repeat. Is o l a t e reference numbersfoI Iow the same coding as found in table1. Baseposicicns are ind ica t e d every50bp.
Gaps arerepresentedby dashes ... . 61
Figure15Scanningelectronmicrographsof escosporeaof four Pl i cariaspec ies. A)Plicariaendocarpoides, B)p]icaria trachycar pa , CIPli c aria cerco ne r i e and D)PI icari a acanthvdi c cyasca lebarequaLs 2J.Lrn•••••• ••• ••••• •
Figure
ie
scanningelectronmicrographs of ascosporesof four membersof pli caria - like-Peziza.A)Peziza vacinii, B)Pezi zaatrovi nosa ,C)Pezizaostracoderma and 0)Peziza badia.Scalebar equals211m....... 64
67
Fi gu r e 17. Astr ictcons ensus tree in f e rri ng adaptationto occur on postfi re or disturbed habitat s inplice rie, Pl icaria -l ike -Pez iza andothe rmember s of Peziza. Maximum parsimonyanalysiswas performed on combi ne dnuc l e o t i de characters from th e SSU1,SSU2 and LSU.Branches showing line a ge's whichhave adapta t ion to occur on fire are indi c t edby cross-hat ches (. ) .Thenumbe r above branches tnda cet en percentage of support for each node determined from 100 bootstrap rep l ica t e s {>80%) .
xiii
.••.70
Intro d uc t i o n
1 1General Intr o d uction
Ares urg e nc e of intere st infungal evolut ion ha s been inspi redbythe combinatio nof two unli kely pa rtners , phylogenetic systemati csandmoleculargenetics (Blackwell, B94) . Thestudy of phylogeneticsstar ted in19 5 0 when wil l i Hennig published "Gru n dz u ge e i.ner'rbe o r Ie der
Phylog en et i schenSyst em atik." Thismet hod attemptsto recons t r uctgenealogical relat i ons hipsamonggroups of and has allowed resear che rs to develop cla s si f i c a t i ons that refle c tphylogenetic:relat ionships (Wil ey, 1981 ) .Th i s systemof empiricalcharacter analys isproved to be a powerfultool but thenum be r ofmo rphol ogi c alch aracters limite ':l.it s usefu l ness (ZambinoandSz abo, 1993) . Man y au t h o r s also felt that homopl a s ics werebe i ng introduced into characteranalyses whenau thorsmistake nl y identified ana logouscharactersas being deri v e d froma recent. common ancestor (Smith, 1994).
Advan c e s inmo l e c u l a r ge net icsha ve all owed systemat is ts toinc r ease the numberof characterswhi c h can becompa re damon g t.axe . This startedin 1987 whenMullisand Faloonapublisheda pap erdescribinga method which allowed for enzyme-medi at e d amplif ic atio n of DNA. Thistechni que, calledthe Polyme r as e Chai n Rea c t i on (ec m, allowed rrcm- molecularbiologi ststo utiliz ete ch ni que s such as DNA
sequencing.The introductionof nucleotide sequencing allowed for the generationof large numbers of charac ters tihat could be analyzedusing phylogenetic methodology . Lar ge data sets of molecular characters could be used to generate ph y log e ne t i c tr ee s which could be tested st.atis tic a lly
(Tayloret a1.,1993).
Nu cle i c acid sequenci nghas become the techn iqueof choice for mycologistswh o areinterested in resolving systematicquestions. Th i s methodallows theresearcherto select a gene or regionwi t h theappropriatedegre eof variation. Suchflexibilityhas allowed auth o r s , such as sogin et al. (1989) andVan de Peer et al. (1993), to cre ate a rnuI t.Lk lnqdorn phy logeny based on nuclearSmallSubuni t Ri bos o malRNA(SSUrRNA) sequences.Similarly, Int ernal Transcribed Spacer ribosomal DNA{ITS rDNA } seque n c e sha v e be e n used to different iateat the population, sp e c i e s and ge ne ric leve l (Kim and Janson, 1994; O'Gorman et;al. , 1994).
Mo l ec u l a r sequence da t a havealso allowed for the incorporation of anamorph andteleomorph stagesinto phylogenetic studies, a t.a s k thatis difficult, or impossibleutilizingonly morphologicaldat a. This has bee n especiallyimportant to mycologists, who ha vebeen abl e to infer anamorph- te leomorph (a s e x u a l - s ex ua l ) con ne ct i on s (Egger and Sigler, J..993 ) aswel l as the phyl og enet i c re l a t i o n s hi p s whic h exist. among mitotic and me i o t i c ta x a (Lobuglioet a1. , 1993; Lobug lioet al., 199 4). Fina ll y ,
sequence datahave allowedresearchers to resolve sy s t ema t i c qu estionswhenmorphologica l char actersarein conEILe t or missing taerbee andTaylor, 1992 ; SpataEor-aand Bl ac k well, J.994) .
The pu r po s e of thisstudy wa s three-fold: ijco assess the phylogeneticandtaxonomicvalidityoEthegenu s Plicari a Fuckel emend . Boudier within the pesiaa c ea e 2)tc assess th e phylog e neticrelationshipof Plicariato a group of morphologica llysimilarPeziza L.species, andJ)t.o examineth e evolut ionofthe eco logical asso ciationwit h postf irehabitat s inPlicariaand Peziza. This study focuses on thephyloge neticanalysiscf nucleotidechar acucr-e obtained from the Smal lSubunit (SSU)gene, Internal TranscribedSpacerregion (I T S ) and Larg eSulaunLt;(LSU) gene of the nuclear-encoded ribosomal DNA.
1 2 Hjstoryand Cla s s if i c a t i o n of pez jzaandpl~
The familyPe z izac e a e, wh i c h is a me mbe r of the order Pez iz a les, has hi storically includedmo ntof the larger, cupulateor sessile, operculatediscomycetes (Seaver, 1'12 8; Le Gal. 1947; Korf, 19 5 4 ;Kimbr ou g h ,197 0 1.Ac c o r d in g to Ki mb r o ug h (1 970) , membersof th is Eamily a r e deecr-L b e d,IS hav i n g Oe docephal ufIl Pre u s s orChromelosporiumCo r da conidial stages, amyloid as ci, and smoothor ornam en te d spore s . Tradit i onall y , thePezi zaceaehas included th e four genera Pezi z a , Pl i COlria , Sarcospha eraAuerswal dandPach ye l l a
Boudier. Howe ver ,additionalge neraincl ud e d in the family at one cimeor anot her ar e Iodophanus Kor f , Thec o theus Boudier , Boud ieraCooke, Spha erosoma Kl ot zs ch and ot he rs. Oneof the major reasons fo r disagree me nt is that the ce c rsionsas towhi ch characte rs shouldbe us e d to de lineate a famil y ishi g hl y subjective . Al s o , as pointed out by Dis s i ng (9 7 4 ) , the charactersthat are us ed todis t in gu i sh p l Lcerie from BoudieraIpe a Laace ae} , Sp ha er o s omaxf.o t.as ch {P'y.r-one met.ace a.e I andSphaerozoma (Peziz a c e a e ) are not at all c Le a r .
Ty p ific a t i onand nomenclatureof gene r a found inth is family are alsoproblematic.1\considerable degree of controversy has surroundedthe largest genus foun d inthe ee ataeceee. ee el ee , anditsdi s t i nc t i o n from the closely- relatedgenus, Plicaria.Pez i za ha s beendescr ibed as possessingcup-shapedto fla tte ned, sessileor ve ry shor t stalked , apotheciawiththi nre c e p ta c l es an d brittle· fl es h , ascus tips th a t tu r n blue in iod i ne, andlarge ell ip tical spores wh i c h are either smoothor orn ame n t e d (Dennis, 19 81 ) . Thisdescrip tionis si milarfor Plicari a that isdes c r i bed as possessing dar k cup-sh a pedto flatt en ed apothec ia ,ascus tipstha t ternsblue in iodine, and sp herical asc ospor e s th at ar e eithe r smoo thor or namen te d (De nnis , 1981 ).
Presen t day controve r s yoverPezizahad itsbeginnings in 1719 when Dilleni us(c it.edinRifai,1968 ) int r o d uce d the name pe zfza, Si nc e thatt ime, this genus , li k ema n y
classicalgenera, ha s underg o ne nume r ousame ndme n t sand in t e r p r eta t i ons. In 1754 Linn a eusadopt edthe namePezizil in
"SpeciesPlantarum"and"GeneraPla n t arum", afte r- which the name Pezizahas been foundin thefunga land botani cal li t e r at ure. Plicariawas first int r o d uce d by Fuckel ill 18 '/ 0 (cite din Korf , 19 60) when he transfe r r ed several ellipt ical and sphericalspore d ta x a to thegen u sPl i cad a . In18 8 5, Boudier re s t r i c t e dPlica r iatosphericill-spor, " ~ taxa. In 1907 , inhisboo k "Histo i r ee c Clas s i fi c a t i o n des mecc myce t.ee d 'Eur ope ," Boudi er use d the name Aleuria (l~ r , ) Gill todescri be t-axa th a tha d smooth egu t tulat e sporesand thenameGalactiniaCo o k e fo r ellipt ical-spo red t.exawhi c h pos ses s edbo th sp ore orname nta ti on and gut t ule s. For th e next 80 years, nume ro us classificat ionschemes we re deve l o ped byauthorssuchas Rehm (1 8 87~1 8 96). whoused Plicariasensu Fuckel,andSe aver (19 28). Howe ver, in 1953, Le Gal publ ished "Lea Di s comy c e te s de Madagascar"whi c h marked a turning pointfor th e nomenc l ature of thetwo genera when she suggested that the genus name Galactinia shouldinc l u deAleuria. Under care ccnne . shein c luded two sections:guttulisporae andeg u ttu l i s porae .
Aut horssuchas Dennis (1 9 60) . Ba tra andBat.ra (1963) and Moser (1 963) argued thatPli ca r iaisvalidly separa ted from Pezi za. basedupon shape of the ascospores. However, in 1960 , 1<or f compiled a detailed historyof the genusPliCiJria inwhich he argued tha t thesphericalascospore character
was not; cuttLcfent towa r ra nt a genericdistinctionand merqnd ptica r LewithPeziza.This argument ha sbe e n followed by;:Jnumber of authors such as Le Gal (1963), Korf(1960 ) , trent con (196 3 ) and Berthet (i9 6 4) .However, Denni s (1%0,1%8) , Bat ra (1961), Rifai(19681, Ec k b l ad (1 968 ) , Dis ni n g and Kar f (l980}, Dissing and Pfister (1 9 8 ~ ), Egger (1987) and Moravec and Spooner (l988) allsug gest edthat Plicariclmay be avalid genus, based upon a suite of charactersin addition to spore shape.Diesing and Pfister
(1 981) argued that thePlicaria genus concept isva lid bec au se membersof thi sgenus representa na t u r al group ing of npe cie s th a tis uni tedby a suite of cha racte rsthat
Ln ctude dark fruitingbody pigments, pa r a ph y s e swh i ch adher e
toone another,Chromelosporiumanamorphs, a carbonico lous habita t , and an excipulum that containsglobose andhyphal elements.However, all of these char a c tersare found in elliptical-sporedPezi za species.Cla ss i f ic at i onof Pe z i z a and Plicclria wasfu r t he r compli catedbyEgger(1987). He compared the ability of Plicariaand Pezi z a tooxid i ze tyrosin a se substrates .Resultsshowed that al l Pli caria species and three Peziza spe ci es had apositivere ac tion, whe r e a s most Pe zi z a species hada negative reacti o n . Eg ger al s o noted that the thr e e tyrosinas e po s it ivePe zizaspecies
(Peziza atrovinos acook an dGerard, Pezi z a ostra c oderm a Korf and Pez izava c i ni i (Velen .) Svr<::ekl share d seve ra l mo rphc Loqica L charact e rs suc has Chromelosporiumana mo rphs
similar toPlicaria.From this information, Egger suggested thati t maybe necessaryto expa ndr hc Plicariilgenus concept to include several elliptical-sporedspecies.
Mo r a ve c and Spooner (198B) add e d more auppoi-t,to this theot·y by poIn tLnq out that a nu mberofmorpho logica l cha r-act e r-n, suchas brown sporecolour,seemed to link eevera I re:;iZ~l sp e c i e s whi c h had chromel osporiumanamorphs , totnLceria,
Adequate mono graph s ofPezi zaand Pl .icariado not exist, there f oreseve r a l different circumscri pt ionshad be followed. Inthi s study, I us e d PIi ceri a trac hy carjJ<l (Curr.) Boudier,Plicaria endocerpoide e (Berk.) RifaL, Pezizapetersii BerkleyandCurti s, Peziza preecervism Bres.• r'earaa victeceaPersoon, eeeiee relJd nd,lPersoonand Peziza vesiculosaRulliard illthe senseof reltat (1 968).
How ev e r, Rifai (l96BJmistakenlyrefe rredto Pezh:a pr a e t e r v i saby the name eeelzo t::en<lce llaPhLl.L. reeleo cen ec e zte isve r y similar toPezizapraetervis,lbuthaa smoothspores andenLa rqedpa ra p hys e s (Egger. 1987).svrcck (19 76 , 1977) cl a imedt hat, the correc t. name for Pezi z<.1 violacea isPe z iza lobul a t aIveLen . } Svr c e kl and thatthe correct nameforPezizapraetervisais eez izeeunvtoln o e o avrcek. I us ed the concept of Plicaria cnrbonertn tpuc ke Ll F'u c kel asdescribe d byMaa s ueesce r anus (1967) un d e r the na mePezizaant h r a cina Cooke. I alsous e d thefollowing co n ce pts :Pez i zaar vernen sisBoudier, Pezizaatr-o v rncee, Pe zi zabadia Pe r s oo n ex . Me r a t ., Peziz acereasowe rcvex.
Merat., eez i zo echinospora Ka s s t ., Pez izaostracode rma, peeizo varia {He dwi g} Fr ies, Sarcos phaeracrassa (Sant i ex.
sueuoeLj rou aa (all sensu Dennis, 1981), Plicaria acanthodictyaDissingandHauerb ach Wissi ng ,1974) , Kimbropezia ciJ.mpes tris Korf and Zhuan g (Korf an dZhu a ng, 1991), r-ear aa phyllogena Cooke (Pfister,1987), Pezi z a quel cpido tia Kerf and O'Don nell (Korf, 1973) Peziza vacinii (svr eck, 197 7 ) , Glischrodermasp. Fuckel (Kerf , 199 4 ) and Pachy"'·d la c1y p e at a (Schw.) Le Gal (Pf i ste r, 1973). Final l y, I am uaLnq Pezi zacfr.linteicola Phill.and Plowr. to describea Pezizasp e c i e s that has brownish ape t he c i awit h a 'ye l Low l-rymenLurn and eguttu la tepunctate -roughene dsp o r e s whi c ha re 13X') 11m.This species appearsto be very simila r to Peziza linteicola (Arroyo and Calonge, 1989;Eck b l a d, 19G8) .
1.3\~h y PostfireFungi OccurAfter Burns
Ascomycet esbel ongingto the ord erPezizales common ly inha bit burnedforest areas butus u a l ly only wit h in three yenr-s of the fire (Petersen, 1985).This ha b itat ,wh dch is ephemeral and constantl yshifting, would be expected to place special constraintsupon the abilityofthes e fungito adapt and spe cLa t e. Thi s ispa r t i c u l a ri t y impo rtant to Plicilria species whi c harenorma llyfo un d on po s t fir e sites and to a le s se r degree Pezi za spec i e s wh i ch can oc c u p y either burned, dis t u r be d , undisturbed sit e s or a co mb ina t ion
of sites.
To explainwh ypoetfLre fungi such as Peziza and Plicariaoccur in such a transient habitat, anumber of theorieshavebe e n deveLopad . First, ithas been suggested that some postfire species may be reacting to the heat or chemical changes produced P" burning, which re Lea ses them frommy co s ta si s (Petersen, 1970";Wicklow andzak, 197 9 ) . Petersen (1970~) carriedout germinationstudies on several postfire species. Resultsshowed thatPlicari<1
endocarpoi d es, Pezizaecninoeporoand Pez i za prae t e rv i s a germinate readily in water but heatingmay increase germinationpercentages.Secondly, specieswhi ch inhabit burned sites may tolerateor'qa:"c byproductsthatarc created duringth e burning process (Petersen, 1970"; Wi d de n and Parkinson,1975).Astudy carried out by Egger(1986) suggeststhat Plicariaendocarpoide s , Plicariil triJclJycarpiJ and several Peziza species producea number of different de g r a d a t i ve enzyme s that include phenoloxidase enzymes . These enzymes ha ve been implicated in the breakdo wnof li gn ins and detoxificationof phenoliccompounds, whi c h are as s o c i a t ed with burns.Thirdly, afte r burning, the heat from th efire may sterilize thesoil or greatly reduce natu ra ll y occurring miroflora and fauna thereb y reducingcompetition, allowingsomeof theless competiti vespeciesto flourish {Wicklowand Hir schfieln ,197 91. 'rx Le is supportedby competi tio n studiesthatsuggestthat man y past-fire
10
PIico c i o and Pezizaspec i.esar e poor compet itors (Egg e r , unpubIisshe d dat a) . Sagara (199 2) furth er added sup port to th isl:h,c,or y when he fo u n d Pez i z aos t r acoderma growingon Ga ilLh c t; hc d been chemica ll y st e r i lizedusing Ca CNp This chemi cu1tre atme n t; issimilar to burni n gin tha t it generates heatan d pr od u ce s ash. Fou rthl y , it has been auqqested that thesefungi ma y have adaptedtothe pbvs Lcochemi c a I en vironment whic h is crea ted by burning (E1- f\.bYild an dWebs ter 196 8 ; Petersen, 1970~).Stud ies ha v e shown t hutmanyPez i zc1 andPlicari aspec .ie e are normally fou n d growi ng all bur n e dsoil s th at have ele v a t e d pHle v e l s (Pe t e r s e n , 19'70"). Ho...ever ,by artific i all y incr e a sing soil pll l:y Limfnq , postf i r e specie s such as Pezizapraetervisa (Petersen, 1970") andPeziza ec h inosporaU:;agar a , 1992 ) have been e c Lrsuja t.ed to fruit on un bu r n e d so il .
r-tcmy pe a.i aaandPlicari aspe cie s tend tobe associated wit hdi s t u rbance . The se disturbances can take manyforms, such<'IS burn i ngof so il, so i l co mpa c t. i o n, excava t.ions, upt u rn e dea r th , riv er banksand othe r s (Pe t.e r s e n, 1985).
suucneehave been ca rr i e d outtodet ermine the edaphic factor or Iectcrs whi c har e of pa r t icu lar signi ficance to the s edistur b a nce medi a t edspe ci e s. In severalst.udies, nume r o u s fact o rshave be e n examinedsuchas minerals nutrie nts, so ilpH, orga n icmatte r, surrounding t.ree and sh r ub sp ecies , con d uc tivi tyan d othe r s (Pe,cxa e n 1967;
197 0"; 19701' ; 1985).Howeve r,pHand organic mattercontent
"
appe a l' tobe the onLytwovariables that canbe co rrcl.nod wi t h the occurrence ofmost epeeLos (Pe t e r s e n , 1985).'ruese compo n en t sm",y be of parti cular Lnipo rtance to theoccurre nce ofpou tcfd re spec ie s aftci-abur-nbecau sethe surtec osotI pHus ua l l y in cre as e s and the organiccontent:dec r ease s
(Pe t.er aen ,1970" ) . Otherstudie s hav e alsofou nd" lin k betw e en arti f i c i al ly elevatingsoil pHby limi ng an dthe occurrenceof po atfLre speci es onunburned soil {peuorscn , 1970"; Turna u et al . , 1991;Sag a r a, 19 9 3) .
Membersof Pezizaand Pl i c<l r i aare rest r icted to burn ed sit es todif f erent degree s .There isa conttnuous progression fr om burnedtounbu r n ed si teinha biti ng spoctou. Wi th thisin mi nd, ma ny authorshave fou n di t uacEu I\.0 es t a bl is h groups basedon the abilityof these tunqI to oc cu p ybur ned , unb u rne dorboth ty pe sof hab i t a ts (MolJer , 1949; Ebe rts , 1958; Peter s e n , 197 0"),TheLjr-et. qroup in clude s spe ci esthatar e fo u nd excl u si ve l y or, burned nftoo . Members fro mthisgroupth <lt we r e ccmp a redinthi s HI.Uc! y in cl ude Plicaria carbona r i a, Plicaria tr ilcllyc a r(J<I, Pc:dz,1 echinospo ra, eeeieope te rsii , Pez izavio la c e c'l(peterncn , 197 0") , Plicari aac a n thodictYil/Dissing 19"fi1) and Pc;ndz,]
vacinii (Mo rave candSpo o ner , 1981l) .The seco n dgr o up includestho s e species whi ch unde r natu ra lcondlt Lcouoccur onburne dsites but ma y also occu ron unburned site s if'thr~
soi l has been alt eredbysomeartifi ci al mea nsnuc bas liming. Se ve r a l exampl e s of th i o gro up tha t were used in
12 thinntud y incLude el ioor ieendoc ar po i de s and Peziza priwr:c r v i sa tPet.e r-aen , 1970 ") Co ll e ct ively, these two
~JT01J r)Drmk oupthe "o bl i ga t e bur nsite sp ec i e s" (Pe t e r s e n , ]'.00').Ath ird gr ou p. called the "facultativebur nedsite
~J pf!cj(m" in clude tho s e (ull g i which occur oneithe r burnedor lItllJlll'fL{l, jRites.recur tativeLu rnedsite spe cies th a twe r e Il:J"d ill thin stud y includepea raa varia, Peziza repanda, voeizn ovverneneie and Peziz a ves i culosa (Pet e r s e n , 1970~1.
f'vz ;:-:aos r.raccde rma is placed in the faculta tivepastfire
<J1"OIiPcoven though I ha ve foundnorecordof itoccurr ingon thrn Ililhiti'lt.The r easona for doing so are two fold, 1)the apo thectaof l'ez iza ostracodermnare mostly foundon stetj1 ized !3o -i.!, whic hshares a numberof ch a r a ct e ris t i c s with bur ne d soil and2) He n ne be rt and Korf 1l9 75l have found cnrcoo ioeooc ium anamorphs grow ing on burned soi lthat they haveident ifie das belong i ng toPez i z a ostracoderma .A Lourrhgroup offung i wh i c hwereex a mi n e din this study inc l udedth e non-b ur ne d sit e species. These are dLsujuquished [ro mthe oth e r groupsby thefa c t that th e y hav e neverbeen fou nd on burn edsites but have been fou nd on dint.ur-bed sites.The s e Ln cLud e Peziz a atrovinosa(Moravec and Spo on e r, 198 8 ) , eeeize badia (Pe t e rsen, 1965), Peziza qtlc 1epi d oti", (Ko rf, 197 3 )Kimbropeziacamp estri s (Korf and Zhu'lllg 1991 )an dPezi za cerea (Ri f a i , 19 661.
.1...4 Ecologica l roleof PZicar iaandPez:j?d
13
Mo s t Pezizaand Plic<11-iaspe ciesare found only in forested regionsand thisha s leadto hyp o these s reg arding the role that thesefungiplay in forest ecolog y. Both generaare probablyrepresenta tivesof the wo o d andwo o dy root decompose r co mmuni ty (Eggeran d Paden, 1986;Egger, 1986) . Wood and woody rootdecomposers produce a wi d e rauqe of enzymessuchas cellulasesand phenol oxidases that are capabLc of degrading ligninand are considered to be indi cat iveof a moregeneralized modeof subs trate hyd rolysi s (Egger, 1986).
The forest fungal co mmu n it y beforea fire consi stsof spec iesthat are specialistsinth a t they p rod uca a limit ed number of extra cel luarhydr olnses . xowever . aftera fire the fungalco mmun it y shiftsto speciesthatarecap a b leof producinga broad rang e of enzymes and a more generalLa ed form of substrate hydrolysis (Wick low and Hirschfield, 1979 ; Egger, 19 8 6).Th e s e general istshaveevolvedlifehi sto r y st r at e g i e s such as fastgrowth for rapidly coloni zi ng ha bita ts, sho r t reproductive cyclesandhomot ha llic ma t i ng that allows themto exploit th i s short lived, consta ntly shiftingha bit a t (El-Abyad and We b s t e r , 1968; Egger,1986).
l...2...N..t.!£l.~gLlW2Q~
RibosomalDNA(rONA) has becomethe mo le c u l e of choice for many fungal molecularsys te maticst u dies. Thid re g i on becamepop ular whe n systema ticstud ies were basedon
14 r-tbo n oma l RNAseq u e nci n g.Th e RNAte mpla t e was originally uned because it was conse r va t i ve and Larqe amounts could be excroct.ed (Bru ns et al., 1991 ) . However, with the deve l opment,of peR, rDNAse q u e n c i n g replacedrRNAsequencing becau s eit wa s faster. more accurateand no t subjectto post trun ssc r LptLon a I edi t i ng (Bruns et al.• 19 91) . The popularity of this reg i onis par t lydue to thepr e s en c e of highly conserved regi o ns whichcon ta in interspersedvariable eIements .Th e nature of rONAtnu.rgiv e s researchersthe
flexibilityto analyze a wide rangeof phylogenetic
relations h ips trc z-e ter etal. , 1990 ; Zambinoand Szabo, 1993 ) . It alsoallows fo r th e designof primerswh i ch amp l iFyacross va ri a b l e ele me nt sbut are anchored in cons erv ed r-eqion e (Bru ns etal., 19 91 ) . Ribosomal DNA is aLeo fou n d in high copynu mbe r s and veryl i tt l e material is neededfor amp l i f y i n g and sequencing.As we l l. large numbers of rDNA sequenceshave been generated and stored inda ta bases suc hasGe n b a n k . This allows researchers to draw quick lyupon the dataof ot h e r s for comparisonan d ana lysis .
Th e org a n i z a t i o nof the nuc learribosomal DNA tandem repeat uni t is shown inFigure 1 and consistsof 3RNA stru ct u ra l co mpo n e nt s usedin theconstructionof ribosome s.
'rtie se comp o n entsco n sis t ofth e 18S subunit, which isal s o called th e sma l lsubunit (SSU rDNJl) , the 5.8S subunit and the 28S subuni t, whic h isalso knownas thelarge subunit (LSU l"DNAJ. Flankingthe 5.8S subunit are two interna l
l'.l
B.
F'igure1. (.~) Schematicdiaq ramof.:0sinqloIB:;-::!H:irepcot unit,IT S",.in t.e rneI r r-an sc ribed spacerrr-qlon . 1~'I':i~ c;.:ll-rlldl transcribedspacerandIGS'".int erqe nLc:'i1"kICl·J".(II);-jc!lPllIilrir ' representat ionof Cl tandem arrav of rfJI-lAtepo o rx.
16 tr a n s c r ibe d spacer regio ns wh i c harecall e d ITSl and ITS2. These two componentsaretrans c ri be d , but are spliced out and degradedberore ribosomeconstruction. Asecond regio n which istra n ecr Ltedbut sp li cedout and de g r a d e d is cal led theexternal tr a ns cribed sp a c er . The firs t spaceris attac he d tothe S' end of the SSU gene and these c o n dsp a c e r is found on the 3' end of th eLSU gene . The threestructural comp onentn, the two ITSregions andth e two ETS regions representa tra n s crip ti onalunit and is se pa r a t e d from the precedingan d follow ingtranscriptional uni tby the non- tra n scri b e d inte rge nicspa c e r (I GS ) als o known as the 110n- tra n s c ribe d spacer (Si ng erandBerg, 199 1 ;Rocheford, 1994).
The re q f cnewhic hare mostcommon ly usedin phyloge ne ticanalysis aretheSSU, ITS 1 andLSU.Thenuc l e a r small subunit has mostlybeenusedto resolve at or abo ve the ord er le v e l (F6rste r et aI., 1990,Ber be e and Taylor, 19 9 2; Spa ta foraand Blackwe l l, 19941.The 5' end of the large subun i t whi c h includ e s two va ri abl e regions. divergent domain 1 (01) and dive rge nt domain 2 ID:!),are more variable th a n the SSUandhasbeen usedtoas sessthe phylogenetic re l at ionshipsat the genus and specieslevel.Th i s region has been used to cre a t e phylogenies between closely related genera, (Peterson. 1993) species (Guadet et aI., 198 9;
Sherriff et al . , 1994) and intra- species level (0'Donnell, 1992;Moncalvo et; aI. . 1993)...nalysesof ITS- 1 and ITS-2 have demons tra te dthehi g h e s t degreeof variation.Studies
17 have used these two regionsto determine relation s hipsamong closelyrelated gen era (Carboneand Kohn , 1993). spe c ie s
(Lee andTa yl o r , 19 9 2) and populations (E=' r 1 t z et a1., 1994). aecene
rv
a number of studdecha v e combined data fromthe LSU(0 1 and02) and ITS regions to determinedph yl o g e n e tic relation shipswit h i na singlegenus (Sherr iffet al. 199'11 and betweencl o s el y rela tedgenera (Peterso n, 19 9 3 ).
1 6 Polymerase Chai n Reactionand DNA. Sequencing In 1987, peR presented itself as an alternativeway of amplifyingDNAor RNAco n c e a l e d wi th inla r g e chainsof polynucleotides .Thiswas less laboriousandno t as erro r
prone asth e more tr adi t i o n a l techn iqueofcl o n i n g, This te c h n i qu eis an invitronuc le i cacidsynt he s is process whichuses DNApolymeraseand ol igonucleotide pr i me r s that fl a n k the region wh i c h isto be ampli fied .Thepurposeof peR is to duplicate the nucleotidesequenceof eachstrand betweenthe twoan neale d primers.Th is is accomplished by repeating a three step procedure of denaturation, primer anneal ing and pri merex.tensionfor a predeterminednumber of times (Figure2) . First, a crudeextract of DNAis heated BO that th e doublest r a nd e d duplexdenatu res, re mainingfree in solution .Secondly , the temperatureislowe r e d so that site specificprimers can anneal toop po s i t e strandsflankingthe region whichis to be amplified.Finally , thete mp e r a tur e is raised to 72"Cwh i c h is optimal fo r the 5 '-))' ex.te nsionof
18
10 0 90 80 70
,,~
GO~
a
50~ R
4030 20 10 0
0 4 10
Time(minutes)
figure 2.'t'empe .re t.uceaend time durinq whichdenat uration, enneeIing andexte nsionoccurduri ng thePo l ymeras e Chain Reaction (PeR).Zero to eight minu t e sequa l s 1 cycle (b ased on Perkins-ElmerCetus)
19 the primer-templateduplexby ahea t stable TagDNA polymerase (o st. e,198 6}. This set ofthreesteps isus ua l l y carriedoutbetween25 to40 time s . After25cyc l es,one dou ble stra nd edte mp lateca nth eore tically generate approximately 1mill io ncop ies of DNAtte e and Taylor, 1990) becaus e each newly sy n t he s ized strand can act as a template for the foll owi ng cycle .
Just aspeR haschange dthe way many molec ular systematists conduct research , the developmentof automated DNAsequenci ng has also ch ang e d the way re sea r c h is car r ied out .DNAse q u enc i ng sta r ted in 1977whe n two dif fe rent te c hn ique s for ob t a i ni ng DNAseque nces were developed for
the dete rm i na ti on ofth e ind i v id u a l ba secons tit u e n t s of DNA, The first me t h od dev elope d by Sa n ge r eta L. (1977) is an enzyma t i cmet ho d that ut ilize s DNA. polymeraseto make copies of thete mpl ate DNAand randomly ins e rtsra di o- la b e l l e dch a i n terminatingdideoxynucl eotides. The second group, Maxam an d Gilbert (1977 ) , developed a base-specif ic chem ica l re a ct ion me thod tha t allowed for base
determi n a t ion. Bothmethods hav e be en use d exten e tvetv but automa tedsequenc ing isqu i cklybecoming the method of choice for those whocanafford the in iti al pur c hasepr-Ice of an aut omatedseque ncer.Automated DNAsequencing, li ke the Sanger et aL. (1977) method , is an enzymati cmethod and worksby ra nd o ml y inc orporat ing four di sti n guis ha b l e fluorescenttagged dddeoxynucLeot Ld ete r mi n at o r s intoa
20 synth e s isreac tIen which is ca t al y z e dby TaqDNA polymerase. DNA labelled with fluorescent tagged dideoxynucleotide are thenelectrophoresisedthrougha po l y a c r y l ami de gel wh e r e a La ser-beamexcites the fluorescen t moleculescausingth e m to emitlight. Thisis detectedbya photomultiplier tubewh i c h transf ersthe si g nal toa co mpute r where the in form at i on is ana Lyved and stored (Proberet ak . , 1987) . Automated sequen c ingha s several advantages over manual sequencing . First,automate d sequen cingrequires less time and is less laborious. Secondly, automated sequencing is non-radioactive anddo e s not require delays for exposure anddevelopmentof autoradlographs.Thirdly, manual sequencing requires four lanes (on e for each nucleot ide )while automatedsequencing on ly re q u i r e s on e lane, whichallowsmore samples tobe run on a single ge l . Finally, the data collectionis automatic. To coll ectmanua l sequencing data requiresagreat deal of skill to interpret and record information from autoradiographs.
1 7 studyobj ~
Cur re nt phenetic cl a s s if i c at i o n schemes developed for Plicari a, seeize and membersof Pezizaceaebasedan mo rp ho Ioq Lc a L similarity/dissimilarityareproblematic. The pur poe e of th i s study is t.o utilize DNAsequencecharacte r s from the SSU, ITS-land LSU z-r.".re g i o n s to establisha rigorous c Iadist Lc taxonomyth a t reflects the phylogenetic
21 rel a t i o n s hi ps among Plicari a, Peei zeand select membersof Pezizace ae.Aphylogenet icclassificati.on thatonl y ac c o mmo d a te sgrou p swhi c hhav e a singl eev o .lut Lonar-yorigin, mo n o phy l y , is prefera b l e to one th atpermit smultiple or heterogeneous origins. polyphyly {Minkoff, 19831.
The first hypothesis being testedis that Plicaria , currently delineated, is a monophyleticgroup. I fit is not.
Pl i ca r i acould be either paraphylet ic, a group contain ingan ances tra l species and some of its descendants, or polyphyle t ic . In eithercase , Plicari a wo u l dnot:. be a valid genus. in a cladisticsense.
The secondhypo t hesisbeing testedis thatVlicaL'icland ellipt ica l-sporedPeziza specieswit h a similar suiteof morphological charact.e rs, inherited thesecha racte ru-ucat ee fromenimme d i a t e commonancestor , eynap omor-p h y .If this i.s the casethe n these taxa should be accommodate din asingle ge n u s. Al t e r na t i v e l y , the suiteof morphological cnaraccer-o commonto the sphe rical- and elliptical-sporedtaxamay be a se t of shared primitiveche r-acte rcste t ee, syrnpl esiornor ph y , or a case of con verge ntevo lution, homo p l a s y .
The finalcompone nt.of this studyis toco mparehow membe rsofPlica ri aand Peziz ahave evol ved inass o c iati.on wi thbur ne d hab i t a t s. Althou qh Plicariasp eci e s arenormally found onburn edsites, Pezi za is found on a vari e ty of substrates incl udin gbu rn edanddisturbed si te s . Ifpo s t fire ta x aform monophyl e t i c grou p s, then this wo u l dsug ge s t that
22 there has been adaptationan dspe c i a tion in thi seph e mer al
habitatove r relati velylong periodsof ti me . I fPlicari ais paraphyle tic th i s wouldsugg e stthat the ada pta tion to oc cu r on burnedsites has evolved mult.i pletimes inde pend ently . Phyloge n eticanaly s ismayalso helpreso l ve otherque stio ns conc e r n i ng wit hrel atio n s hi psamong specieson burnedand ueburned site s, suc haswhe th er sp e cie s onburne dsite s are recentl y derivedfr o m spe c i e s on unbur nedsit es ,or vice
23
~rialsandMe t h od s
2.1 Is o l a t e s Studiedand DNAExtra~
The isolateschosen for th i s studyrepresent several speciesof PlicariaandPez izaas well as severalroembe cs ot the family Pezizaceaeasli st e din Table1. Isolates wer e cultured on E-s trainaga r (Egg er and Fort in , 1990) [or approximately 4 days at roomte mp e ra t u r e. Next, plugs we re take nfromaroun dthe grovling colonyedge using a glass pipet. freezedried and stor edat -s-cuntil requiredfor DNAextraction.
DNAextrac tionwas carri ed ou t on approximately 25Ing of freez edriedhyphal materialor air driedapothec ia , [o r tho s e isol at e s for whic hcultu resdid not exist.TissueWilB ground ina 1.5 mL mic rocentrifuge tube usingli q uid nitrogen and a 1.5mL microcen t ifuge tu b e plasticpes t le. Nucle i c acidswere extracted follow inga mod ifica tionot the miniprep protocol of Zolan and Pukkila {1 9 8 6 ) . This consistedof inc Uba t ingground tissueat 60"Cfor 15min u t es in700~Lex t r a c ti o n buffe r {7 QOmM NaCl , 50mMTriapH 8, 10 mM EDTA, 1%crAB, 0. 2t mez-capb oet.han ol}. Cell debris and proteins were removed by emulsifyinginch l o r o fo r m:isoamyl alcohol (2 4:1), centrifugingfor10 minutesat 13000 rpmand transferring the aqueous phase toa newmi.cr-ocentr LEuqe tube.Nucle icacidswere precipitat edwith isopropano l and resuspended inTE- 8 (10 mMTr ia- HCl pH a, 0. 1mM EDTAI.The
Species.isolate s. subs t rataandloc a t ion of P&z1:&. P11e .r.::-l& .n d••le e t lIIell\l:)ar.of"e::':'::acea e.
Species Collection Sub_ tr. te
number Sourcs at:
ho la te"
Determiner
pe...t vermiculit e Quebec Can pea tvumiculite Quebec C...n .teamste rilized Quabe cCan potting so 11
ro o t. ot: contlliner Alber taClln grown pine
burned 1I0 il B.C.Can
bur nedlitte r Ontariocen charcoalandaah B.C .Can charco allindalh a.C.Can on"Jiffy-'1 Pellet" Mi ch i ga n USA burne dlitter OntarioCan
burnedso il Oregon USA
wallbo.r dof houlle a.C. Can
horse dung Albert. Can
burne d li t t e r B.C. cen burned1I0 il and littera.c .C.n bUnled1I0 il andlit ter B.C .C&.n
wood ash B.C.ca.n
Abbott US S.p. Abbott CACM 199606 R.I'.Karf Egger 001 K.N.Egger Egger 002 K.N.Egger OACM199'136 K.N.E3'ger vd ls tll d 93/1 54T. Vr Ull t a d AbbottSA-On K.N.Egger
OAOM195'196 K. N.Egger DAOM 1958 0 9 K.N. Egg er OAOM195816 K.N .Egger DAOM 19 58 2 9 K.N.Eg ger O'Donnell 22205 R.F.Kor f CACM195813 K.N.Egge r We ber 6'152 1'1.5 .We ber Egger11.0-2160 J.W.Pad en AbbottSA-On s.p .Abbott CACM195B2 2 K.N.Eg g e r DACH 199673 X.N.Egger OACM1996'18 X.N.Egger DACH 199561 X.N .Egger hzlz&
t..,..
Pezi z.il a:rvenl e n s i sBoud ie r P.acrovinosaCook.r.Gera rd P. badiaPersoon ex Mer. t . P.bad! .
P.cereaSowerbyex Merat. P.ech!nospora Kasst.
P. cfr.l1n ce i c ola Phil. and plo....r.
P. oBtra c od e rma. Karf P.ostracod'erma P. oscr""c oo e rma P.oser a c od e rma P.petersllBe rkley "Cl.Irt is P.prate rvis <l Br e s.
P.pra te:rvis..
P.pra te:rvis""
P. quelepidotia Kar t "O'OOnn.
P. repanda Persoon p.va cin ii(·"elen.JSvri!':ek P. varia (Hed....ig)Fries P. ve si culosaBulliard P. vlola ceasecs . P. violac ea P. viol acea P.vio l acea
511.-(,55 2094ocr
00'
2113 TV-lS4 511.-093 2098 213 8 11.0-147111.0-1079 305 asasse KO-2 2 05 asa NW- 6'152 11.0-216 0 511.-540
' 65
10'14 111 3 2040
li tt er/ wood. debr ia ex po se dso il ex pose d .oil expos ed .oil undisturbedlo il burnedground debriaonlo i l
Alberta Ca n Main..USA NUd.Can NUd.Can Quebe c C...n Norw ay Al~rtaC...n
DACM199608 cACM1997 51 OACM1'14176
ICN.Egger K.N.Egger S.J.Hughes R.Danielson
H.Diu1ng
C DAa'I 195819 CACJol199089 DACI'l19967 5 P~1car1 .tax.
Pl i ciII::-i . aca nthod i c cya Diss._ Hauer ba c h
P.aeoUlt bodi e tya
P.earbonariaIFekl.)Fuckel C-009 P.en docarpoi d e s (Be rk.) Rifai 887
P. en d oc a rpoid e s 9B5
P.endocarpoides 1076
wood a.h burned ground wood ....h burnedlitt e r burnad litter burnedsoil
Norway OliIfUIIilrk B.C.c.n B.C.can
B.C .Can
Vr.lh tad93/181C.Holmand T.vrAls tad P.Rabenbcrg X.N. Egger K.N. Egger K.N. Egger
~
:!s 0'
:: r~
;:It_. . .(1 ..zz ~lllill
,(,,(
~~
N
~~~~~~ i
OX
. ,
0.0 0 0
~ m ;,m
..
8~ ~.
" , . , ~g .; ~; ~~~
u -"
~ ~,;
88
"
;;8
I!lli/!
... "x e ..
iii]~ -.
. !;~ ~~~ ~.
u
]iii~ e ,-
i!il!i!l:
N<
R::
] ] ~ ~ ~
I ~~ ~e
~i~.~
:~ C-
~E ; ,
~ ~.: :;:; ~ .~
e·,; e·e- e'e'
~~:
~6~~
~i
~'Il~mm·~~
~·~t~
g, Ol'1: ...~ ,,~~...~~ ~~ ~ 1i ~ f;"~ ~ II
..:~ ..:..: ..:..:~
;;,:i,~~.~~26 -unulniLicnt-ion, precipit at ion andresuspen s i o nst eps were rr' fJ" ;J t '~rla second time to incre ase the pur i t yof theDNA.
Vill;Jlly,UNA W<lS res u spended in 50~LofTE·8and st ored at -z uc unt il requir edfor amp lification.
!-~J)tfll)lification ofDNA
Three regionsof nuclear ribosomalDNA were targeted for .nnpllrLc .u lon and s equenc Ln q . The first regio n inc l udes ITS1. d highlyvar-LabLe regio n wh i c h ext ends from the 3 end at thotJIII<111 subunit thr oughth e5 internal tr a n s cri b e d spacer-dudanchorsill the5.85subu n it.To amp l ifyth is r-eqion. primers ITS9mun and ITSIOmun were us ed (Figu r e 3), 'I'his pri mer set a1'-;10 ampLifLed a portionof the 3' endof Lhe SSU (SSUll thatis part of the hi g hl y conser v ati veSS U
~JflIW. f\ second compone ntof the SSU (SSU2) wasamplif iedby
pri me i-s NSl l- 12mun. The thir d region tha t co nta insthe5' endof the lar ge su bun i t.issli g h t lymorecons e r vative and contai nsdi verge n t domains01 and02. Thisregion was to o lonq tosequence using a si n g l epr imer se t so twosets of ove rLappinqpri me rswe r e designed. Th e firs t prime r set which<illlplifiedthe 5' end of thi s region was NLS mun and NL6mUlland the second pr ime r se t wh i c h amplifiedthe 3' end of this re gio n was NL7mun and NL8mun (Fi g u r e 3).
For flCR ampLffLcatLon1 J.lL of und il ut e dge nomi c DNA was use-d,",S>ltemp late. Ampl i f i c at i onswereca r ri e d out in3. 100Ill,rcaccIcnecont a ini ng peR buf f e r (5 0 mM xci , 10roM
ISS NlICI.\ARrDN/\ [TS s.as ITS rDN,\
-- --
Figure3.scnemetIcdieqtumof18s-2!lStep, ~.l t. uuir :lll<MillllI~:I ~ primerloc a tion .SSU/.desiqrtzrteethe Ue'Ji UIl[L ~ ll k "dby pIinu-r:.
NS11 -12, SSUIdesign at es the 3'end ottlie~;:;UampLifiuduninq pr i me r-s ITS 9 -10 , IT S --l de aiqnetesth e';,' 1'1':-;rv-qiond!ll[Jl i li ..d usingp ri mer s ITS9- l 0an d LSUdesiqnat c«tho 1"'li fJflI loJllk'-;fJhy primersNLS -8.Hi g hly cous c rvect reqion-,ctoinilicot od by"''''''''', mo d e r ate l y conserved zeqion sateind icatedby ...".urdhinhlv variableregi o n s ar e in d icat e d by_ •
28 Tris-Hel (p I!9 at 2S"C). 1.5 mM MgC!2. a.Ol\"gelatin (w/v l.
a . nTritonX-l 00 1 . 50RIMeach of dGTP. dATP. dTIPand dCTP IPharmac ia cor p.), 0.4 J.lM of each primer (a s liste din Table 2) and 2 unit sofT<:Iq:>NA polyme rase (Pr o r.'le g a corporation). peR ampLifLcat.Lc n awer ecarried ou t in a Perkin-El me r Cetus DNA thermocyclerwithcycle parameters of 94°Cfor1 min ut e,
46"Cfor 60 sec ondsand72"Cfor 120 seconds initiallyand
fncreasinq by 1 second per cycle. wac h a1mi nu te ramp time.
Initialdenaturationwas ca r riedout at94QC for2 minutes an da fi nal extensionst e p of 5minu t e .With ea chsetof peR reac tions, aDNA-f r e e,nega t i ve controlwas alsoincluded to ensurethat co n t a mi n ati on did not occurwhile se t t ingup the reac tion. After thermocycling, 5~Lof ampl i f ie d produ c t was mixedwith) pLof loadingbuffer (0. 2 5\br o mop he n o l blue, 0.25% xy lene cyanc L, 25\Ficolll. loadedontoa 1. 0 \ agarose gel and ele c t r o p ho re se sed in O.5X TBE buffer (.. 5mMTr i s - bor ate. 45 mM bori c aci d. 1roMEOTApH81at 90vfor 45 minutes.Gelswe r e st ai ne d in a tank ofO. 5 ~g/mLEt h i d i u m Bromide for )0 minu tesand DNA bands we r e vis ualize d on a W-transilluminat or (JOOnm).Gelswere examined toensure that onlyone pe R productbandoccurredpe r lanean dtha t no ban ds wer e pre nent in the controllane. Af t er ini t ial inspecti o ngels we r e photog ra ph e d.
Table 2.Oligonucleotide PeR and sequencingprimers.
29
Primer PrimerSequence Re gion Amplified
ITS9mun TGTACACACCGCCCGTCG ITSl(sen sest r a nd) ITS J.Omun GCI'GCG'I'TC"ITCA TCGAT ITSl (an tisens e strand) NL Smun GCATATCAATAAGCGGAGGA LSU01 (sense strand) NL6mun CAAGTGCTTCCCTTTCAACA LSU 01 (a nt isensestra ndl NL7mun T'I'G<'.GAATGCAGCTCTAAATG LSU02 (sensestr an d ) NLBmun TI'GGTCGGTGTTTCAAGACG LSU 02 {antisense5c.rand I
30 2...l..-Ef:R....e.roductPuri ficat ion
peR products we r epur if i e d by theuse of"lizardMagic peRminiprep fPromegaCorporationl techniquefollowin g the manuracturor-'oprocedure. This involved add ing100ilL of Mil gi c ecn miniprepbuff er (5mM Kel , 1 roMTria- Hel(pH 9 at 2S"Cl. 150 11M MgC12, O.OOH gelatin (w/ v) .
o.uie
Triton x- 100) topeR productina 5 mL polyst yrene tube and vortexi ng .Onemil l i litreof Magi cpeR mdn Lprep resin (6M Guani dine Th iocyan a te)wasthe nadde dtothe mix ture an d vozte xed 3 timesover a one minutet.imepe r iod . The mixtu re was pipetted into a 3 cc syringewitha Magic peRmini prep column attachedto the1uer lock.Th e syring e pLun ge r wa s ins e r t e d and the solutionpushed through th emin ic o lumn . The syringewas then filled wit h2 mL of 80t isopr opanol andth e syringepl u nger was us ed topus hth e isop ro pa nol throughthe mi nic olumn. Next , theminicolumn was remove d , insert ed into a 1.5 mL microcentrifuge tube and centrif ug ed at 13,000 rpm for 30seco n ds . Followingthis ,the minicolumn wa s placed into a newmicrocentrifugetube, 50 ilLofdH~Oor TE:- 8 was added, itwa s allowed to stand for1 minut e and centri fuged at 13,000 rpmfor 3D seconds. FollowingpeRpuri fi cation, conce n trati o nswe r e determine d by spec t rophot ome t r yat 260 runan d store dat 4"C until readyfor se qu e nc ing .31 2 4 DNA Sequencing
Sequencingreact ions forautomated ON'"sequen cingwere perfo r med usi n g0,5.ugof dou ble stranded peR product ,3. 7.
pmo Iof primerand 7.0pL of re action pre mix 'Applie d Bio s ys t e msrn c .t .Final vo l u mes wereadjusted to 19.2IlL withdH~O.The sequencing reactionswer ethe n praeed in« thermocycl aran dSUb j ectedtocycle ee queucLnq pa r-eme te r-ssof 9So Cfo r 1s,50°Cfor15sand60"C fOI 2 min 30 8 fo r 25 cycles.
Aft.ercy clesequenc i ng, excess pri me rs and unincorporatednuc leo tide s were removedbyspin chromat o graphy.This invo lvedequil ibrat ing Gso fine sephadex (Pha r macial indH"O , loa d ing 2 mLint.oaspin column (Sp rime-)o3pr ime )and spinningfor 1mi n ut e at. 1500 rpm to removeexcess water.The sequen c ing reactionmixtur e was then loaded cn t; o the top of the se pha d excolumn, spun at 150 0 rpm fo r 2 minut e s so tha tth einco rpo r a t e d DNAwill be eluted outth e bot tomofthecolu mn. Theelut e d DNAwas then driedin a speed -vee and resus pe nded in 5 ilL of 1.0IlM deio nizedformamide:5 0 mMEDTAat pH 8.0 , heatedto 'lO"C [o r 2 minutes, snapcoo l e don ice and loa d e don a polyac r ylamide gel (6% acrylamide, 8.3 M ure a , IXTBE ) at t ac h edto an ABI 373A automa ticDNA sequencer (Ap p li ed Biosystems) . ThegeJ wa s subjectedtoelectrophores is at 30 watts, 10- S0 "C for8 hours.
32 /. <1D3 t ,)BatT\} aod Analysjs
DNAsequences weregenerat.edin the form of dye intensitychromatographs, collectedand analyzed wi t h the us e of the ABI373A softwarepackage ver . 1.0 .2 . Conse nsus sequenceswe r e determined ,for eachisolate, by proof readinganalyzed datafor complementarystrands. Ot he r d Iscrepancieewere resolvedby comparing multiple sequence chromatographsfromdifferent isolatesof the same species.
PreliminaryDNA alignments were determinedusing th e defaultsettings Eor boththeautoma t icDNAseq uence r software package SeqEd ver. 2.0andCLUSTALV. Fina l alignments were optimizedby hand.Twodata matriceswe r e used fo r analysis, llaligned data forPlicaria, Peziz aand sele ct membe r-sof Pezizaceae werecombi ne d forSSU1, SSU2 andLS U 2)aligned data forPlicariaandmembers of Plicaria- like-Pe z i zawe r e combined for ITS-l andLSU.Bo th we r e analyzedusing the ma xi mum parsimony program PAO'P3,lq on a Macintosh IIcxcomputer. Missingor ambiguouscharact ersor regions were not include in the analysisand
tr an s v e r s i o n s : t r a n s iti o n s were we i g h t e d 2:1.. Parsimony trees were constructed using heuristicsearch utilizing the tree bisection-recognitionbranch swappingalgor i thm for th e SSul, SSU2 and LSUdata set,dueto the lar g enumb e r of taxa analy z e d ,and the branch and bound search al g ori th m for the sma l l e r ITS-l and LSUda t a set. Boots tra p analyse s were pe rforme d on both data set s, using the same searc h opt ions
33 as descr ibedabove to determinetheconf idence leve l s of the infe rre d phylogenie s . Boots t rap indice s tpejeenatetn, 1985) were calcu latedusing 10 0 re p l icat e sfo r theSSUl,SSU2 an d LSU dataset, duetot.he la r ge numberof taxa analyzed , an d 100 0 re p l i c a t e s for thesmalle r ITS-l and LSU dat asetusi n g PAUP 3.1q. Thi s method attempt sto appr-ox.i mat;c the underlying samplingdistri but ionby resampling fromth e d.:tt.-:t set byrandomlyreplacingassignedcha r act ersunt il a dat a set is ge n erated tha ti s of theRamp.siz e as th e origina l . This new data se t isthe n used to con stt-ucr;
phy logeny. Byrep e a t i n g this procedurea larg e number of times aco nfide n c e limit is genera te dwhi ch compa re s how wel l the distributionof the odgina l characte r set approximatesa distribution ofan in fin ite l ylarge character set (Sanderson , 1989).
A modification of the jackknife te c h ni que (Lanyon, 198 5 : Spatafora and Blackwel l , 199 4 ) was al s operforme don the ITS·! andLS Udat a todet e rmine how sele c t taxawere influenc ingthe phylogeny(Le.importance of ch a r a ct e r.nt ato frequencies). Thi s technique invo lvesexcludingta xa and reanalyzing the data using boot strap anal y si s to det e rml.ne the stabilityof branches.
26 Sca nnin9 ElectronMic r os copy(S EMI
The Hitachi S570scanning electron mic roscopewasuee d to viewascospore size, shape and ornamentationof
34
repr esenta t. ives ofPlicaria andPlicaria-like-Peziza taxa. A smil l lpor t ionof apothecia tissue W<1S placedindi s t i ll ed water ona glassslideand macerated ....ith a scalpel using a dissect ingscope.Afterwards brokenasci fragments and spore sweretra ns f er re dto analuminums tu band allowed to airdried for10minutes.Driedt.issuewa s goldcoated with the use of a Ed wa r ds VacuumS150ASputter Coater. Thestubs were then inspe c tedwith th e useof the Hitachi 570 Scanning Electron microscope .Photographswere takenof spores which appearedto repre se n t themost co mmo nshape. size and or n a ment ati onwitbth e useof Pol aroid 665 blackand white film
35
31 Seml enceAlignment for PIiCinia Pezjzaand ~ me mb e r s of PezizaceaeUtilizingSSU2 ssmfln~J.L..R.e.qLQtl.s.
The first region, SSUI an d ITS-I,wa s amplifiedusing primers ITS91l1.un-ITSIOmunwhich yieldeda peR p roduct; that wa s ap proxi mate l y 400 bas e pa i r s (bp) in length. 'rtu.c in i t ial peR pr o d u c t . wh i c hwas used as a te mp la t e in double stranded se q uenc ing , reliablygenerated 360 bp ofsequence data. Attempts to align all 22 ta x a for the entire r-eqion , using the alignmentprograms SeqEd and CLUST1\Lv,wer e unsuccess fuldue to the high degree of sequence d l ve r'qcnce for the ITS-lregion. Th i swa s resolvedby elimina ting1'1'$-1 data fro mtheanalysis. Aligned da t a for SSul reveal s thut;
this regionishi g hl y conservedamongal l 22 taxa.Of ]:7.?
pos i t i o ns , 20sites we r e variable (16%)(Figure41.
The secondregion that was usedin thisa naIvsLa included a portion of the LS U gene. Th i s segment of theL,SU gene was 615 bp lo ng and was originally amplifi e d using pr i me r sNL5mun~NL8mun. However, initial automatedsequencing data sho wed that ambigu ities in baseca l l i ngLn c reaaod to an una c cept a b l e level beyond 45 0 bp. To deal with this problem, two internal pri merswere designed. Thisa lIowe d for.the ent ire615 bpsegme ntto be amplifie d using twoove r -la p p i ng sets ofprimers, NLSmu n - NL6mun and NL7mun- NLB mun. Primers NLSmun-NL6munamplifie d the first 360 bp andNL7mun-
36
/','l .'11'
T'/i ',,;
'/',·1',~
.'1'/"
,'n l
.. ,
'-nl 1'1>
,,,
TV ,,/I
:1'1~
,'111'-''' I :',\ ,,,4 ,'\lI'h"1
~I'.'.:"',
riqu r e ". Alignedseq u ence s for-ell l 23 taxa for SSU1. Is olat e refe re nce numb e r s foll ow thesa me coding as found in table 1.
nos e pos i t ions ar eindi c a te d every 50bp. Gap sar e representedby dashes.
37
NL8mun overlapped NL 5mu n - NL 6 mu n by 150bp and amplifiedthe las t 375 bpof th e NLSmun ·NL6mullsegment. Comb i ne d sequence data yieldeda total of 531 bpof whic h 13B siteswe r e va ri able (26\) (F i g ure 5).
Th e fi na l regi on wh i ch wa sused in the phylogeneti c analysis of Plicaria, Pezizaandselect members of Pezizaceaewas theSSU2 reg ion.Thi ssegment was ampl i f ied us i ng primersNSll-12 and pro d uce d afra g ment whi ch wau<165 bp. Sequencedatayielded a total of1123bp of which7'\
sites were variable (i ?%-)(Fig u r e 6).
It shouldbe not edtha t Pez iza efr . lin t ei c ol.lwa s not.:
inc l u ded inthe asui, SSU2 andLSU analysisbe cause I WilS un suc c ess f u l at obta ining a reliable sequenceforthe NSJ1- 12region. Numer ou sextra ctions, amplifica t i ons and sequencingsattempts weretr i e d but. the sequencedata that.
we r e generated were of verypoor qualityor contained many ambiguous sites. Compari s on of the sequencedata sug g e s t s thattwodifferentNSll-12fragment. s ar e be ing se q ue nc ed concurrent.ly.My ina b i l i ty to re mo v e this contaminant, even after tr y i n g differentDNAext.rac t i ons, suggests that a fungal contaminant must be present in the apot heci.a of this specimenofPezizacfr. lin t e i c ol a
"IJI' :;11
pLqure 5. Al i g ned sequences for all 22 taxa containing a portion of the LSU rDNA repeat. Isolate reference numbers follow the same coding as found in table 1. Base positions areind i ca t e d every 50 bp . Gaps are representedbydashes.
38
]<)
r.-Slu C-O ~ 9
'"
'"
~098 2094 002 511.- 0 9)
«aa
~_O_l071
10H SA- ~40
v-erse
~lH TV-l~4 511.'45 5 J53 217 8 CUP- 276 1 5A-36~
CUP-651 KD·2;:OS
. ".'
,,,,,Fig ure 5 ccntLnued
40
rtour e 5 conti nued
"-2 16',
?oIl.' TV-g<j 5/1-455
'"
~IH
ClJP2761 S/l·3';Q ':lJP· 6 ~ 1
~[}-n()"
,,'
''''' N,e,
.~ : ;;:,
,"l\' ,\.·T.:,V, :" , · .·,l"~ ·T'I'"'"
.~ :~:;
; ~~ ;,
';T·:..\· 'T· :/I''':'\' ·' ·'~·' '' -I''I.~,~:: ;:~::"
·:'·.~\; ··":A.' ;'\'·' ·'''U·, ·, ·
," .'" "
.,'''''r':'·','"".00','"
Fi yurEo'5conti nued
