113
Title : A recurrent missense variant in EYA3 gene is associated with Oculo-Auriculo-Vertebral
Spectrum
Authors : Angèle Tingaud-Sequeira1, Aurélien Trimouille1,2, Manju Salaria3,6, Rachel Stapleton4, Stéphane Claverol5, Claudio Plaisant2, Marc Bonneu5, Estelle Lopez1, Benoit Arveiler1,2, Didier Lacombe1,2, Caroline Rooryck1,2*
1 Univ. Bordeaux, Maladies Rares: Génétique et Métabolisme (MRGM), U 1211 INSERM,
F-33000 Bordeaux
2 CHU de Bordeaux, Service de Génétique Médicale, Centre de Référence Anomalies du Développement et Syndromes Malformatifs, F-33076, Bordeaux, France
3Genetic Health Service, Monash Health, 246 Clayton Road, Clayton VIC 3168, Australia.
4Genetic Health Service NZ - South Island Hub, Christchurch Hospital, Christchurch 8140,
New Zealand
5Plateforme Protéome, Centre Génomique Fonctionnelle Bordeaux, France
6Wyndham Specialist Care Centre, 289 Princes Highway, Werribee, VIC 3030, Australia.
*Corresponding Author: Pr. Caroline Rooryck MRGM, Inserm U1211
CHU Pellegrin – Ecole des Sages-femmes
Place Amélie Raba-Léon 33076 Bordeaux Cedex France e-mail: caroline.rooryck-thambo@chu-bordeaux.fr
114 Acknowledgments. The authors warmly thank the patients and their families. They thank the clinician geneticists for providing patients.
Key words: Goldenhar, Oculo-auriculo-vertebral spectrum, EYA3, zebrafish, H2AFX, genetics
Declarations
Funding. This work was supported by the ANR (Agence Nationale pour la Recherche, ANR-12-JVS1-0002).
Competing interests. The authors declare no conflict of interest.
Ethics approval. The local ethics committee (Comité de Protection des Personnes: DC2012/76) approved this study.
Consent to participate. Informed written consent for genetic studies was obtained prior to collecting blood samples for DNA extraction.
Availability of data and material. All data that support the findings of this study are available on request from the corresponding author.
Authors' contributions. AT-S, AT and CR planned the experiments. AT-S, AT, SC, CP, MB and EL performed experiments and analyzed data. MS, RS, BA, DL and CR clinically ascertained patients and provided samples; AT-S, AT and CR co-wrote the manuscript.
115
Abstract
Goldenhar syndrome or Oculo-auriculo-vertebral spectrum (OAVS) is a complex developmental disorder characterized by asymmetric ear anomalies, hemifacial microsomia, ocular and vertebral defects. We aimed at identifying and characterizing a new gene associated with OAVS.
Two affected brothers from family 1 were analyzed by exome sequencing. EYA3 screening was then performed in 122 OAVS patients. Mutated protein stability and function were investigated in cellular models by overexpression. Knockdown by siRNA experiments in HeLa cells followed by proteomics analysis were performed. Developmental role of zebrafish eya3 was assessed based on transient knockdown strategy using morpholinos.
We reported a recurrent heterozygous missense variant (p.(Asn312Ser)) in the EYA3 gene in two unrelated families. Segregation assessment in both families showed incomplete penetrance and variable expressivity. We investigated this variant in cellular models in order to determine its pathogenicity and demonstrated an increased half-life of the mutated protein with a lower ability to dephosphorylate H2AFX following DNA repair pathway induction. Proteomics performed on this cellular model revealed 4 significantly predicted upstream regulators which are PPARGC1B, YAP1, NFE2L2 and MYC. Moreover, eya3 knocked-down zebrafish embryos developed specific craniofacial abnormalities corroborating previous animal models and supporting its involvement in the OAVS. Additionally, EYA3 gene expression was deregulated
116 EYA3 is the second recurrent gene identified to be associated with OAVS. Moreover, based on protein interactions and related diseases, we suggest the DNA repair as a key molecular pathway involved in craniofacial development.
Introduction
Oculo-auriculo-vertebral spectrum (OAVS), also reported as Goldenhar syndrome or Hemifacial Microsomia [MIM 164210], is a rare developmental disease involving the first and second branchial arch derivatives, with incidence around 1/26 500 (Barisic et al. 2014). The clinical phenotype is highly heterogeneous and characterized by hemifacial microsomia and/or asymmetric ear anomalies (microtia, preauricular tags, external auditory canal atresia, conductive and/or sensorineural hearing loss…), ocular defects (epibulbar dermoids, microphthalmia…), vertebral malformations (fused cervical vertebrae, vertebral puzzle…)(Gorlin et al. 1963; Gorlin R, Cohen MM 2001). Other features are cleft lip/palate, cardiac, renal or cerebral malformations, and rarely mental retardation. OAVS was first described in 1952 by Maurice Goldenhar (Goldenhar 1952) and the clinical spectrum of this disorder has since been expanded (Gorlin et al. 1963; Gorlin R, Cohen MM 2001).
Diverse chromosomal abnormalities have been associated with OAVS (Barber 2018; Beleza-Meireles et al. 2015; Rooryck et al. 2010) including 5pter deletion (Ala-mello et al. 2008), 22q11.2 deletion (Beleza-Meireles et al. 2015; Dos Santos et al. 2014; Silva et al. 2015; Xu, Fan, and Siu 2008), 4p16.1 duplication (Barber 2018; Bragagnolo et al. 2018) or 14q21.3-q24.3 duplication (Ou et al. 2008; Zielinski et al. 2014). To date, only one recurrent causative gene,
117
MYT1, has been reported (Berenguer et al. 2017; Lopez et al. 2016). However, only five patients
present variants associated with OAVS features supporting the hypothesis of a strong genetic heterogeneity in OAVS (Berenguer et al. 2017; Lopez et al. 2016; Luquetti et al. 2020). Recently, one de novo loss of function variant in AMIGO2 gene and one in ZYG11B gene were found associated with OAVS (Rengasamy Venugopalan et al. 2019; Tingaud-Sequeira et al. 2020). Moreover, an in-frame-duplication variant, c.159_161dup p.(Ala55dup), in ZIC3 gene was associated with OAVS features in a familial case. This variant expands from 10 to 11 alanines in apolyalanine tract (Trimouille et al. 2020). In addition, polyalanine tract expansions leading to 12 alanines in ZIC3 gene were associated with OAVS features and VACTERL (Trimouille et al. 2020; Wessels et al. 2010).
In the context of this complex disease, incomplete penetrance and variable expressivity is observed in a significant number of cases. MYT1 variants associated with OAVS features were showed to be inherited in 3 cases (Lopez et al. 2016; Luquetti et al. 2020). Genetic etiology of OAVS should then take in account this parameter. In this way, we were able to highlight a recurrent variant in EYA3 (Eyes Absent 3) gene in two independent families.
Material and methods
Whole-Exome sequencing and variant identification
Informed written consent for genetic studies was obtained prior to collecting blood samples for DNA extraction. The local ethics committee (Comité de Protection des Personnes: DC2012/76) approved this study. All methods were performed in accordance with the relevant guidelines and regulations. Array-CGH was initially performed to discard potential pathogenic CNV.
118 Then, library preparation, exome capture, sequencing and data analysis were performed by IntegraGen SA (Evry, France), using SureSelect Human All Exon kit V2 in-solution enrichment methodology (Agilent, Santa Clara, California), followed by paired-end 75 bases massively parallel sequencing on Illumina HiSeq2000 (Illumina, San Diego, California). Variants were filtered using Eris software (IntegraGen), with a minimal read depth of 10X. Only rare variants (allele frequency <0,1% in public databases GnomAD, Exac and EVS), with a potential effect on proteins (non-synonym, and synonym or intronic variants within 5 bp of a splice site). ). DNA samples of patients 1.III.4 and 1.III.6 were then processed for exome data filtering based on autosomal dominant segregation. All rare heterozygous variants were then selected.
Cohort screening for EYA3 mutations (EYA3 NM_001282561/ NP_001269490.1)
We performed screening for other nucleotide variants of EYA3 in 122 OAVS patients. Next-generation sequencing of EYA3 was performed using the Ion Torrent technology on Personal Genome Machine (PGM) (Life Technologies, ThermoFisher Scientific) with the AmpliSeq method. Samples were quantified using the Qubit™ dsDNA HS Assay Kit on the Qubit® 2.0 Fluorometer (Life Technologies). Amplicons (libraries) were generated with Ion AmpliSeq™ technology and then qualified and quantified on the 2200 TapeStation (Agilent). EmPCR and enrichment were performed on the Ion CHEF System (Life Technologies) using the Ion PGM™ Hi-Q™ Chef Kit. Sequencing on PGM system was performed on 316 v2 chip. After sequencing, base calling, alignment and variant calling were performed with Torrent Suite 4.4.2 software (Life Technologies).
119 EYA3 NM_001282561 cDNA and H2AFX NM_002105.3 cDNAs were amplified by RT-PCR using tRNA extracted from HeLa cells. Briefly, total RNA were extracted from HeLa cells using the RNeasy Microkit (Qiagen). Quality and quantity were assessed on agarose gel and on a Nanodrop, respectively. One microgram was then reverse-transcribed using M-MuLVRT enzyme (Analitica-Advanced Biomedecine) following the manufacturer’s instructions. cDNAs were PCR amplified using AmpliTaq Gold™ DNA Polymerase (Thermofisher Scientific) following the manufacturer’s instructions. For EYA3, the following primer pair was used:
forward, 5’-TCCTGTTGTGGGGCTTTTAC-3’ and reverse
5’-AAAAGGAGCTCAAGGGGAAG-3’. A c-myc tag was then inserted by PCR using the following primer pair: primer pair: forward, 5’-TCCTGTTGTGGGGCTTTTAC-3’ and reverse
5’- TTACAGGTCTTCTTCAGAGATCAGTTTCTGTTCGAGAAAATCAAGCTC -3’.
Resulting Amplicon was first cloned in pGEMT-easy vector following manufacturer’s instructions (Promega, France). Sequence was assessed by Sanger sequencing. Sub-cloning in pCS2+ expression vector was performed using In-Fusion® HD Cloning kit following manufacturer’s instructions (Takara Bio, USA). This wild-type cloned was named EYA3-WT. Site-directed mutagenesis to introduce c.937A>G, p.(Asn312Ser) was performed by using QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions and using the following primer pairs: forward 5’-
CATCTATTTTTCAGTGACTTAGAGGAGTGTGACCAGGTAC-3’ and reverse
5’-GTAGATAAAAAGTCACTGAATCTCCTCACACTGGTCCATG-3’. This mutated clone was named EYA3-N312S. All constructs were assessed by Sanger sequencing. For H2AFX, the
following primer pair was used: forward, 5’-
120 GAGAGGCCTTGAATTGCTCAGCTCTTTCCATGAGG-3’. These primers include a tail for direct cloning in pCS2+ using In-Fusion® HD Cloning kit following manufacturer’s instructions (Takara Bio, USA).
Cell culture, treatment and transient transfections
RA treatment. HeLa cells were seeded at 100 000 cells/well in 6-well plates. After 24 hours,
cells were treated for 48 hours with All-Trans Retinoic Acid (Sigma Aldrich) dissolved in Dimethyl Sulfoxide (DMSO) at 0.1mM for final dilution in cell medium 1/1000 corresponding to a final concentration of 0.1 µM, respectively.
Transient transfections. HeLa cells were seeded at 100 000 cells/well in 6-well plates for
western blot analysis and cell proliferation assay or 7500cells/well in 8 chamber-slides for subsequent immunocytochemistry analysis. Cells were transfected using FuGENE HD Transfection reagent following manufacturer’s instructions (Promega, France). Cells were transfected for 48 hours with 3µg of total DNA. For co-transfection experiments, the total amount was divided by the number of plasmids.
Phosphorylation study of amino acid H2AFX at Tyr-142, cells were co-transfected with EYA3 and H2AFX including plasmids for 48 h. Then, cells were treated with cisplatin 5µg/mL for 2 hours, rinsed and incubated for 24 hours. Cells were then lysed and processed for western blot analysis. For cyclyhexamide treatment, cells were transfected with EYA3-WT or EYA3-N312S plasmids for 48 h and then treated with cycloheximide 50µg/mL for 0, 6 and 24 hours.
SiRNA transfections. HeLa cells were seeded at 100 000 cells/well in 6-well plates for cell
121 control nonspecific siRNA (EHUEGFP, Sigma) or with specific siRNA targeting EYA3 (EHU134641, Sigma) using DharmaFECT™ Transfection Reagent following manufacturer’s instructions (Dharmacon Horizon Discovery).
Western Blot. Total proteins from HeLa cells transfected for 48 hours with pCS2+ empty or
EYA3-WT, or EYA3-N312S were extracted with RIPA lysis buffer and analyzed by standard western blot protocol. Primary antibodies used were rabbit polyclonal anti-EYA3 (1:600, ab95876, Abcam), mouse monoclonal anti-Myc Tag, clone 4A6 (1:600, 05-724, Millipore), rabbit polyclonal anti-phospho Histone H2A.X (Tyr142) (1:300, 07-1590, Millipore), rabbit polyclonal anti-H2Ax (1:500, PLA0023, Sigma), rabbit polyclonal anti-turboGFP (1:500, AB513, Evrogen), rabbit polyclonal anti-ASF1B (1:500, SAB4502347, Sigma), mouse monoclonal anti- α Tubulin (1:1000, sc-8035, Santa Cruz), mouse monoclonal anti-GAPDH (1:1000, Sc25778, Abcam) and mouse monoclonal anti-ACTB (1:3000, A1958 Sigma). Corresponding fluorescent secondary antibodies were purchased from LI-COR and diluted 1/5000. Immunoblots were visualized with the Odyssey infrared imaging system (LI-COR Biosciences, Nebraska, USA).
Immunocytochemistry. HeLa cells transfected for 48 hours with pCS2+ empty or EYA3-WT or
EYA3-N312S were fixed in 4% PFA in PBS for 10 min at room temperature. Cells were then rinsed and permeabilized with Triton X100 at 0.15% in PBS for 15 min. Blocking step was performed with BSA 10% in PBS. The primary antibodies listed above were diluted 1/300 in blocking solution and incubated with cells for 1 h at room temperature. Cells were rinsed 3 times. Fluorescent secondary antibodies, diluted 1/500 in blocking solution, were incubated for 1hour at room temperature. Nuclei were stained with DAPI.
122
Proteomic analysis.
nLC-MS/MS analysis
Fourty µl of samples in Laemmli buffer were deposited onto SDS-PAGE gel for concentration and cleaning purpose. After colloidal blue staining, bands were cut out from the SDS-PAGE gel and treated overnight with trypsin as described elsewhere (Berenguer et al. 2018). Peptide digests were resuspended in 40 µL of water 0.1% HCOOH and peptide mixture were analyzed on a Ultimate 3000 nanoLC system (Dionex, Amsterdam, The Netherlands) coupled to a Electrospray Q-Exactive quadrupole Orbitrap benchtop mass spectrometer (Thermo Fisher Scientific, San Jose, CA).
Database search and Label-Free Quantitative Data Analysis
Data were searched by SEQUEST through Proteome Discoverer 1.4 (Thermo Fisher Scientific Inc.) against a subset of the 2017.10 version of UniProt database restricted to Homo sapiens Reference Proteome Set (71294 entries). The search parameters were as follows: mass accuracy of the monoisotopic peptide precursor and peptide fragments was set to 10 ppm and 0.02 Da respectively. Only b- and y-ions were considered for mass calculation. Oxidation of methionines (+16 Da) was considered as variable modification and carbamidomethylation of cysteines (+57 Da) as fixed modification. Two missed trypsin cleavages were allowed. Peptide validation was performed using Percolator algorithm (Käll et al. 2007) and only “high confidence” peptides were retained corresponding to a 1% False Positive Rate at peptide level. Raw LC-MS/MS data were imported in Progenesis QI for Proteomics 2.0 (Nonlinear Dynamics Ltd, Newcastle, U.K). Features abundancies were normalization based on ratio median between
123 the run of interest and a run chosen as reference. Protein abundancies were calculated as the sum of the abundancies of corresponding peptides. A T-test was calculated for each group comparison and proteins were filtered based on p-value<0.05. Noticeably, only non-conflicting features and unique peptides were considered for calculation at protein level. Quantitative data were considered for proteins quantified by a minimum of 2 peptides.
RT-qPCR
RT-qPCR was performed by using the iQTM SYBR Green Supermix and Icycler CFX96 real time-PCR detection system (Bio-Rad, France). Quantitative expression of ZYG11B and GUSB (used as reference gene) was determined from cell culture experiments. The relative transcript level was calculated as fold change using the 2-ΔΔCt method. Reference gene was GUSB with the following primer pair: GGAGAGCTCATTTGGAATTTTGCCG-3’ and TGGCTACTGAGTGGGGATACCTGG-3’. For EYA3 the following primer pair was used: 5’-CGATTACATCCCTCGCTCAT-3’ and 5’-ATACGTTTGGGTTGCCTGAG-5’.
Zebrafish eya3 knockdown
Morpholino oligonucleotides (MOs) was designed by and obtained from Gene Tools, LLC. It was designed as complementary to the sequence flanking the translation initiation codon of
eya3 (5′-TGATTCGTCCATGCCGTTGAGA-3′), brackets indicate the initiation codon
complementary sequence). The standard control MO from Gene Tools, LLC (5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used as negative control. MOs were injected at the 1-4 cells stage at 2 ng/embryo. Embryos were then incubated at 28.5 °C until 5 dpf for Alcian blue/Alizarin red staining according to Walker and Kimmel (https://wiki.zfin.org).
124 Rescue experiments were performed with cRNA synthetized from EYA3-WT plasmid with the using the mMESSAGE mMACHINE® SP6 Transcription Kit (Ambion). Four independent experiments were performed.
Results
Clinical description of OAVS patients and identification of EYA3 variant, c.937A>G, p.(Asn312Ser)
Family 1 was ascertained through Whole Exome Sequencing (WES) approach including two affected brothers, patients 1.III.4 and 1.III.6, born to healthy unrelated parents (family 1, Figure 1a). Family 1 is from New Zealand Patient 1.III.4 presented with hemifacial microsomia, bilateral small dysplastic ears, cleft palate, pectus carinatum and psychomotor delay. Patient
1.III.6 presented with asymmetric bilateral ear anomalies (including
anotia/microtia/preauricular tags), cleft palate, pectus carinatum and tracheomalacia (full clinical features in table 1). For genetic studies, written informed consents were obtained prior to collecting blood samples for DNA extraction. The local ethics committee approved this study (Comité de Protection des Personnes: DC2012/76). WES identified a heterozygous missense variant in EYA3, 1:g.28326481T>C (c.937A>G, p.(Asn312Ser), NM_001282561) reported as dbSNP (rs148584287). The reported allele frequency of the variant in GnomAD database is 0.00007204 (20/277606) and no homozygotes are reported. This variant is predicted to be pathogenic by Polyphen2, SIFT and CADD softwares (CADD v1.4 Phred: 26.5). Of note, the
EYA3 gene presents constraint metrics in favor of its intolerance to loss-of-function variant
(ratio of the observed / expected (oe) number of loss-of-function variants is 0.12 and its pLI is 1). Segregation assessment showed that patients 1.II.2 (mother) and 1.III.1 (oldest brother) are
125 healthy carriers. However, both members 1.I.3 and 1.IV.1 (unavailable) were reported as having sinus pits, a minor feature of OAVS reported in 6% and 2% of previously described OAVS cohorts (Berenguer et al. 2018; Lopez et al. 2016). Considering this feature to be a mild hallmark of OAVS, incomplete penetrance and variable expressivity might therefore be considered in this family.
Screening of EYA3 in 122 additional OAVS patients identified a second patient carrying the same missense variant (Figure 1b). This female patient, 2.III.2 presented with bilateral ear anomalies (preauricular tags, ear dysplasia, sinus pits), ocular anomalies (epibulbar dermoid and glaucoma) and thoracic hemi-vertebra (T11, T12). In addition, she presented with micro-retrognathism and glossoptosis. Hemifacial microsomia was described clinically. Of note, her mother reported repetitive exposure to horticulture drugs during pregnancy. The variant was inherited from the healthy father whose maternal uncle had preauricular tags, a clinical feature retrieved in 40% to 60% of OAVS patients (Berenguer et al. 2018; Lopez et al. 2016). The patient died from the consequences of her glossoptosis. Family 2 is from France. The frequency of the variant is then 2/123 in the OAVS cohort corresponding to 1.16% while it is 0.007204% in the GnomAD database. The Fisher exact test confirms the significant difference between frequencies at p < 0.01.
The asparagine residue involved is highly conserved in the human EYA proteins family and belongs to a highly conserved domain corresponding to almost the half of the total proteins at the C-terminal end. The highly conserved domain carries the enzymatic active site for tyrosine phosphatase activity. Moreover, this domain shows high evolutionary conservation including
126 the residue modified by the identified variant (Figure 1c). Of note, modelling of the protein carrying the variant did not show any structural impact (data not shown).
Variant p.(Asn312Ser) alters EYA3 stability with low impact on H2AFX phophorylation
HeLa cells were transfected with C-myc-tagged-EYA3 expression plasmids (named for the study EYA3-WT and EYA3-N312S). EYA3-WT and EYA3-N312S were both strongly detected within the nucleus with the same pattern (Figure S1). However, western blot systematically revealed a stronger signal for the mutated form which was confirmed by quantification data by normalization to GFP expression from co-transfected GFP-plasmid (Figure 2a). This result was confirmed by half-life studies of the two forms. Inhibiting protein synthesis by cycloheximide treatment revealed that EYA3-WT was completely degraded after 24 hours of treatment whereas EYA3-N312S was still detectable (Figure 2b). Looking at a possible effect on tyrosine phosphatase activity, enzymatic activity of the two forms was compared by focusing on H2AFX which can be dephosphorylated at tyrosine 142 by EYA3 (Krishnan et al. 2009; Singh et al. 2012). The ratio of the phosphorylated form (H2FX-Y142-P) and the whole H2AFX forms was measured after DNA repair pathway induction by cisplatin treatment (Noguchi et al. 2018). As expected, overexpression of EYA3-WT induced a significant decrease in H2AFX-Y142-P content meaning that an over-dephosphorylation happened compared to the control group. However, overexpression of EYA3-N312S did not induce a drastic distinct effect. Indeed, a non-significant weak decrease is observed versus the control group however not significantly higher than EYA3-WT. This result suggests a low impact on tyrosine phosphatase activity on H2AFX.
127 Non-genetic causes have been hypothesized for OAVS, including exposure to toxic substances during pregnancy such as retinoic acid (RA). Indeed, RA embryopathies present features overlapping with OAVS phenotypes (Glineur et al. 1999; Mondal, Shenoy, and Mishra 2017). Next, we then investigated the effect of RA on EYA3 expression as it is a known toxic molecule involved in non-genetic causes of OAVS. Moreover, the potential toxic exposure reported in family 2 during pregnancy was intriguing. In this way, EYA3 expression was assessed by quantitative RT-PCR in HeLa cells, after RA treatment for 48 hours. We found a significant decreased expression of ≈80% of EYA3, with 100nM RA versus DMSO treated cells (Figure 2d).
Transient knock-down of eya3 specifically alters craniofacial development in zebrafish
We evaluated the effects of eya3 knockdown during zebrafish embryogenesis. Early embryonic expression of eya3 was previously demonstrated (Söker et al. 2008) and we could then design an antisense morpholino directed against the translation start site of the transcript (MO-eya3-ATG). After dose-response experiments to discard nonspecific cytotoxicity, we determined that microinjection of 2.5 ng/embryo at 1-4 cell stage give rise to specific phenotypical features. Early in the development at 48hpf stage, microphthalmia/anophthalmia was observed in 80% of embryos and among them the strongest altered embryos also presented a curved tail phenotype corresponding to 50% of total embryos. We could then define 3 phenotypes: phenotype 0 for normal gross morphology, phenotype 1 for microphthalmia / anophthalmia without additional features, and phenotype 2 for microphthalmia / anophthalmia associated with curved-tail (Figure 2e,f). We then followed the development of these embryos until 5 dpf for