• Aucun résultat trouvé

mRNA localization by a 145-nucleotide region of the c-fos 3 '-untranslated region - Links to translation but not stability

N/A
N/A
Protected

Academic year: 2021

Partager "mRNA localization by a 145-nucleotide region of the c-fos 3 '-untranslated region - Links to translation but not stability"

Copied!
8
0
0

Texte intégral

(1)

HAL Id: hal-02197449

https://hal.archives-ouvertes.fr/hal-02197449

Submitted on 27 May 2021

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Distributed under a Creative Commons Attribution| 4.0 International License

mRNA localization by a 145-nucleotide region of the c-fos 3 ’-untranslated region - Links to translation but

not stability

G. Dalgleish, J. L. Veyrune, J. M. Blanchard, J. Hesketh

To cite this version:

G. Dalgleish, J. L. Veyrune, J. M. Blanchard, J. Hesketh. mRNA localization by a 145-nucleotide region of the c-fos 3 ’-untranslated region - Links to translation but not stability. Journal of Biological Chemistry, American Society for Biochemistry and Molecular Biology, 2001, 276 (17), pp.13593–13599.

�10.1074/jbc.M001141200�. �hal-02197449�

(2)

mRNA Localization by a 145-Nucleotide Region of the c-fos 3 ⴕ- Untranslated Region

LINKS TO TRANSLATION BUT NOT STABILITY*

Received for publication, February 11, 2000, and in revised form, November 20, 2000 Published, JBC Papers in Press, January 3, 2001, DOI 10.1074/jbc.M001141200

Gillian Dalgleish‡, Jean-Luc Veyrune§, Jean-Marie Blanchard§, and John Hesketh‡From the ‡Rowett Research Institute, Bucksburn, Aberdeen, AB21 9SB Scotland, United Kingdom,

§Institut de Genetique Moleculaire, CNRS UMR 5535, 1919 Route de Mende, 34293 Montpellier cedex 5, France, and theDepartment of Biological and Nutritional Sciences, University of Newcastle, Kings Road,

Newcastle-upon-Tyne, NE1 7RU, England, United Kingdom

The presence of a localization signal in the 3ⴕ-untrans- lated region of c-fos mRNA was investigated by in situ hybridization and cell fractionation techniques. Cells were transfected with chimeric gene constructs in which the␤-globin coding region was used as a reporter and linked to either its own 3ⴕ-untranslated region, the c-fos 3ⴕ-untranslated region, or the c-fos 3ⴕ-untranslated region containing different deletions. Replacement of the endogenous␤-globin 3ⴕ-untranslated region by that from c-fos caused a redistribution of the transcripts so that they were recovered in cytoskeletal-bound poly- somes and seen localized in the perinuclear cytoplasm.

Deletion of the AU-rich instability region did not affect transcript localization, but removal of a distinct 145- nucleotide region of the 3ⴕ-untranslated region abol- ished it. The prevention of transcript translation by des- ferrioxamine led to a marked loss of transcript localization, independent of mRNA instability. The data show that the 3ⴕ-untranslated region of c-fos mRNA, as c-myc, contains a localization signal, which targets the mRNA to the perinuclear cytoskeleton. We propose that this is important to ensure efficient nuclear import of these key regulatory proteins. mRNA localization by the fos 3ⴕ-untranslated region is independent of mRNA in- stability, and the two are determined by different regu- latory elements.

There is increasing evidence that many eukaryotic mRNAs have 3⬘-untranslated regions (3⬘-UTRs)1 that contain impor- tant control sequences. These regulate gene expression at the post-transcriptional level through control of mRNA stability, regulation of translation efficiency, and altering the coding capacity of mRNAs. More recently, sequence elements within 3⬘-UTRs have been discovered that are able to localize mRNAs to particular regions of the cytoplasm (1–3). In the early devel- opment of Drosophila and Xenopus, this mRNA localization is important for establishing morphological gradients, apparently leading to local protein synthesis (4). mRNA localization also

occurs in somatic mammalian cells such as fibroblasts where 3⬘-UTR sequences and the cytoskeleton have been shown to be involved in targeting mRNAs to the cell periphery and to the perinuclear cytoplasm (5– 8).

The c-myc mRNA has been shown to contain a localization signal within the 3⬘-UTR (5, 8); this directs a reporter tran- script to the perinuclear cytoplasm and to polysomes bound to the cytoskeleton (5). The perinuclear localization of c-myc mRNA and its association with the cytoskeleton has been sug- gested to provide local synthesis of the protein that promotes efficient import of the newly synthesized protein into the nu- cleus. This could be important in the case of unstable transcrip- tion factors; however, it is not clear if mRNAs coding for other transcription factors are also localized by a similar mechanism.

It is well established that the c-fos proto-oncogene encodes a transcription factor that is a very unstable protein, exhibiting rapid nuclear turnover (9) and a biphasic half-life. The equally unstable messenger RNA has been studied in some detail (10, 11) and is subject to both transcriptional and post-transcrip- tional control. Much evidence indicates that both the coding region and the 3⬘-UTR contain the information required for RNA destabilization. The c-fos 3⬘-UTR is capable of destabiliz- ing␤-globin mRNA and furthermore, AU-rich regions (ARE) within the 3⬘-UTR have been identified as important in insta- bility (11–14). In particular, the conserved motif AUUUA has been found in a variety of unstable mRNAs coding for proto- oncogenic transcription factors and cytokines (15). The cyto- plasmic lifespan of c-fos mRNA is dramatically increased by the addition of protein synthesis inhibitors, the so called “superin- duction phenomenon” (9, 10, 13, 16). Using chimeric␤-globin- fos 3⬘-UTR gene constructs in fibroblast cell lines, reporter stability was found to increase severalfold when the translation of the reporter was decreased (17, 18). This indicated some link between translation and ARE-dependent mRNA degradation of the c-fos mRNA; however, the mechanisms require further clarification.

c-fos mRNA has been shown to be enriched in cytoskeletal- bound polysomes released from the cell matrix following addi- tion of cytochalasin D (19, 20), implying that c-fos mRNA is translated on cytoskeletal-bound polysomes and is associated with the cytoskeleton. However, it is not known if the c-fos mRNA is localized or if this association with the cytoskeleton involves a signal within the 3⬘-UTR.

The aims of the present study were 3-fold: first, to determine whether the 3⬘-UTR of c-fos proto-oncogene contains a localiza- tion signal capable of directing a reporter construct to a distinct subcellular compartment or to the cytoskeleton; second, to study whether this localization is linked to mRNA translation/

* This work was supported by the Scottish Office Agriculture, Envi- ronment, and Fisheries Department and by Grant BioMed BHM4 CT95-0995 from the European Community. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

储To whom correspondence should be addressed. Tel.: 44-191-222- 8744; Fax: 44-191-222-8684; E-mail: [email protected].

1The abbreviations used are: UTR, untranslated region; ARE, AU- rich element; nt, nucleotide; IRE, iron response element; CHO, Chinese hamster ovary cells.

This paper is available on line at http://www.jbc.org

13593

This is an Open Access article under the CC BY license.

(3)

stability; and last, to determine whether the elements that regulate these aspects of mRNA fate are distinct. Cell fraction- ation and in situ hybridization analyses indicate that a specific 145-nt region of the c-fos 3⬘-UTR, distinct from the instability element, is sufficient to localize a reporter transcript. Further- more, initiation of translation of the transcript is required for the mRNA to be localized.

EXPERIMENTAL PROCEDURES

Gene Constructs—Gene constructs pIREglo䡠fos, pIREglo䡠fos⌬, and pIREglo䡠glo were made as previously described (17). Briefly, the BamHI genomic DNA fragment containing most of the mouse c-fos gene was recovered from p19/1 and cloned into the pJ6⍀ vector downstream from the rat ␤-actin promoter (21). The fos⌬ construct was obtained by excising the ARE contained in the 3⬘-UTR with NstI and MstI (respec- tively nucleotides 3701 and 3831 from the cap site) and re-ligation of the blunt ends. The IRE from the human ferritin gene was introduced into the constructs by cloning the following 43-base pair double-stranded oligonucleotide cloned into the XbaI site of pJ6⍀: (5⬘-CTAGGGATTC- CTGCTTCAACAGTGTTGGACGGATCCCTCTAGA-3⬘. This created the constructs, pIREglo䡠glo, pIREglo䡠fos and pIREglo䡠fos⌬. Further deletions in the fos 3⬘-UTR were generated by polymerase chain reac- tion with the following oligonucleotides, combining GDDS with succ- essively the reverse primers GDD2 (to produce⌬2), GDD3 (⌬3), GDD4 (⌬4), and GDD5 ⌬poly(A)). The polymerase chain reaction products (GDDS, AGGGCAGCTGCTGCTTACAC; GDD2, ACCATTCAGACCAC- CTCGAC; GDD3, GATACAATCCAGCACCAGGT; GDD4, GGAACAA- CACACTCCATGCG; GDD5, TCCACATGTCGAAAGACCTC) were cloned directly into pcDNA3.1/V5/his-TOPO (Invitrogen). All constructs were verified by sequencing, and they are shown schematically in Fig. 1.

Cell Culture and Transfection—Cells were grown in 90-mm Petri dishes for cell fractionation or RNA extraction and in glass chamber slides for in situ hybridization. LTK fibroblasts were grown in

Dulbecco’s minimal Eagle’s medium (Life Technologies, Inc.) and CHO cells in Ham’s F12 modified withL-glutamine (ICN Biomedicals Inc), both supplemented with 10% fetal calf serum and in an atmosphere of 5% CO2.

Transfection of LTKfibroblasts and Chinese hamster ovary cells was carried out using LipofectAMINE (Life Technologies, Inc.). Cells were cotransfected with both the plasmid DNA of interest and a pcDNA3 (Invitrogen) plasmid carrying neomycin resistance. Stable transfectants were selected by culture in the presence of 1 mg/ml G418.

For transient transfection, cells were transfected 2 days after subcul- ture, the medium was changed after 24 h, and in situ hybridization was carried out after a further 24 h.

In Situ Hybridization—Comparison of mRNA distribution was car- ried out in cells grown in multiwell chamber slides so that the different cell lines and different treatments could be studied under identical conditions; in this way mRNA distribution and its quantification was directly comparable. Fixation, hybridization, detection, and analysis was carried out as described previously (5, 8); a digoxigenin-labeled antisense riboprobe was used followed by alkaline phosphatase detec- tion. The probe was generated using T7 polymerase from a 511-base pair XbaI-BamHI fragment containing most of the first two exons of the rabbit␤-globin gene using a DIG RNA labeling kit (Roche Molecular Biochemicals). Controls were either hybridized with a digoxigenin- labeled sense probe generated from the same fragment using SP6 polymerase or incubated with hybridization mix containing no probe.

Bound probe was detected by incubation with alkaline phosphate- linked anti-digoxigenin and incubation with 4-nitro blue tetrazolium for 16 h or with HNPP detection kit (Roche Molecular Biochemicals). The staining produced by the alkaline phosphatase activity was quantified using an image analysis system in which the images were captured using a Pulnix camera and Fenestra/Cyclops software (Kinetic Imaging Ltd., Liverpool, UK).

For each cell, staining intensity was measured in three small areas of identical size (8). First, a measurement of staining was taken from the perinuclear region; this was defined as a region of cytoplasm close to the nucleus but not including any of it. A second measurement was taken in an adjacent area of the cytoplasm but in the cellular periphery, near the cell membrane, and finally a cell blank was taken out with the cell.

Following subtraction of the blank reading, a perinuclear/peripheral staining ratio was calculated to obtain a quantitative measure of the extent of the localization in each case. 3– 4 measurements were made in each cell, and 30 individual cells selected at random were analyzed for each cell line. The experiments and analyses were repeated at least three times.

The staining pattern produced using the fluorogenic substrate HNPP was examined by confocal laser scanning microscopy (CLSM). CLSM was performed using a Bio-Rad confocal laser with a krypton-ion laser and an emission line at 568 nm. Cells were examined using a ⫻ 60 objective lens and optically sectioned at 0.5-␮m slice thickness parallel to the substratum. Images were directly transferred to an optical disc and subsequently analyzed using Confocal Assistant software. Images were converted to TIFF format, and figures were assembled using Freehand version 8.

Cell Fractionation, RNA Extraction, and Northern Hybridization—

For analysis of endogenous fos expression, LTK cells were serum- starved for 20 h prior to treatment with cyclohexamide (10␮g/ml) and serum (10% fetal calf serum) for 30 min prior to extraction of polysomes;

this treatment elevates endogenous fos mRNA expression (9, 22). Cells stably transfected with pIREglo䡠glo, pIREglo䡠fos, and pIREglo䡠fos⌬ did not require serum induction or cyclohexamide treatment prior to frac- tionation. Free cytoskeletal-bound and membrane-bound polysomes were isolated using a sequential detergent/salt extraction procedure followed by centrifugation at 32,000 ⫻ g for 16 h through a 10-ml cushion of 40% sucrose, as described previously (5, 23, 24).

Total RNA was extracted by the method of Chomczynski and Sacchi (25), and the RNA species were then separated by electrophoresis through a denaturing 2.2Mformaldehyde, 1.2% agarose gel (26) and transferred to a nylon membrane (Genescreen from PerkinElmer Life Sciences) by capillary blotting. RNA was fixed to the membrane by exposure to UV light, and membranes were prehybridised overnight at 42 °C with 0.1 gm/ml denatured salmon sperm DNA in 50% formamide, 10% dextran sulfate, 0.2% bovine serum albumin, 0.2% polyvinlypyrri- lidone, 0.2% ficoll, 0.1% sodium pyrophosphate, 1% SDS, and 50 mM

Tris-HCl, pH 7.5.

The␤-globin probe corresponded to the XbaI-XhoI fragment previ- ously used for Northern analysis (5). The c-fos probe was produced from a 1.3-kilobase pair PstI fragment of the v-fos gene in the pfos-1 vector (27); and c-myc from a 1.8-kilobase pair HindIII fragment from the FIG. 1. Details of gene constructs with variations in the 3ⴕ-

untranslated region. The coding region of ␤-globin was used as a reporter transcript. In one set of constructs, it was linked both to the IRE from the ferritin gene (in a 5⬘ position) and either its own 3⬘-UTR (pIREglo䡠glo), the whole 3⬘-UTR from c-fos (pIREglo䡠fos), or the c-fos 3⬘-UTR with a the instability region deleted (pIREglo䡠fos⌬, removing bases 589⫺715); these three constructs used the fos polyadenylation signal (poly(A)). A second set of constructs lacked the IRE and consisted of the␤-globin coding region linked to the whole fos 3⬘-UTR, the 3⬘-UTR without the instability region (pcDNA3.1poly(A) glo䡠fos⌬), or the 3⬘- UTR with increasingly large deletions so that⌬2, ⌬3, and ⌬4 contained respectively, bases 0 – 646, 0 – 403, and 0 –260 of the fos 3⬘-UTR. These constructs utilized the vector polyadenylation signal (from bovine growth hormone, BGH). A final construct contained globin coding se- quences, the whole fos 3⬘-UTR, and the BGH polyadenylation site.

Localization Signal in 3 ⬘-UTR of c-fos mRNA

13594

(4)

mouse pT7–2 vector (5). A 50 –100-ng sample of each DNA probe was labeled with [32P]dCTP by random priming (Amersham Pharmacia Biotech) and the labeled DNA was then separated from free nucleotides by gel filtration on Sephadex G-50; probe-specific activities were⬃109 cpm/␮g DNA. The labeled probes were added to the prehybridization mix and hybridized at 42 °C for 24 h. The membranes were then washed to remove nonspecific hybridizations twice in 2⫻ SSC at room temper- ature for 5 min, followed either by 0.75⫻ SSC, 1% SDS (globin); 0.5⫻

SSC, 1% SDS (fos and myc) or 0.2⫻ SSC, 1% SDS (18 S) at 65 °C for 1 h (twice). Specific hybridization was then detected and quantified using Canberra Packard Instantimager. After stripping, membranes were rehybridised with a 1.4-kilobase probe for 18 S rRNA (28) to quantify RNA loading.

The half-life of transcripts derived from appropriate constructs was estimated in stable transfected cell lines by inhibition of transcription with actinomycin D (5␮g/ml) and subsequent RNA extraction after 2, 4, 6, and 10 h, and estimation of transcript abundance by Northern hybridization.

Statistical Analysis—Data from quantification of cell fractionation or in situ hybridization were expressed as logarithms of the ratio of cy- toskeletal/free polysomes or perinuclear/peripheral staining and ana- lyzed using the Student’s t test.

RESULTS

Endogenous c-fos mRNA Is Enriched in Cytoskeletal-bound Polysomes—It has previously been reported that c-fos mRNA (along with other cytoskeletal-bound mRNAs) can be released from the cell matrix by treatment with cytochalasins (19). A more recent sequential detergent and salt extraction releases cytoskeletal-bound polysomes from the cell matrix (29); a non- ionic detergent soluble fraction contains free polysomes (F), a salt extract contains cytoskeletal-bound polysomes (C), and a deoxycholate-solubilized fraction contains membrane bound polysomes (M). As shown in Fig. 2A, c-fos mRNA was found enriched in the C fraction as has been observed previously for c-myc mRNA (5). This was confirmed by quantification of the Northern analysis; the C/F ratio of c-fos mRNA abundance was 1.8 (data not shown), indicating enrichment of c-fos mRNA in cytoskeletal-bound polysomes.

c-fos 3⬘-UTR Localizes a Reporter mRNA Sequence to Cy- toskeletal-bound Polysomes and the Perinuclear Cyto- plasm—To study the localization functions of the fos 3⬘-UTR, stable transfected cell lines were made that express chimeric gene constructs in which the fos 3⬘-UTR, fos⌬ 3⬘-UTR, or globin 3⬘-UTR were linked to the␤-globin coding region as a reporter.

Addition of either the c-fos 3⬘-UTR or c-fos ⌬3⬘-UTR to the

␤-globin coding region reporter led to the globin transcripts being recovered at highest abundance in the cytoskeletal- bound polysome fraction, which was not the case in the␤-globin control (Fig. 2B). In all three cell lines (glo䡠glo, glo䡠fos, and glo䡠fos⌬) the c-myc mRNA was enriched in the C fraction (Fig.

2B). The ratio of transcript abundance (per unit 18 S rRNA) in cytoskeletal-bound polysomes/free polysomes was significantly higher (p⬍ 0.05) in both the glo䡠fos and glo䡠fos⌬ cells compared with the glo䡠glo control cells (Fig. 2C).

In situ hybridization was used to detect the subcellular lo- calization of the globin transcripts. In LTKcells transfected with a control construct containing the whole of the␤-globin gene there was no specific subcellular localization of the globin reporter transcript (Fig. 3A, as previously reported (8); this is indicated by staining throughout the cytoplasm of the cell.

However, cell lines transfected with constructs in which the c-fos 3⬘-UTR was linked to a␤-globin coding sequence, resulted in a marked perinuclear distribution, visible as rings of stain- ing around the nucleus, but with little or no staining toward the cellular periphery (Fig. 3A). A similar perinuclear-staining pattern was seen in cells expressing the stable glo䡠fos⌬ tran- scripts (Fig. 3A); the increased staining intensity in these cells, compared with glo䡠fos cells, may be attributed to the greater stability of the glo䡠fos⌬ transcript. These differences in tran-

script distribution were confirmed by image analysis (see “Ex- perimental Procedures” and Ref. 5); as shown in Fig. 3B, the glo䡠fos and glo䡠fos⌬ transcripts showed an enrichment of the perinuclear cytoplasm, which was significantly (p ⬍ 0.01) greater than that of the glo䡠glo control. The difference between the c-fos⌬ construct and the globin-fos construct is that the instability element has been deleted from the 3⬘-UTR (17);

indeed the glo䡠fos⌬ transcript is not rapidly degraded and has a half-life of greater than 10 h compared with 2 h for glo䡠fos (Fig. 4). Because both the rapidly degraded glo䡠fos and the stable glo䡠fos⌬ transcripts are localized, it is evident that not only is the fos 3⬘-UTR capable of targeting the globin reporter FIG. 2. Distribution of c-fos, c-myc, and ␤-globin transcripts between free, cytoskeletal-bound, and membrane-bound poly- somes in LTKfibroblasts. LTKcells were subjected to sequential detergent and salt extraction to release free (F), cytoskeletal-bound (C), and membrane-bound polysomes (M). RNA was extracted from the polysomes and analyzed by Northern hybridization using32P-labeled DNA probes. Results are shown for 10 ␮g of total RNA, and each hybridization was carried out sequentially on the same nylon mem- brane. A, samples from untransfected cells were analyzed successively for c-fos mRNA, c-myc mRNA, and 18 S rRNA (to control for any variation in loading). The c-fos and c-myc mRNAs were found at highest abundance in the C fraction. B, RNA from transfected cells was ana- lyzed for globin, c-myc, and 18 S. Globin transcripts with the endoge- nous 3⬘-UTR (glo䡠glo) were found at highest abundance in the F fraction with considerable amounts in the C. In contrast, the transcripts with globin linked to the whole fos 3⬘-UTR (glo䡠fos) or the fos 3⬘-UTR with the ARE removed (glo䡠fos⌬) showed highest abundance in the C fraction, in parallel to c-myc distribution. C, quantification of Northern blots from four experiments confirmed that addition of the fos 3⬘-UTR (or fos⌬) increased association of globin transcripts with the cytoskeleton. Data were expressed as mRNA abundance per unit 18 S rRNA, and then the ratio of abundance in C fraction compared with that in the F fraction was calculated.

(5)

to cytoskeletal-bound polysomes and the perinuclear cytoplasm but that this targeting is independent of message stability.

Confocal Microscopy of CHO Cells Transfected with Globin Reporter Linked to c-fos 3⬘-UTR—CHO cells have a wider, broader morphology and were used to confirm the results ob- tained in LTK cells, coupled with the use of a fluorescent HNPP detection method and confocal microscopy. Confocal mi- croscopy allows analysis of z-sections through the cells, thereby reducing artifacts in analysis because of differences in cellular thickness. Cells were transiently transfected with each of the

constructs, and fluorescent in situ hybridization was used to visualize the distribution of the reporter transcripts.

Cells transfected with the glo䡠glo construct (Fig. 5a) again showed no particular localization of transcripts, as indicated by fluorescent staining present throughout the cytoplasm. In con- trast, as shown in Fig. 5, b and c, cells expressing either glo䡠fos or glo䡠fos⌬ transcripts both showed a clear localization of stain- ing in the perinuclear region. The differences in staining pat- tern were confirmed by image analysis. Profiles of staining intensity showed that the intensity of staining remains high throughout the cytoplasm (even toward the extremities of the cells) in cells transfected with the glo䡠glo construct, but that the cells expressing the glo䡠fos and glo䡠fos⌬ constructs exhibited a peak of intensity in the perinuclear region (results not shown).

Combined, these data indicate that the differences in globin reporter distribution on addition of c-fos 3⬘-UTR sequences represent a true mRNA redistribution and cannot be accounted for by differences in cellular thickness.

Effect of Altering Translation on Reporter Transcript Distri- bution—The glo䡠fos and glo䡠fos⌬ constructs contain an IRE in a position 5⬘ to the globin reporter. The presence of this IRE makes translation of the reporter transcript sensitive to iron concentration in the culture media (17). Under conditions where iron is abundant (such as cells treated with ferric am- FIG. 5. Confocal microscopy showing␤-globin transcript dis- tribution in transiently transfected CHO cell lines. CHO cells were transiently transfected with the glo䡠glo, glo䡠fos, and glo䡠fos⌬ con- structs. Globin transcripts were detected by in situ hybridization using a digoxigenin-labeled riboprobe specific for the globin coding sequence and alkaline phosphatase-linked anti-digoxigenin antibody with the fluorogenic HNPP as substrate. The distribution of the fluorescent product was detected by confocal microscopy and 0.5␮m z-series sec- tions that were collected through the cells. The sections shown are taken through the middle of the cell. There was no localization of the

␤-globin in the cells transfected with glo䡠glo (a), but those transfected with either glo䡠fos (b) or glo䡠fos⌬ (c) showed distinct perinuclear local- ization of the globin transcripts. Note the perinuclear ring present in b and c but not in a. The data confirm that the c-fos 3⬘-UTR is capable of targeting a globin reporter to the perinuclear cytoplasm. Bar represents 10␮m.

FIG. 3. In situ hybridization and quantification of the distri- bution of globin transcripts showing the effects of c-fos 3ⴕ-UTR on distribution of reporter. A, LTKfibroblasts were stably trans- fected with glo䡠glo, glo䡠fos, and glo䡠fos⌬ constructs. Globin transcripts were detected by in situ hybridization using a digoxigenin-labeled ribo- probe specific for the globin coding sequence and alkaline phosphatase- linked anti-digoxigenin antibody with 4-nitro blue tetrazolium as sub- strate. Using antisense probes, specific transcript distribution was detected. In glo䡠glo cells (a), there was distinct localization of tran- scripts, but in both glo䡠fos (b) and glo䡠fos⌬ (c), rings of staining were observed in the perinuclear cytoplasm with little or no staining in the cell periphery. Bar represents 10␮m. B, LTKfibroblasts stably trans- fected with either glo䡠glo, glo䡠fos, or glo䡠fos⌬. Globin transcripts were detected by in situ hybridization using a digoxigenin-labeled riboprobe specific for the globin coding sequence and alkaline phosphatase-linked anti-digoxigenin antibody with 4-nitro blue tetrazolium as substrate.

Images were captured and staining was quantified in the perinuclear and peripheral cytoplasm of at least 30 cells chosen at random. The data were collected from the same stable cell lines illustrated in A.

FIG. 4. Stability of chimeric globin-fos 3ⴕ-UTR transcripts in transfected CHO cells. mRNA stability was assessed by measure- ment of transcript levels using Northern hybridization. Total RNA was isolated from glo䡠fos (f), glo䡠fos⌬ (Œ), glo䡠fos⌬2 (E), glo䡠fos⌬3 (⽧), and glo䡠fos⌬4 (●) cells grown in normal medium and 2, 4, 6, and 10 h after treatment with actinomycin D.

Localization Signal in 3 ⬘-UTR of c-fos mRNA

13596

(6)

monium citrate) the IRE promotes mRNA translation, whereas under conditions where iron is scarce (such as after treatment with chelator desferrioxamine), translation is prevented and the RNA is found in free mRNPs. This effect has been found to be specific for transcripts containing an IRE, and global protein synthesis is not affected by iron availability. When cells ex- pressing either glo䡠fos or glo䡠fos⌬ transcripts were cultured in elevated iron concentrations, (conditions in which the reporter transcript is actively translated), the perinuclear localization of the transcripts was maintained (Fig. 6, b and d), as indicated by a strong ring of staining surrounding the nucleus. Con- versely, addition of desferrioxamine for 16 –20 h (which reduces the translation of the chimeric transcripts), led to a less marked ring of perinuclear staining in both cell lines (Fig. 6, a and c). Treatment with ferric ammonium citrate or desferriox- amine had no effect on cell morphology (Fig. 7).

A 145-Nucleotide Region of the c-fos 3⬘-UTR Is Required to Localize a Reporter Construct—The data from cells transfected with the glo䡠fos⌬ construct show that the region between bases 589 and 715 is not necessary for localization. The c-fos 3⬘-UTR is highly conserved throughout evolution, and sequence align- ments indicate an 80% homology between species with certain regions showing high conservation. It is possible that one of these other conserved regions is involved in localization. To define further the 3⬘-UTR region required for localization, three new deletions were made in which different regions of highly conserved homology were removed. The different 3⬘- UTR deletion products were linked to ␤-globin reporter se-

quences (as in the previous constructs), resulting in the␤-glo- bin linked to the c-fos 3⬘-UTR with increasingly large deletions.

During cloning of these constructs the endogenous poly(A) site was removed and replaced with that of the bovine growth hormone within the pcDNA3.1 mammalian expression vector.

To ensure that this had no effect on the localization of the mRNA, a further construct was produced, which removed only the region containing the endogenous c-fos poly(A) site (⌬poly- (A)GF). The replacement of the poly(A) site was found to have no effect on mRNA of the reporter by the c-fos 3⬘-UTR (data not shown).

CHO cells were transfected with each of the⌬2, ⌬3, and ⌬4 constructs and were analyzed by in situ hybridization after both transient and stable transfection. In each case, the⌬2 and

⌬3 both showed a perinuclear distribution of globin transcripts (Fig. 8, a and b). However, cells transfected with the⌬4 con- struct no longer exhibited a perinuclear localization (Fig. 8c), with globin transcripts distributed throughout the cell to the periphery. The localization of the globin transcripts was quan- tified in both stable and transient transfectants by scoring the percent cells with transcript distribution localized in the pe- rinuclear region. In each group under study, at least 100 cells were analyzed and, as shown in Table I, the results showed that 64 – 85% of the cells transfected with⌬2 or ⌬3 exhibited perinuclear localization, but only 14 –22% of the cells express- ing ⌬4 showed localization. This confirms the observations illustrated in Fig. 8 and shows that removal of bases 3⬘ to position 403 does not affect localization, but that removal of the 145-nt region between bases 260 and 403 largely destroys the ability of c-fos 3⬘-UTR sequences to localize globin transcripts to the perinuclear cytoplasm. The stability of⌬2, ⌬3, and ⌬4 transcripts was assessed following actinomycin D treatment, and all three were found not to be rapidly degraded but to be stable, similar to the glo䡠fos⌬ transcript; the half-lives were all similar and all greater than 10 h (Fig. 4). The comparable stability of these transcripts indicates that the differences in localization are independent of stability. Overall, the data show that the 145-nt region of the c-fos 3⬘-UTR between bases 260 and 403 is sufficient to localize the globin reporter.

DISCUSSION

Endogenous c-fos mRNA has been shown to be associated with the cytoskeleton (19, 20). The present results confirm this observation using a complementary method involving separa- tion of cytoskeletal-bound polysomes by salt treatment of the cell matrix (23). Furthermore, the data show that the c-fos 3⬘-UTR is also sufficient to target a chimeric reporter to cy- toskeletal-bound polysomes and the perinuclear cytoplasm.

This suggests that the c-fos 3⬘-UTR contains a perinuclear targeting signal.

It was formally possible that the perinuclear distribution of the glo䡠fos transcript was caused by mRNA instability rather than a mRNA targeting mechanism. However, although re- moval of the instability element from the 3⬘-UTR (glo䡠fos⌬) produced transcripts with a significantly longer half-life it had no effect on the perinuclear localization of transcripts or asso- ciation with the cytoskeleton induced by the c-fos 3⬘-UTR. In addition, a further deletion in the 3⬘-UTR (⌬4) destroyed local- ization without affecting mRNA stability. These data suggest that the observed localization caused by c-fos 3⬘-UTR sequences is due to a mRNA localization mechanism and not an effect on mRNA instability. Furthermore, they indicate that the local- ization signal is distinct from the ARE instability region, and that localization by the c-fos 3⬘-UTR is not linked to the mRNA degradation pathway.

Previous studies using stable (17) and transient (18) trans- fected cell lines expressing chimeric globin-fos 3⬘-UTR con- FIG. 6. In situ hybridization showing the effects of modulating

iron concentration on globin transcript distribution in trans- fected CHO cells. CHO cells transfected with pIREglobin䡠fos and pIRE globin䡠fos⌬ were cultured in medium either supplemented with ferric ammonium citrate (10␮M) or treated with desferrioxamine (100

M) for 16 h prior to fixation and in situ hybridization using an anti- sense riboprobe specific for the globin coding sequences. Specific label- ing was detected using an alkaline phosphatase-linked anti-digoxigenin antibody and 4-nitro blue tetrazolium as substrate. Cells transfected with either the IREglo䡠fos (b) and IREglo䡠fos⌬ (d) showed distinct pe- rinuclear distribution when the cells were grown in medium supple- mented with iron (IRE-containing transcripts translated). In contrast, both IREglo䡠fos (a) treated with desferrioxamine (to reduce iron levels and so prevent translation of transcripts containing the IRE) and IREglo䡠fos⌬ (c) cells treated with desferrioxamine showed no localiza- tion of the transcripts. In the latter, there was no ring of perinuclear staining, and staining was found throughout the cytoplasm into the cell periphery. Bar represents 10␮m.

(7)

structs containing a IRE found that prevention of the initiation of translation (by addition of an iron chelator) led to a signifi- cant increase in the half-life of the reporter mRNA. Further- more, removal of the ARE in the glo䡠fos⌬ construct led to a stable mRNA that was insensitive to Fe availability (10, 17, 30). These observations indicated that the stability of tran- scripts due to control by the ARE within the fos 3⬘-UTR is linked to translation. In contrast, although the present results indicate no link between localization by the fos 3⬘-UTR and mRNA stability, they do suggest a link between translation and localization; alterations in Fe concentration in the medium not only prevent the initiation of translation of glo䡠fos and glo䡠fos⌬ transcripts (17), but also affect their localization. Be- cause desferrioxamine has no effect on degradation of the more stable glo䡠fos⌬ mRNA (17), its effect on transcript localization (Fig. 6) cannot be accounted for by altered transcript stability.

Thus, the changes in glo䡠fos⌬ distribution in response to re- duced iron availability indicate that initiation of translation is required for localization and that these effects do not reflect differences in mRNA stability.

Further deletion studies showed that removal of the fos 3⬘-UTR from 647 to the poly(A) signal and from 403 to 647 had no effect on localization. However, removal of bases 260 – 403 led to loss of localization without any change in transcript stability, showing that this 145-nt sequence contains the local- ization signal required for perinuclear localization and associ- ation with the cytoskeleton. This region has not been impli- cated in stability, is distinct from the ARE region, but it is highly conserved between species. More detailed investigation into the region of the c-fos 3⬘-UTR is required to define the exact part of a 145-nt region that is responsible for localization and to determine the precise nature of the perinuclear target- ing signal.

The c-fos 3⬘-UTR is highly conserved between species, which implies that it has an important functional role. This indeed appears to be the case and overall, the present results support the view that the c-fos 3⬘-UTR has a multifunctional role in mediating mRNA degradation and localization, and that these in turn are linked to translation. Furthermore, it is apparent that the elements within the 3⬘-UTR responsible for mRNA localization and instability are distinct. The presence of the instability element is well documented (11, 12, 14, 30, 31), but the present observation of a localization function is novel.

The evidence presented here suggests that 3⬘-UTR sequences ensure that c-fos mRNA is translated in the correct location, namely associated with the perinuclear cytoskeleton. Further- more, perinuclear mRNA localization on the cytoskeleton pro- motes efficient nuclear protein import of metallothionein-1 (32). Targeting of mRNAs to the cytoskeleton may be a general mechanism to promote efficient nuclear protein import, and this may be particularly important for an unstable protein that is required to be used as efficiently as possible (33). Further- more, such a mechanism could be a control point; ␤-actin mRNA localization responds to growth factor stimulation (34), FIG. 8. Effect of deletion in the c-fos 3ⴕ-UTR on its ability to

target␤-globin transcripts to the perinuclear cytoplasm. ␤-glo- bin transcript distribution was studied by in situ hybridization in transiently transfected CHO cells. Globin transcripts were detected by in situ hybridization using a digoxigenin-labeled riboprobe specific for globin coding sequence and alkaline phosphatase-linked anti-digoxige- nin antibody with 4-nitro blue tetrazolium as substrate. Cells trans- fected with glo䡠fos⌬2 (a) and glo䡠fos⌬3 (b) showed distinct perinuclear distribution of the globin transcripts (note the perinuclear ring of stain- ing), but cells transfected with glo䡠fos⌬4 showed no localization of transcripts. Cells reacted with sense riboprobe showed no staining (d).

Bar represents 10␮m.

TABLE I

Effect of deletions in the c-fos 3⬘-untranslated region on its ability to localise␤-globin reporter transcripts

The distribution of globin transcripts was studied in cells transfected with a series of deletion constructs using in situ hybridization with a digoxigenin-labeled riboprobe and alkaline phosphatase detection. Both stable and transient transfectants of each construct were studied, and in every case at least 100 cells were scored for transcript localization.

The data presented are from two separate experiments.

FIG. 7. Cellular morphology after modulating iron concentration in the media of CHO glo䡠fos cells. CHO cells transfected with IREglo䡠fos were cultured in either normal medium (a), in medium supplemented with 10␮Mferric ammonium citrate (b) or treated with 100M desferrioxamine (c) for 16 h prior to analysis. No change in cellular morphology was observed following either experimental treatment.

Localization Signal in 3 ⬘-UTR of c-fos mRNA

13598

(8)

and if c-myc or c-fos mRNA localization was modulated simi- larly, it could provide a mechanism to regulate nuclear local- ization of the protein.

REFERENCES 1. St. Johnston, D. (1995) Cell 81, 161–170 2. Hesketh, J. E. (1996) Exp. Cell Res. 225, 219 –236

3. Bassell, G., and Singer, R. H. (1997) Curr. Opin. Cell Biol. 9, 109 –115 4. Gavis, E. R. (1997) Trends Cell Biol. 7, 485– 492

5. Hesketh, J., Campbell, G., Piechaczyk, M., and Blanchard, J. M. (1994) Biochem. J. 298, 143–148

6. Kislauskis, E. H., Zhu, X. C., and Singer, R. H. (1994) J. Cell Biol. 127, 441– 451

7. Wilson, I. A., Brindle, K. M., and Fulton, A. M. (1995) Biochem. J. 308, 599 – 605

8. Veyrune, J. L., Campbell, G. P., Wiseman, J., Blanchard, J. M., and Hesketh, J. E. (1996) J. Cell Sci. 109, 1185–1194

9. Muller, R., Bravo, R., Burckhardt, J., and Curran, T. (1984) Nature 312, 716 –720

10. Bonnieu, A., Rech, J., Jeanteur, P., and Fort, P. (1989) Oncogene 4, 881– 888 11. Shyu, A. B., Greenberg, M. E., and Belasco, J. G. (1989) Genes Dev. 3, 60 –72 12. Shaw, G., and Kamen, R. (1986) Cell 46, 659 – 667

13. Wilson, T., and Treisman, R. (1988) Nature 336, 396 –399

14. Chen, C. Y., You, Y., and Shyu, A. B. (1992) Mol. Cell. Biol. 12, 5748 –5757 15. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brownshimer, S., and Cerami,

A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 1670 –1674 16. Treisman, R. (1985) Cell 42, 889 –902

17. Veyrune, J. L., Carillo, S., Vie, A., and Blanchard, J. M. (1995) Oncogene 11, 2127–2134

18. Winstall, E., Gamache, M., and Raymond, V. (1995) Mol. Cell. Biol. 15, 3796 –3804

19. Bird, R. C., and Sells, B. H. (1986) Biochim. Biophys. Acta 868, 215–225 20. Zambetti, G., Wilming, L., Fey, E. G., Penman, S., Stein, J., and Stein, G.

(1990) Exp. Cell Res. 191, 246 –255

21. Morgenstern, J. P., and Land, H. (1990) Nucleic Acids Res. 18, 1068 22. Kruijer, W., Cooper, J. A., Hunter, T., and Verma, I. M. (1984) Nature 312,

711–716

23. Hesketh, J. E., Campbell, G. P., and Whitelaw, P. F. (1991) Biochem. J. 274, 607– 609

24. Hovland, R., Campbell, G., Pryme, I., and Hesketh, J. (1995) Biochem. J. 310, 193–196

25. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156 –159 26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, pp. 7.37–7.49, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

27. Curran, T., Peters, G., Vanbeveren, C., Teich, N. M., and Verma, I. M. (1982) J. Virol. 44, 674 – 682

28. Erickson, J. M., Rushford, C. L., Dorney, D. J., Wilson, G. N., and Schmickel, R. D. (1981) Gene 16, 1–9

29. Vedeler, A., Pryme, I. F., and Hesketh, J. E. (1991) Mol. Cell. Biochem. 100, 183–193

30. Fort, P., Rech, J., Vie, A., Piechaczyk, M., Bonnieu, A., Jeanteur, P., and Blanchard, J. M. (1987) Nucleic Acids Res. 15, 5657–5667

31. Chen, C. Y., and Shyu, A. B. (1994) Mol. Cell. Biol. 14, 8471– 8482 32. Levadoux, M., Mahon, C., Beattie, J. H., Wallace, H. M., and Hesketh, J. E.

(1999) J. Biol. Chem. 274, 34961–34966

33. Carillo, S., Pariat, M., Steff, A. M., Roux, P., Etiennejulan, M., Lorca, T., and Piechaczyk, M. (1994) Oncogene 9, 1679 –1689

34. Latham, V. M., Kislauskis, E. H., Singer, R. H., and Ross, A. F. (1994) J. Cell Biol. 126, 1211–1219

Références

Documents relatifs

Depending on the model size, strong scaling (speedup at a larger number of cores) was satisfactory for the explicit method, and more limited for the implicit method.. The im-

For an ex- tractive laser-based system with a 200 m path length, in or- der to achieve a 50 ppt v detection limit, a spectrometer would need a detection sensitivity corresponding

Après un survol des principales approches ayant orienté la recherche en gestion stratégique des ressources humaines (GSRH), il sera question des construits

By analysing the degradation kinetics we demonstrate the existence of di fferent processes: (i) trapping of electrons in the gate insulator under positive gate bias, (ii) time-

In this manuscript I will focus on the int6 (Integration site 6) gene, the sixth member of the int genes family which has been demonstrated to be a frequent site were the

Das FZA verweist in seinem Anhang III sowohl auf die Richtlinie 2005/36 über die Anerkennung von Berufsqualifikationen als auch auf die Richtlinie 98/5 zur

Un jour, Raoul arrive dans la forêt des loups gris... Partie 2 : page 5

On a également observé que les accidents vasculaires céré- braux de type non hémorragique sont survenus chez 4,4 % des patients du groupe recevant le placebo, comparativement à 3,4