For Peer Review
1 Identification and characterization of new mutations in mitochondrial cytochrome b that 2 confer resistance to bifenazate and acequinocyl in the spider mite Tetranychus urticae 3
4 Short running title: Novel target-site mutations cause Q0I resistance in Tetranychus urticae 5
6 Seyedeh Masoumeh Fotoukkiaii1, Zoë Tan1, Wenxin Xue2, Nicky Wybouw2 and Thomas Van 7 Leeuwen2
8
9 1 Department of Evolutionary and Population Biology, Institute for Biodiversity and Ecosystem Dynamics, 10 University of Amsterdam, Amsterdam, the Netherlands
11 2 Laboratory of Agrozoology, Department of Plants and Crops, Faculty of Bioscience Engineering, Ghent 12 University, Coupure Links 653, B-9000 Ghent, Belgium
13
14 Corresponding author:
15 Thomas Van Leeuwen 16 Laboratory of Agrozoology 17 Department of Plants and Crops 18 Faculty of Bioscience Engineering 19 Ghent University
20 Coupure Links 653, B-9000 Ghent, Belgium 21 Phone: +3292646143
22 Email: thomas.vanleeuwen@ugent.be
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
23 Abstract
24 BACKGROUND: In spider mites, mutations in the mitochondrial cytochrome b Q0 pocket have been 25 reported to confer resistance to the Q0 inhibitors bifenazate and acequinocyl. In this study we surveyed 26 populations of the two-spotted spider mite Tetranychus urticae for mutations in cytochrome b, linked newly 27 discovered mutations with resistance and assessed potential pleiotropic fitness costs.
28 RESULTS: We identified two novel mutations in the Q0 site: G132A (equivalent to G143A in fungi 29 resistant to strobilurins) and G126S + A133T (previously reported in Panonychus citri to cause bifenazate 30 and acequinocyl resistance). Two T. urticae strains carrying G132A were highly resistant to bifenazate but 31 not acequinocyl, while a strain with G126S + A133T displayed high levels of acequinocyl resistance, but 32 only moderate levels of bifenazate resistance. Bifenazate and acequinocyl resistance inherited maternally, 33 providing strong evidence for the involvement of these mutations in the resistance phenotype. Near isogenic 34 lines carrying G132A revealed several fitness penalties in T. urticae: a lower net reproductive rate (R0), the 35 intrinsic rate of increase (rm), and the finite rate of increase (LM), a higher doubling time (DT), and a more 36 male biased sex ratio.
37 CONCLUSIONS: Several lines of evidence were provided to support the causal role of newly discovered 38 cytochrome b mutations in bifenazate and acequinocyl resistance. Due to the fitness costs associated with 39 the G132A mutation, resistant T. urticae populations might be less competitive in a bifenazate free 40 environment, offering opportunities for resistance management.
41
42 Keywords: spider mites; complex III inhibitor; cytochrome b; mutation; cross-resistance; fitness cost 43
44 45 3
4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
46 1. INTRODUCTION
47 The spider mite Tetranychus urticae Koch (Arthropoda: Acari: Tetranychidae) is an important 48 cosmopolitan pest damaging many agricultural crops. Frequent acaricide applications are needed 49 to control this species which inevitably led to the development of resistance. This species is 50 considered as one of the most pesticide resistant arthropods based on the number of active 51 ingredients to which resistance has been reported.1, 2 Pesticide resistance evolves via two main 52 mechanisms: (1) toxicodynamic changes, such as the reduction in the sensitivity or availability of 53 the target-site due to point mutation(s), gene knock-out or amplification, (2) toxicokinetic changes 54 that reduce the amount of pesticides that reaches the target-site through changes in exposure, 55 penetration, transportation, metabolism and excretion.3, 4 Resistance mechanisms are often costly, 56 for example point mutations in essential target genes can convey pleiotropic effects and affect 57 other phenotypic traits in addition to pesticide resistance.5-7 Reproduction, dispersal, generation 58 time, and longevity have been reported to be negatively affected by target-site resistance 59 mutations.8-12 Also, for the spider mite T. urticae, fitness costs have been reported after marker 60 assisted back-crossing, but not for all resistance mutations.11
61 Although environmentally friendly methods such as biological control increase in importance, 62 especially in greenhouse crops,13, 14 spider mites as T. urticae are still mainly controlled by 63 acaricide applications.15 The hydrazine carbazate acaricide bifenazate is one of the most recently 64 developed and frequently used acaricides with excellent selectivity to all life stages of Tetranychus 65 spp. and Panonychus spp..16, 17 Bifenazate was first classified as a neurotoxin,18 but later studies 66 revealed a mitochondrial mode of action via inhibition of electron transport.12, 19 Bifenazate 67 resistance was shown to inherit maternally and high levels of resistance were tightly linked with
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
68 mutation(s) at highly conserved regions (the cd1-helix and ef-helix) of the cytochrome b Q0 site 69 of the mitochondrial complex III (bc1 complex, ubihydroquinone: cytochrome c oxidoreductase 70 enzyme complex).
71 The mitochondrial complex III is an essential enzyme complex in the electron transport 72 chain and plays a critical role in the biochemical generation of adenosine triphosphate (ATP) via 73 oxidative phosphorylation. The catalytic core of this enzyme complex is composed of three 74 subunits in eukaryotes which are cytochrome b, Rieske iron–sulphur protein (ISP) and cytochrome 75 c1 proteins. Cytochrome b is encoded by the mitochondrial genome while the other subunits are 76 encoded by the nuclear genome. Electrons are transported from low-potential ubiquinol to a higher 77 potential cytochrome c via the Q-cycle pathway.20, 21 This pathway requires two separate quinone- 78 binding sites: the quinol oxidation site (Q0 site) and the quinone reduction site (QI site). These two 79 sites are located on opposite sides of the membrane and linked by a transmembrane electron- 80 transfer pathway. Pesticides that inhibit the normal functioning of Q0 sites have been developed 81 from different chemical classes including, in addition to the carbazate bifenazate, the 2- 82 hydroxynaphthoquinones (HONQs) and the b-methoxyacrylates (MOAs) with the strobilurins as 83 a commercially successful family of potent fungicides.22-24 Acequinocyl is the only 84 commercialized acaricide of the naphthoquinone analogue group25 and is commonly used against 85 all stages of T. urticae and other spider mite species.18 Cross-resistance between bifenazate and 86 acequinocyl associated with cytochrome b mutations has been reported from T. urticae and 87 Panonychus citri populations.19, 24 The strobilurin fungicides were originally isolated from the 88 mycelium of the basidiomycete Strobilurus tenacellus strain No. 2160226 and are currently 89 considered as one of the most important classes of agricultural fungicides.27, 28 The first field
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
90 resistance to strobilurin fungicides was reported in wheat powdery mildew populations in northern 91 Germany in 1998.29 Later studies revealed that resistance to this group of fungicide in plant 92 pathogenic fungi is most often due to point mutation(s) in the Q0 region of mitochondrial 93 cytochrome b.30-32
94 In this study we discovered a G132A mutation in cytochrome b of T. urticae, equivalent to 95 G143A in fungi, which has been reported as the most frequent mutation associated with strobilurin 96 resistance.30, 33-36 During a survey investigating the frequency of G132A in T. urticae field strains, 97 we also uncovered for the first time the combination of G126S + A133T in T. urticae, previously 98 reported in the spider mite P. citri.24 We provide strong evidence of the causal role of these 99 resistance mutations by revealing maternal inheritance and determined the strength of the 100 phenotype by introgression of the mitochondrial haplotype in a susceptible genomic background.
101 Last, we used the generated isogenic lines to assess potential fitness costs associated with G132A 102 in T. urticae.
103 2. Materials and Methods 104 2.1 Chemicals and mite strains
105 Commercial formulations of the mitochondrial complex III electron transport inhibitors bifenazate 106 (Floramite®240 g litre−1 SC) and acequinocyl (Cantack ® 150 g litre−1 SC) were purchased from 107 Intergrow (Aalter, Belgium). All chemicals were analytical grade and purchased from Sigma- 108 Aldrich, unless stated otherwise. The JP-R strain37 and the laboratory susceptible Wasatch strain38 109 were previously described. In addition, twenty-three field strains were collected from different 110 geographical areas across Europe between 2016 and 2019 for resistance mutation screening (Table
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
111 1). All mites were reared on kidney bean plants Phaseolus vulgaris L. cv. ‘‘Speedy’’ or ‘Prelude’
112 at 25 ± 1°C, 60% RH, and 16/8 h (L/D) photoperiod.
113 2.2 Survey of cytochrome b variants
114 DNA extraction and PCR amplification of cytochrome b was performed as described by Van 115 Leeuwen et al..12 Briefly, approximately 200 adult females were collected and homogenized in 116 800 μL SDS buffer (200mM Tris-HCl, 400 mM NaCl, 10 mM EDTA, 2% SDS at pH = 8.3) 117 followed by phenol-chloroform extraction. For single mite DNA extraction, a single adult female 118 was homogenized by hand in 20 µl mixture of STE buffer (100 mM NaCl, 10 mM Tris-HCl, 1 119 mM EDTA, pH 8.0) and proteinase K (10 mg/ml, 2 ml) in a 1.5 ml Eppendorf tube. Then, the 120 mixture was incubated at 37°C for 30 min followed by 95°C for 5 minutes.12 PCR was performed 121 using the Expand Long Range PCR kit (Roche) and the primers Cytbdia2F (5’-
122 TTAAGAACTCCTAAAACTTTTCGTTC) and Cytbdia2R (5’-
123 GAAACAAAAATTATTATTCCC-CAAC). PCR products were purified with a Cycle- Pure Kit 124 (E.Z.N.A.TM) and sequenced with the original PCR primers and four internal sequencing primers
125 (cytbWTF, 5’-CGGAATAATTTTACAAATAACTCATGC; cytbWTR, 5’-
126 TGGTACAGATCGTAGAATTGCG; PEWYF1, 5’-AAAGGCTCATCTAACCAAATAGG;
127 PEWYR2, 5’-AATGAAATTTCTGTAAAAGGG-TATTC).12 Sequence data were analyzed with 128 BioEdit software.39 Sequences have been submitted to the NCBI repository (Table 1).
129 2.3 Generation of isofemale and introgressed lines
130 Isofemale lines were established from the FS1 and FS8 strains and were labeled as iso-FS1 and 131 iso-FS8, respectively. Approximately 500 mated female mites were transferred to detached bean 132 leaves on wet cotton wool in petri-dishes and were sprayed with 200 mg/L bifenazate. Five Petri-
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
133 dishes were prepared per strain. After 72 h, ten alive females were selected randomly from the 134 sprayed arenas and transferred to 9 cm2 square bean leaf discs individually. Mites were allowed to 135 lay eggs for 3-4 days. DNA of each single female was extracted as described above. Progeny of a 136 single female with the G132A (iso-FS1) and G126S + A133T (iso-FS8) mutations was used to 137 create the isofemale lines. Introgressed lines were established using the back-crossing methods 138 described by Bajda et al. 2017.40, 41 Briefly, JP-R and iso-FS8 virgin females were crossed with 139 susceptible Wasatch males. A virgin F1 female was back-crossed to Wasatch males, and the back- 140 crossing was repeated seven times. After back-crossing, mites were transferred to full bean plants 141 and were allowed to expand their population size for toxicity and fitness costs experiments.
142 Introgressed lines that carry G132A and G126S + A133T are labeled as JP-R-BC (1-3) and iso- 143 FS8-BC (1-3), respectively.
144 2.4 Toxicity bioassays
145 To determine bifenazate and acequinocyl toxicity, dose-response bioassays were conducted with 146 female adult mites as described by Van Leeuwen et al..42 Briefly, we tested a minimum of five 147 concentrations in four replicates. For each replicate 20-35 adult females were transferred to 9 cm2 148 bean leaf discs on wet cotton wool. Arenas were sprayed with 1 ml of acaricide solution or 149 deionized water (as control) at 1 bar pressure in a Potter spray tower resulting in 2 mg aqueous 150 deposit per cm2. Mortality was recorded after 24 h. The LC50-values and their 95% confidence 151 limits were calculated from probit regressions using the POLO-Plus software (LeOra Software, 152 2006).
153 2.5 Reciprocal crosses
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
154 To elucidate the mode of inheritance of bifenazate and acequinocyl resistance, reciprocal crosses 155 were set up between the JP-R (G132A), iso-FS1(G132A) and iso-FS8 (G126S + A133T) resistant 156 lines and the susceptible Wasatch strain. To create hybrid F1 females, approximately 80 157 teleiochrysalid females and 100 adult males were placed on detached bean leaves on wet cotton 158 wool and were allowed to mate. After two days, females were collected and transferred daily to a 159 fresh 9 cm2 square bean leaf disc and allowed to lay eggs. F1 adult females were used for toxicity 160 bioassays. The degree of dominance (D) was calculated with the Stone (1968)43 formula: D = (2X2
161 – X1 – X3)/ (X1 – X3), where X1 = log10 LC50 of the resistant strain, X3= log10 LC50 of the 162 susceptible strain and X2 = log10 LC50 of the F1 females obtained from the reciprocal cross.
163 2.6 Fitness cost of G132A
164 To explore potential fitness costs associated with the G132A mutation, demographic experiments 165 were conducted with the three independent JP-R back-crossed lines in comparison with the 166 parental Wasatch line as control.
167 Developmental time, immature stage survivorship (ISS), and sex ratio
168 From each introgressed line and the Wasatch control, 100 females were randomly collected from 169 stock cultures and transferred to a detached bean leaf on wet cotton in three replicates. Females 170 were allowed to lay eggs for 4-5 h and the numbers of eggs were recorded. After eight days, the 171 development of the offspring was followed every 12h, and the eclosion time and sex of the adults 172 were recorded.
173 Oviposition and adult longevity
174 From the three introgressed lines and the Wasatch control, 40 female teleiochrysalids were placed 175 individually with an adult male on a 2 cm2 leaf disk (in total 4 × 40 = 160 leaf disks each with a
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
176 mite couple). Every 12 h, all disk arenas were checked for female oviposition and death. Every 24 177 h each mite couple was transferred to a fresh leaf disk until the female died. Pre-oviposition, 178 oviposition and post-oviposition periods were determined as the time spanning between adult 179 female emergence and the first egg, the time between the first and last day of oviposition, and the 180 day when no eggs were deposited until her death, respectively.
181 2.7 Statistical analysis
182 Statistical analysis was conducted within the R framework [R Core Team (2014), version 3.1.2]44 183 for all data. Normality of variances was tested using a Shapiro-Wilk test. A generalized linear 184 model with a negative binomial error distribution was used to analyse the data of female longevity, 185 pre-oviposition period, oviposition period, post-oviposition period and the number of eggs. Sex 186 ratio data was analysed using a generalized linear model with a binomial error distribution. A 187 general linear model was used to analyse ISS data that were normally distributed. Differences 188 between the introgressed lines were determined using the Tukey’s HSD test at 95% confidence 189 level. Life table analysis was performed based on the lifetable R script. 45 The intrinsic rate of 190 increase (rm) was calculated with the equation ∑ Ωg e−rmlxmx=1 where lx is the proportion of
x = x0
191 females surviving to age x and mx is the mean number of female progeny per adult female at age 192 x. The net reproductive rate or mean number of daughters produced per female was calculated 193 from R0= ∑ Ωg lxmx and the mean generation time from T= . The finite rate of increase
x = x0
ln (R0) rm
194 and doubling time were inferred from the equations LM=erm and DT= ln2 rm, respectively. Variance 195 for the life table (LT) parameters was estimated with Jackknife resampling method.46 As the 196 Jackknife method is an asymptotic procedure that is sensitive to a highly skewed distribution,47
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
197 the symmetry of our dataset was measured with the function skewness from package moments 198 prior to the final analysis.48 Subsequently, mean Jackknife values and their standard errors (SE) 199 were calculated for the five LT parameters.49 Mean jackknife values for lines carrying mutations 200 were then compared to Wasatch using Dunnett’s test (adjusted p-value <0.05).
201
202 3. Results
203 3.1 Cytochrome b genotypes of JP-R and the field strains
204 During a cross-resistant screen of the Japanese JP-R strain selected for cyenopyrafen resistance,37 205 we found strong bifenazate resistance, and therefore sequenced the complete cytochrome b gene.
206 Aligning the cytochrome b sequences of JP-R against that of the susceptible strains Wasatch and 207 GSS revealed a novel amino acid substitution (G132A) (Table 1 and Figure 1). To explore the 208 spread of this mutation in Europe, several field-collected strains were screened (Table 1). We 209 found four mutations in the conserved cd1 and ef-helix of the Q0 pocket of cytochrome b of 210 mitochondrial complex III (G126S, G132A, A133T and P262T). The novel G132A uncovered in 211 JP-R was also identified in FS1, a strain from the Netherlands. In addition, a novel mutation 212 combination (G126S + A133T) was identified in strain FS8 from the UK. This combination of 213 mutations has already been reported from P. citri, but was so far never encountered in T. urticae 214 24 (Table 1 and Figure 1). Last, the well characterized P262T was found in a population from 215 strawberry in the UK. Additional substitutions were also found in non-conserved regions. The 216 G126S mutation was found by itself in five strains collected from the Netherlands and the UK 217 (Table1 and Figure 1), but whether the mutation alone confers resistance remains to be 218 investigated.
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
219 3.2 Resistance to bifenazate and acequinocyl
220 Results of all toxicity tests are listed in Table 2. The JP-R and FS1 strain that carry the G132A 221 mutation were resistant to bifenazate (LC50 >150 mg/L), but not to acequinocyl. In contrast, the 222 FS8 strain with the G126S + A133T haplotype showed high levels of acequinocyl resistance (LC50 223 > 600 mg/L), and only very moderate resistance to bifenazate (Table 2). The levels of resistance 224 between parental and introgressed lines were comparable across all independent replicates for 225 G132A (Table 2), strongly suggesting that the cytochrome b mutation alone completely determines 226 the resistance phenotype. For the G126S + A133T haplotype, resistance ratios for acequinocyl 227 were two-fold lower after introgression, but LC50 values were still very high (Table 2). This 228 suggests a strong effect of the combination of these mutations in acequinocyl resistance, but also 229 implies that additional factors might be involved in the very high resistance of the non-introgressed 230 strain iso-FS8.
231 3.3 Mode of inheritance of bifenazate and acequinocyl resistance
232 Reciprocal crosses revealed a complete maternal inheritance of bifenazate resistance in the G132A 233 lines (Table 3, Figure 2), linking the mutation to the phenotype. The limited bifenazate resistance 234 observed in iso-FS8 with the G126S + A133T haplotype also inherited completely maternal. There 235 was a very strong maternal effect in the inheritance pattern of acequinocyl resistance in the 236 reciprocal cross of iso-FS8 × Wasatch. In contrast, the very low resistance to acequinocyl in 237 G132A lines did not inherit maternally (Table 3, Figure 2), indicating that G132A does not confer 238 acequinocyl resistance. The LC50 values and dominance levels for all reciprocal crosses are 239 specified in Table 3.
240 3.4 Fitness costs
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
241 Adult males and females of Wasatch emerged earlier than the introgressed lines JP-R-BC (1-3) 242 (female: df = 3, F= 11.12, P < 0.001 and male: df= 3, F= 7.29, P < 0.001) (Supplemental Figure 1 243 and Figure 3). Significant differences were observed between the three introgressed resistant lines 244 JP-R-BC and the bifenazate susceptible strain Wasatch in terms of ISS (F = 4.13; df = 3, P = 245 0.015), sex-ratio (χ2 = 9.30; df = 3; P = 0.023), longevity (χ2 = 17.76; df = 3; P < 0. 001), 246 oviposition period (χ2 = 17.62; df = 3; P < 0. 001), total number of eggs laid per female (χ2 = 247 12.61; df = 3; P = 0.005), and post-oviposition (χ2 = 7.97; df = 3; P = 0.46), but not pre-oviposition 248 period (χ2 = 0.12; df = 3; P = 0.989) (Figure 3).
249 Fertility life table parameters
250 All LT parameters, net reproductive rate (R0), the intrinsic rate of increase (rm), the finite rate of 251 increase (LM), mean generation time (T) and the doubling time (DT) of the three introgressed lines 252 carrying resistance mutations JP-R-BC (1-3) and Wasatch, are summarized in Table 4. All three 253 introgressed lines of JP-R showed significantly smaller values for R0, rm and LM and significantly 254 longer DT compared with their congenic line, Wasatch (Table 4 and Figure 4). No significant 255 difference was found in T.
256 4. Discussion
257 Because of its excellent efficacy and safety toward biological control agents such as predatory 258 mites,15, 16, 50 bifenazate has been frequently used worldwide. Soon after its introduction in the EU, 259 resistance was reported in T. urticae populations from greenhouse roses in the Netherlands.12 260 Surprisingly, bifenazate resistance inherits maternally and investigation of resistance mechanisms 261 lead to the discovery of a mitochondrial mode of action,12 instead of the earlier proposed
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
263 mutations at conserved sites in the mitochondrial cytochrome b gene, suggesting that bifenazate 264 acts as a QO inhibitor.12, 19, 53 In spider mites, reciprocal genetic crosses between populations can 265 be easily conducted, and should thus be the standard in validating the role of specific mutations in 266 cytochrome b in QoI resistance. As cytochrome b is encoded by the mitochondrial genome, 267 maternal inheritance is uniquely associated with these resistance conferring mutations. In addition, 268 for a number of cytochrome b mutations, repeated back-crossing to a susceptible line has 269 confirmed the very potent resistant phenotype in bifenazate resistance.40 Over the years, a number 270 of mutations conferring bifenazate and acequinocyl resistance have been validated by revealing a 271 maternal inheritance, both in T. urticae as P. citri populations (Figure 1). Although a number of 272 other mutations has been reported, formal evidence of their contribution to bifenazate resistance is 273 still lacking.54 The same is true for G126S, which was initially reported in combination with other 274 cd1 helix mutations, but the mutation alone has never been validated to confer a resistant 275 phenotype, despite a recent report.54 This is in contrast with mutations in (or close to) the ef helix, 276 where P262T and I256V alone confer bifenazate and acequinocyl resistance respectively (Figure 277 1).12, 55
278 In this study, we report for the first time a single mutation in the cd1-helix, G132A, that confers 279 resistance to bifenazate. The mutation was uncovered after a cross-resistance screen of JP-R,37 a 280 strain of Japanese origin, and was subsequently also detected in a Dutch field strain, FS1. Both 281 lines harboring the G132A mutation, as well as back-crossed lines, displayed similar LC50’s and 282 RR and resistance inherited perfectly maternal. This strongly validates the role of the G132A 283 mutation in bifenazate resistance. However, the mutation did not confer acequinocyl cross- 284 resistance. Bifenazate resistance levels of 30-fold with LC50 values of 150-200 mg/L are very
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
285 significant in the light of field rate (e.g. Floramite at 96 mg active ingredient/L in EU) and could 286 cause field failure, but nevertheless are much lower than those previously reported in the cd1 helix 287 (LC50s > 10,000).12, 19 This suggests that a combination of mutations is needed to attain these very 288 high resistance levels. Interestingly, this mutation is the main resistance factor in pathogenic fungi 289 resistant to strobilurins, which are classified as MOAs and Q0I inhibitor fungicides,22, 23, 56, 57, 290 providing a strong example of convergent evolution across kingdoms. Screening of field-collected 291 European T. urticae populations also led to the discovery of another novel combination of 292 mutations: G126S + A133T. This Qo pocket haplotype is associated with high levels of 293 acequinocyl and bifenazate resistance in P. citri.24 In our study, the combination of G126S and 294 A133T in T. urticae conferred only moderate levels of resistance to bifenazate but high resistance 295 to acequinocyl. It is surprising that this combination of substitutions confers such different levels 296 of bifenazate resistance in P. citri and T. urticae, especially because the resistant phenotype 297 inherited maternally in both species, and additional (nuclear) factors in resistance can thus be ruled 298 out. For G132A, it is clear that bifenazate must be the most relevant selective force in T. urticae 299 field populations, as it does not confer acequinocyl resistance. The opposite is likely true for 300 G126S + A133T, as the effect seems to be much more pronounced on acequinocyl toxicity, and 301 hence it is tempting to speculate that frequent acequinocyl use lies at the basis of resistance 302 development.
303 After repeated back-crossing to the susceptible Wasatch strain, we obtained congenic lines 304 harboring the mitochondrial haplotype of JP-R (G132A) and the nuclear background of Wasatch.
305 As this uncouples the mitochondrial resistance mutations from confounding genomic factors, it is 306 not only a validation of the phenotypic strength, but also a powerful approach to assess fitness
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
307 costs. Our analyses of the G132A congenic lines revealed a lower R0, rm, LM, and a higher DT 308 compared with Wasatch. It therefore seems that in an acaricide-free environment the resistant 309 genotypes might be less competitive and will grow slower than susceptible genotypes. In addition, 310 we found that the resistant genotype is more male biased, which could further reduce the frequency 311 of the transmission of G132A. Our findings could be important for the management of G132A 312 conferred resistance in the field. It appears that the management of G132A resistance might be 313 easier than that of the mutations without fitness costs, such as G126S + S141F and P262T.11 314 There are several reports on the fitness of resistant fungal species that carry the G143A (G132A 315 in spider mites). Some species, such as Plasmopara viticola58, 59, and Magnaporthe oryzae60 show 316 lower fitness. For example, conidia production of the field G143A azoxystrobin-resistant mutant 317 of M. oryzae is lower than that of the susceptible wild-types.60 Other studies failed to find fitness 318 costs in resistant species such as Blumeria graminis61, Alternaria alternata62, Botrytis cinerea63, 319 and Colletotrichum acutatum64. These fitness studies, however, did not provide direct evidence for 320 the association of fitness consequences with the G143A mutation. To evaluate the role of G143A 321 in fungicide resistance and its impact on the fitness of fungi, the mutation was introduced into the 322 cytochrome b of the yeast species Saccharomyces cerevisiae as a model system65. While 323 confirming the involvement of the mutation in resistance, they showed that the mutation has a 324 slightly deleterious effect on the bc1 function of the site mimic of some pathogenic fungi species 325 but not all. The authors therefore argued that a small variation in the Qo site can affect the impact 326 of the G143A mutation on bc1 activity, and can differentially affect the fitness between species.
327 In this light, it is not surprising that different spider mite mutations can confer different levels of 328 fitness penalties.
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
329 5. Conclusion
330 In conclusion, new cytochrome b mutations were uncovered and several lines of evidence support 331 the causal role of these mutations in bifenazate or acequinocyl resistance. Patterns of maternal 332 inheritance and introgression experiments identified G132A as tightly linked with high levels of 333 bifenazate resistance. In T. urticae, G126S + A133T conferred very high acequinocyl resistance, 334 with only limited levels of bifenazate cross-resistance. Investigation into the fitness costs revealed 335 that strains harboring G132A might be more easily managed.
336
337 6. Acknowledgments
338 The authors wish to thank Masahiro Osakabe for providing the T. urticae JP-O strain, the ancestral 339 strain of JP-R. This work was partially funded by the University of Amsterdam (IBED), and 340 supported by the Research Foundation - Flanders (FWO) [grant G009312N and grant G053815N]
341 and the Research Council (ERC) under the European Union's Horizon 2020 research and 342 innovation program [grant 772026-POLYADAPT and 773902–SUPERPEST]. N.W. was 343 supported by a Research Foundation - Flanders (FWO) post-doctoral fellowship (12T9818N).
344 7. References
345 1. Van Leeuwen T, Vontas J, Tsagkarakou A, Dermauw W and Tirry L, Acaricide resistance 346 mechanisms in the two-spotted spider mite Tetranychus urticae and other important Acari: a 347 review. Insect Biochem Mol Biol 40: 563-572 (2010).
348 2. Whalon M, Mota-Sanchez R, Hollingworth R and Duynslager L, Arthropods Resistant to 349 Pesticides Database (ARPD) (2008).
350 3. Feyereisen R, Dermauw W and Van Leeuwen T, Genotype to phenotype, the molecular and 351 physiological dimensions of resistance in arthropods. Pestic Biochem Physiol 121: 61-77 (2015).
352 4. Van Leeuwen T and Dermauw W, The molecular evolution of xenobiotic metabolism and
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
354 5. Fisher RA. The genetical theory of natural selection: a complete variorum edition: Oxford 355 University Press, 1999.
356 6. Crow JF, Genetics of insect resistance to chemicals. Annu Rev Entomol 2: 227-246 (1957).
357 7. Bass C, Does resistance really carry a fitness cost? Current opinion in insect science 21: 39-46 358 (2017).
359 8. Bourguet D, Guillemaud T, Chevillon C and Raymond M, Fitness costs of insecticide resistance 360 in natural breeding sites of the mosquito Culex pipiens. Evolution 58: 128-135 (2004).
361 9. Gassmann AJ, Carrière Y and Tabashnik BE, Fitness costs of insect resistance to Bacillus 362 thuringiensis. Annu Rev Entomol 54: 147-163 (2009).
363 10. Kliot A and Ghanim M, Fitness costs associated with insecticide resistance. Pest Manag Sci 364 68: 1431-1437 (2012).
365 11. Bajda S, Riga M, Wybouw N, Papadaki S, Ouranou E, Fotoukkiaii SM, Vontas J and Van 366 Leeuwen T, Fitness costs of key point mutations that underlie acaricide target‐site resistance in the 367 two‐spotted spider mite Tetranychus urticae. Evolutionary applications 11: 1540-1553 (2018).
368 12. Van Leeuwen T, Vanholme B, Van Pottelberge S, Van Nieuwenhuyse P, Nauen R, Tirry L 369 and Denholm I, Mitochondrial heteroplasmy and the evolution of insecticide resistance: non- 370 Mendelian inheritance in action. Proc Natl Acad Sci U S A 105: 5980-5985 (2008).
371 13. van Lenteren JC, Bolckmans K, Köhl J, Ravensberg WJ and Urbaneja A, Biological control 372 using invertebrates and microorganisms: plenty of new opportunities. Biocontrol 63: 39-59 (2018).
373 14. Hajek AE and Eilenberg J. Natural enemies: an introduction to biological control: Cambridge 374 University Press, 2018.
375 15. Van Leeuwen T, Tirry L, Yamamoto A, Nauen R and Dermauw W, The economic importance 376 of acaricides in the control of phytophagous mites and an update on recent acaricide mode of action 377 research. Pestic Biochem Physiol 121: 12-21 (2015).
378 16. Ochiai N, Mizuno M, Mimori N, Miyake T, Dekeyser M, Canlas LJ and Takeda M, Toxicity 379 of bifenazate and its principal active metabolite, diazene, to Tetranychus urticae and Panonychus 380 citri and their relative toxicity to the predaceous mites, Phytoseiulus persimilis and Neoseiulus 381 californicus. Experimental and Applied Acarology 43: 181-197 (2007).
382 17. Van Nieuwenhuyse P, Demaeght P, Dermauw W, Khalighi M, Stevens C, Vanholme B, Tirry 383 L, Lümmen P and Van Leeuwen T, On the mode of action of bifenazate: New evidence for a 384 mitochondrial target site. Pestic Biochem Physiol 104: 88-95 (2012).
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
385 18. Dekeyser MA, Acaricide mode of action. Pest Management Science: formerly Pesticide 386 Science 61: 103-110 (2005).
387 19. Van Nieuwenhuyse P, Van Leeuwen T, Khajehali J, Vanholme B and Tirry L, Mutations in 388 the mitochondrial cytochrome b of Tetranychus urticae Koch (Acari: Tetranychidae) confer 389 cross‐resistance between bifenazate and acequinocyl. Pest Management Science: formerly 390 Pesticide Science 65: 404-412 (2009).
391 20. Trumpower BL, Cytochrome bc1 complexes of microorganisms. Microbiol Rev 54: 101-129 392 (1990).
393 21. Crofts AR, The cytochrome bc 1 complex: function in the context of structure. Annu Rev 394 Physiol 66: 689-733 (2004).
395 22. Lümmen P. Mitochondrial Electron Transport Complexes as Biochemical Target Sites for 396 Insecticides and Acaricids. In: Anonymous Insecticides Design Using Advanced Technologies:
397 Springer, 2007, p.197.
398 23. Fisher N and Meunier B, Molecular basis of resistance to cytochrome bc 1 inhibitors. FEMS 399 yeast research 8: 183-192 (2008).
400 24. Van Leeuwen T, Van Nieuwenhuyse P, Vanholme B, Dermauw W, Nauen R and Tirry L, 401 Parallel evolution of cytochrome b mediated bifenazate resistance in the citrus red mite 402 Panonychus citri. Insect Mol Biol 20: 135-140 (2011).
403 25. Yorulmaz Salman S and Sarıtaş E, Acequinocyl resistance in Tetranychus urticae Koch (Acari:
404 Tetranychidae): inheritance, synergists, cross-resistance and biochemical resistance mechanisms.
405 Int J Acarol 40: 428-435 (2014).
406 26. Anke T, Oberwinkler F, Steglich W and Schramm G, The strobilurins-new antifungal 407 antibiotics from the basidiomycete Strobilurus tenacellus (PERS. ex FR.) SING. J Antibiot 30:
408 806-810 (1977).
409 27. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parr‐Dobrzanski B, The 410 strobilurin fungicides. Pest Manag Sci 58: 649-662 (2002).
411 28. Balba H, Review of strobilurin fungicide chemicals. Journal of Environmental Science and 412 Health Part B 42: 441-451 (2007).
413 29. Erichsen E, Problems in mildew control in northern Germany. Getreide 1: 44-46 (1999).
414 30. Zheng D, Olaya G and Köller W, Characterization of laboratory mutants of Venturia inaequalis 415 resistant to the strobilurin-related fungicide kresoxim-methyl. Curr Genet 38: 148-155 (2000).
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
416 31. Hnatova M, Gbelska Y, Obernauerova M, Šubíková V and Šubík J, Cross-resistance to 417 strobilurin fungicides in mitochondrial and nuclear mutants ofSaccharomyces cerevisiae. Folia 418 Microbiol (Praha) 48: 496 (2003).
419 32. Sierotzki H, Wullschleger J and Gisi U, Point mutation in cytochrome b gene conferring 420 resistance to strobilurin fungicides in Erysiphe graminis f. sp. tritici field isolates. Pestic Biochem 421 Physiol 68: 107-112 (2000).
422 33. Avila-Adame C and Köller W, Characterization of spontaneous mutants of Magnaporthe grisea 423 expressing stable resistance to the Qo-inhibiting fungicide azoxystrobin. Curr Genet 42: 332-338 424 (2003).
425 34. Walker A, Auclair C, Gredt M and Leroux P, First occurrence of resistance to strobilurin 426 fungicides in Microdochium nivale and Microdochium majus from French naturally infected 427 wheat grains. Pest Manag Sci 65: 906-915 (2009).
428 35. Kirk W, Hanson L, Franc G, Stump W, Gachango E, Clark G and Stewart J, First report of 429 strobilurin resistance in Cercospora beticola in sugar beet (Beta vulgaris) in Michigan and 430 Nebraska, USA. (2012).
431 36. Miles L, Miles T, Kirk W and Schilder A, Strobilurin (QoI) resistance in populations of 432 Erysiphe necator on grapes in Michigan. Plant Dis 96: 1621-1628 (2012).
433 37. Khalighi M, Dermauw W, Wybouw N, Bajda S, Osakabe M, Tirry L and Van Leeuwen T, 434 Molecular analysis of cyenopyrafen resistance in the two‐spotted spider mite Tetranychus urticae.
435 Pest Manag Sci 72: 103-112 (2016).
436 38. Bryon A, Kurlovs AH, Dermauw W, Greenhalgh R, Riga M, Grbic M, Tirry L, Osakabe M, 437 Vontas J, Clark RM and Van Leeuwen T, Disruption of a horizontally transferred phytoene 438 desaturase abolishes carotenoid accumulation and diapause in Tetranychus urticae. Proc Natl Acad 439 Sci U S A 114: E5871-E5880 (2017).
440 39. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program 441 for Windows 95/98/NT. In: Nucleic acids symposium seriesAnonymous, pp.95-98: [London]:
442 Information Retrieval Ltd., c1979-c2000.
443 40. Riga M, Bajda S, Themistokleous C, Papadaki S, Palzewicz M, Dermauw W, Vontas J and 444 Van Leeuwen T, The relative contribution of target-site mutations in complex acaricide resistant 445 phenotypes as assessed by marker assisted backcrossing in Tetranychus urticae. Scientific reports 446 7: 9202 (2017).
447 41. Bajda S, Dermauw W, Panteleri R, Sugimoto N, Douris V, Tirry L, Osakabe M, Vontas J and 448 Van Leeuwen T, A mutation in the PSST homologue of complex I (NADH: ubiquinone
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
449 oxidoreductase) from Tetranychus urticae is associated with resistance to METI acaricides. Insect 450 Biochem Mol Biol 80: 79-90 (2017).
451 42. Van Leeuwen T, Stillatus V and Tirry L, Genetic analysis and cross-resistance spectrum of a 452 laboratory-selected chlorfenapyr resistant strain of two-spotted spider mite (Acari: Tetranychidae).
453 Exp Appl Acarol 32: 249 (2004).
454 43. Stone BF, A formula for determining degree of dominance in cases of monofactorial 455 inheritance of resistance to chemicals. Bull World Health Organ 38: 325-326 (1968).
456 44. Team RC, R Foundation for Statistical Computing; Vienna, Austria: 2014. R: A language and 457 environment for statistical computing : 2013 (2018).
458 45. De Holanda Nunes Maia, Aline, De Almeida Pazianotto, Ricardo Antonio, Luiz AJB, Marinho- 459 Prado JS and Pervez A, Inference on arthropod demographic parameters: computational advances 460 using R. J Econ Entomol 107: 432-439 (2014).
461 46. Quenouille MH, Notes on bias in estimation. Biometrika 43: 353-360 (1956).
462 47. Maia AdH, Luiz AJ and Campanhola C, Statistical inference on associated fertility life table 463 parameters using jackknife technique: computational aspects. J Econ Entomol 93: 511-518 (2000).
464 48. Sheskin D, Handbook of Parametric Statistical Procedures. Chapman Hall/CRC., (2011).
465 49. Meyer JS, Ingersoll CG, McDonald LL and Boyce MS, Estimating uncertainty in population 466 growth rates: jackknife vs. bootstrap techniques. Ecology 67: 1156-1166 (1986).
467 50. James DG, Selectivity of the acaricide, bifenazate, and aphicide, pymetrozine, to spider mite 468 predators in Washington hops. Int J Acarol 28: 175-179 (2002).
469 51. Dekeyser MA, McDonald PT and Angle Jr GW, Synthesis and miticidal activity of o- 470 biphenyldiazenecarboxylates. J Agric Food Chem 43: 1705-1707 (1995).
471 52. Hiragaki S, Kobayashi T, Ochiai N, Toshima K, Dekeyser MA, Matsuda K and Takeda M, , 472 A novel action of highly specific acaricide; bifenazate as a synergist for a GABA-gated chloride 473 channel of Tetranychus urticae [Acari: Tetranychidae]. Neurotoxicology 33: 307-313 (2012).
474 53. Van Leeuwen T, Tirry L and Nauen R, Complete maternal inheritance of bifenazate resistance 475 in Tetranychus urticae Koch (Acari: Tetranychidae) and its implications in mode of action 476 considerations. Insect Biochem Mol Biol 36: 869-877 (2006).
477 54. Shi P, Cao L, Gong Y, Ma L, Song W, Chen J, Hoffmann AA and Wei S, Independently 478 evolved and gene flow‐accelerated pesticide resistance in two‐spotted spider mites. Ecology and
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
480 55. Kim SI, Koo H, Choi Y, Park B, Kim HK and Kim G, Acequinocyl Resistance Associated 481 With I256V and N321S Mutations in the Two-Spotted Spider Mite (Acari: Tetranychidae). J Econ 482 Entomol 112: 835-841 (2019).
483 56. Fernández-Ortuño D, Torés JA, De Vicente A and Pérez-García A, Mechanisms of resistance 484 to QoI fungicides in phytopathogenic fungi. International Microbiology 11: 1 (2008).
485 57. Gisi U, Sierotzki H, Cook A and McCaffery A, Mechanisms influencing the evolution of 486 resistance to Qo inhibitor fungicides. Pest Manag Sci 58: 859-867 (2002).
487 58. Heaney S, Hall A, Davies S, et al. Resistance to fungicides in the Qol-STAR cross-resistance 488 group: current perspectives. In: The BCPC Conference: Pests and diseases, Volume 2. Proceedings 489 of an international conference held at the Brighton Hilton Metropole Hotel, Brighton, UK, 13-16 490 November 2000Anonymous, pp.755-762: British Crop Protection Council.
491 59. Genet J, Jaworska G and Deparis F, Effect of dose rate and mixtures of fungicides on selection 492 for QoI resistance in populations of Plasmopara viticola. Pest Management Science: formerly 493 Pesticide Science 62: 188-194 (2006).
494 60. Ma B and Uddin W, Fitness and competitive ability of an azoxystrobin-resistant G143A mutant 495 of Magnaporthe oryzae from perennial ryegrass. Plant Dis 93: 1044-1049 (2009).
496 61. Chin K, Chavaillaz D, Kaesbohrer M, Staub T and Felsenstein F, Characterizing resistance 497 risk of Erysiphe graminis f. sp. tritici to strobilurins. Crop Protection 20: 87-96 (2001).
498 62. Karaoglanidis G, Luo Y and Michailides T, Competitive ability and fitness of Alternaria 499 alternata isolates resistant to QoI fungicides. Plant Dis 95: 178-182 (2011).
500 63. Veloukas T, Kalogeropoulou P, Markoglou A and Karaoglanidis G, Fitness and competitive 501 ability of Botrytis cinerea field isolates with dual resistance to SDHI and QoI fungicides, 502 associated with several sdh B and the cyt b G143A mutations. Phytopathology 104: 347-356 503 (2014).
504 64. Forcelini BB, Rebello CS, Wang N and Peres NA, Fitness, Competitive Ability, and Mutation 505 Stability of Isolates of Colletotrichum acutatum from Strawberry Resistant to QoI Fungicides.
506 Phytopathology 108: 462-468 (2018).
507 65. Fisher N, Brown AC, Sexton G, Cook A, Windass J and Meunier B, Modeling the Qo site of 508 crop pathogens in Saccharomyces cerevisiae cytochrome b. European journal of biochemistry 271:
509 2264-2271 (2004).
510 3
4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
For Peer Review
512
513
514
515 Tables
516 Table 1. The cytochrome b Q0 genotypes of the surveyed T. urticae strains.
517 518 519 520 521 522 523 524 525 526 527 528 529 530
531 All strains were field collected in Europe, except JP-R and Wasatch, which were laboratory strains. The substitutions in the
532 conserved regions of the cytochrome b Q0 pocket (the cd1-helix and ef-helix) are described using the GSS genotype as reference
533 (EU556751.1). *: Selected by cyenopyrafen, a complex II inhibitor, under laboratory conditions
534 535 536
Strain Host Origin Qo genotype Access. Nr.
JP-R Rose Japan* G132A MN029033
Wasatch Tomato United States - MN276073
FS1 Rose the Netherlands G132A MN029034
FS2 Potted rose the Netherlands - MN029035
FS3 Cucumber the Netherlands G126S MN029048
FS4 Gerbera the Netherlands - MN276066
FS5 Rose the Netherlands G126S MN276067
FS6 Rose the Netherlands G126S MN276068
FS7 Cucumber United Kingdom G126S MN029041
FS8 Strawberry United Kingdom G126S/A133T MN029042
FS9 Rose United Kingdom G126S MN029043
FS10 Cucumber United Kingdom - MN029044
FS11 Strawberry United Kingdom P262T MN276069
FS12 Cucumber Belgium - MN029036
FS13 Raspberry Germany - MN029037
FS14 Hop Germany - MN029038
FS15 Hop Germany - MN029039
FS16 Hop Germany - MN029040
FS17 Carnation Italy - MN276070
FS18 Rose Italy - MN276071
FS19 Citrus Italy - MN276072
FS20 Strawberry Spain - MN029045
FS21 Cucumber Spain - MN029046
FS22 Rose Romania - MN029047
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
