kinases during cell swelling : novel insights 4.1 Résumé de l’article
Régulation du cotransport K+-Cl- par les « WNK lysine deficient protein kinases » lors de
l’augmentation du volume cellulaire: nouvelles perspectives
Il est maintenant bien connu que les cotransporteurs K+-Cl- (KCC) sont activés par l’augmentation du volume cellulaire (Vi) et du Cl- intracellulaire (Cl-i), mais les intermédiaires signalétiques impliqués demeurent peu définis. Selon des travaux récents, la « WNK lysine deficient protein kinase 4 » (WNK4) pourrait remplir un tel rôle puisqu’elle régule plusieurs systèmes de transport, dont les KCC. Dans cette étude, nous avons utilisé une stratégie structure-fonction et le système d’expression hétérologue des ovocytes du
Xenopus laevis pour déterminer par quels mécanismes WNK4 participe à la régulation de
KCC4. Nous avons trouvé que WNK4 et PP1 font toutes deux partie d’une voie de signalisation commune qui agit sur le transporteur en réponse à une augmentation du volume cellulaire, que l’action de PP1 serait en amont de celle de WNK4 et que deux résidus dans la partie C-terminale de KCC4 seraient ciblés plus spécifiquement par cette voie de signalisation commune.
4.2 Title Page
Regulation of the K+-Cl- cotransport by WNK lysine deficient protein
kinases during cell swelling : novel insights
Rachelle Frenette-Cotton, Luc Caron, and Paul Isenring
Nephrology Research Group, Department of Medicine, Faculty of Medicine, Laval University, Québec (QC), Canada G1R 2J6
Address correspondence to: Paul Isenring, M.D., F.R.C.P.(C.), Ph.D.
CHUQ-L’Hôtel-Dieu de Québec Research Center 10 Rue McMahon (Room 3852)
Québec (QC), Canada G1R2J6 Tel.: (418) 691-5151 (15477)
FAX: (418) 692-5795
4.3 Abstract
The K+-Cl- cotransporters (KCCs) are integral membrane proteins that belong to the cation- Cl- cotransporter family. They have been found to exist as four isoforms and many splice variants. Their main role is to facilitate the electroneutral efflux of K+ and Cl- across the surface of many cell types, and in doing so, they regulate intracellular ion concentration, cell volume and transepithelial salt movement. They are also known to be activated by an increase in cell volume and intracellular Cl- concentration (Cli-), but the molecular mechanisms involved in this response are still ill-defined. The lysine deficient protein kinase type 4 (WNK4) could play an important role in this regard, especially in the case of KCC4, given that it exerts an inhibitory effect on K+-Cl- cotransport and that it is coexpressed with this isoform of the KCCs in many cell types. In this study, we have used the Xenopus laevis expression system to gain new insight regarding the molecular mechanisms of KCC4 regulation by WNK4. We have found that both WNK4 and PP1 are members of a common signaling module that acts upon KCC4 to regulate carrier activity during a change in cell volume, but that PP1 operates downstream rather than upstream of WNK4 within this module. We have also found that WNK4 and PP1 act on KCC4 through intermediate steps, rather than directly, and that they do so at cotransporter sites within the C-terminus. Based, however, on in vitro phospholabelling studies of full-length KCC4, it was not possible to demonstrate that these sites were phosphorylated during cell swelling. Our data are thus partially in consistent with previously proposed models in which PP1 acts upon WNK4 to inhibit KCC4 activity by dephosphorylation of the carrier.
4.4 Introduction
The K+-Cl- cotransporters (KCCs) are integral membrane proteins that are expressed at the surface of most animal cells where they bring about electroneutral K+-coupled Cl- movement [1]. They belong to the cation-Cl- cotransporter (CCC) family in which they constitute a distinct phylogenetic branch next to another branch comprised of Na+-coupled Cl- cotransporter, that is, of the Na+-K+-Cl- cotransporters (NKCCs) and the Na+-Cl- cotransporter [2-4]. They have been found to exist as four isoforms (called KCC1, KCC2, KCC3 and KCC4), to exhibit wide, but differential tissues distributions, and to be
expressed in non-polarized cell types as well as in the basolateral membrane of many epithelia [5-8].
All of the KCC isoforms exhibit the same structure, including highly conserved central cores of successive α-helices and cytoplasmically disposed extremities [5-8] (see Fig. 4-1A). They appear to be organized mainly as homodimers in the plasmalemma although there is evidence to suggest that certain isoforms can associate with each other to form heterodimers in vivo [9-11]. Studies have revealed that the central core is responsible for ion movement across the membrane and that the C-terminus (Ct) is responsible for regulating carrier activity and assembling the KCCs in high-order structures [12-15].
KCC-facilitated ion movement is outwardly directed in most cell types [1]. It is typically induced through cell swelling as well as increased intracellular Cl- concentration (Cl-i) [16-18]. For these reasons, members of the KCC family are involved in regulatory volume decrease (RVD) responses [19, 20], Cl-
i maintenance and solute reabsorption across various epithelia [21, 22]. Interestingly, KCC4 is also induced through decreased intracellular pH (pHi) and can operate as a NH4+-Cl- cotransporter, suggesting that it is involved in acid-base balance regulation as well [20, 23]. In this regard, interestingly, a KCC4-/- mouse model has been found to exhibit distal renal tubular acidosis among other phenotypic abnormalities [19].
The mechanisms by which K+-Cl- cotransport is regulated remain ill-defined. A general model has emerged in which swelling-induced K+-Cl- efflux is mediated primarily through carrier dephosphorylation. The regulatory intermediates potentially implicated have been found to include various protein phosphatases (PP), especially PP1 [24, 25], tyrosine kinases, such as c-Src [26], and PKCs [27]. Importantly, however, their involvement has been inferred mainly from indirect evidence and from studies in red blood cells where three out of the four KCC isoforms are expressed (KCC1, KCC3 and KCC4). We have recently shown for the first time that KCC4 was a phosphorylatable substrate, but that the main stimulus associated with changes in carrier phosphorylation was a change in Cl-i, while phorbol myristate acetate, calyculin A and cell swelling produced little if no effect except on carrier activity [28]. Another group has recently shown that KCC3 was
also a phosphorylated substrate, identifying two residues (T991 and T1048) that are potentially involved in swelling-induced carrier dephosphorylation [29].
During the last years, the WNK lysine deficient protein kinases (WNKs) have generated much enthusiasm in the transport field given that they have been linked to a hereditary form of arterial hypertension called familial hypertension with hyperkalemia and acidosis (FHHt) and that they have been shown to regulate the activity of many ion transport systems, including CCC family members [30-34]. In particular, all of the WNK isoforms, including WNK1, WNK2, WNK3 and WNK4, have been found to inhibit K+-Cl- cotransport [35], but the manner in which they exert their effects are largely unknown. In the case of KCC4, these WNK-dependent effects do not appear to involve SPAK and OSR1 based on certain observations [36].
In the current work, we have used the Xenopus laevis oocyte expression system to identify mechanisms by which WNK4 regulates KCC4, expecting that such mechanisms would be physiologically relevant for several reasons. In particular, both proteins are coexpressed in the same cell types along the distal nephron [37-39], WNK4 is one of the isoforms that has been linked to FHHt [40], it contains PP1-interacting KXVTF motifs [41] and its expression rises under high K+ diets [38], and KCC4, as mentioned earlier, is involved in acid-base balance regulation.
Based on the approach exploited, we have found that regulation of KCC4 by WNK4 requires probably the participation of PP1 and that it implicates two residues within the C- terminus of the cotransporter. However, we have also found that these residues do not seem to interact with this enzyme directly and that they do not play the role of phosphoacceptor sites either.
Kinase Positions on msKCC4 Residues on msKCC4 Consensus pattern References CK-2 40-43 TPGD [ST]-x(2)-[DE] Biochim. Biophys. Acta 1054:267- 284(1990) 62-65 SYFE 729-732 SVLE 734-737 TYLD 814-817 TVRD 942-945 SKNE PKC 108-110 SRR [ST]-x-[RK] J. Biol. Chem. 260:12492- 12499(1985) 807-809 SWK 814-816 TVR 965-967 TAR 1006-1008 SLK TK 1048-1054 RQGDENY [RK]-x(2)-[DE]-x(3)-Y or [RK]-x(3)-[DE]-x(2)-Y
Proc. Natl. Acad. Sci. U.S.A. 79:973-
977(1982)
Figure 4-1. Localisation of putative phosphorylation sites. A) Hydropathic plot models. The symbols represent amino acid residues. The model of msKCC4 was drawn using the program PLOT (Biff Forbush). B) Summary table. Prosite was used to search for consensus phosphorylation sites.
4.5 Experimental Procedures 4.5.1 Supplies
Chemicals, reagent or kits were purchased from several companies. They included: a mouse anti-HA monoclonal antibody and a mouse anti-c-Myc monoclonal antibody (Roche), a horseradish peroxidase-conjugated sheep anti-mouse anti-IgG and the ECL™ Western Blotting Detection Reagents (GE Healthcare), an impermeant biotin (EZ-link® sulfo-NHS-Biotin) and plasma grade H2O (Fisher), the T7 mMessage mMachine Kit and streptavidin-coupled magnetic beads (Dynabeads® MyOne™ Streptavidin T1) (Invitrogen), enzymes/buffers used for cDNA construction (New England Biolabs) as well as various salts, sucrose, ouabain, furosemide, bumetanide, okadaic acid, calyculine A, staurosporine, oligonucleotides, a mouse anti-FLAG monoclonal antibody (Sigma) and the Alexa Fluor 594-conjugated goat anti-mouse anti-IgG (Amersham). Vector and constructs were all amplified in XL1 blue cells (Agilent).
4.5.2 cDNAs
All constructs used in this study consisted of inserts cloned in the pGEM-HE or PolI vector [9, 15]. Both plasmids include (from 5’ to 3’): the T7 bacterial promoter, the
Xenopus laevis β-globin 5’ untranslated region (UTR), a multiple cloning site, the Xenopus laevis β-globin 3’ UTR, a polyA tract and two linearizing sites (NheI and ScaI) for in vitro
transcription of cDNA inserts.
A construct in which an HA-tagged mouse KCC4 (HA-KCC4) insert was already cloned in pGEM-HE from previous work [9] was used to generate three mutants called HA- KCC4(T926A), HA-KCC4(T980A) and HA-KCC4(T926A/T980A). Substitutions were introduced with the QuikChange® Site-Directed Mutagenesis Kit using relevant oligonucleotide primers (listed in Table 4-1). Another construct in which a c-myc-tagged mouse KCC4 (cMyc-KCC4) insert was already cloned in PolI from previous work [9] was also exploited in certain experiments. The c-Myc sequence included in this construct codes for the epitope tag MEQKLISEEDL.
Oligonucleotide sequences
msWNK4(wt/D138A) S gctctagaatgggactcgagctagcacc
AS gctctagactacaggtcttcttcagaaatcagc
FLAG tag epitope S tcgagaagcttatggactacaaagacgatgacgacaacc AS tcgaggttgtcgtcatcgtctttgtagtccataagcttc msKCC4(T926A) S cacctatgagaagGcgctaatgatggag AS ctccatcattagcgCcttctcataggtg msKCC4(T980A) S caaagtgcagatgGcatggacgaaag AS ctttcgtccatgCcatctgcactttg FLAG-msWNK4(KXVTF1) S caacagcaagatggCgGcgGCccgatttgatctgg AS ccagatcaaatcggGCcgCcGccatcttgctgttg FLAG-msWNK4(KXVTF2) S ggcaagcaagggggCAGcaGCcgccggggatattg AS caatatccccggcgGCtgCTGcccccttgcttgcc
Table 4-1. Mutagenic, FLAG epitope tag or PCR amplification primers used. They are all written 5’ to 3’. Capital letters in the oligonucleotide sequences designate nucleotides that were substituted. Abbreviations used are S = sense and AS = antisense.
Additional cDNA constructs used in this work included both wild-type and mutant mouse WNK4. Available c-myc-tagged mouse WNK4 (c-myc-WNK4) and c-myc- WNK4(D318A) inserts were cloned first into Pol1 at an XbaI site present in the multiple cloning site. Three other constructs were generated afterwards as follows: 1) by using a PCR approach to delete the c-myc epitope and add XbaI sites on each end of the WNK4 inserts, 2) introducing the cDNA fragment generated in PolI and 3) opening the resulting construct with XhoI to add the FLAG epitope tag MDYKDDDDN in front of the coding sequence (through a pair of complementary oligonucleotides designed to possess XhoI compatible ends once hybridized). From there, FLAG-WNK4 was used to create one other mutant called FLAG-WNK4(V697A-T698A-F699A-V1213A-T1214A-F1215A) (or FLAG- WNK(KXVTF1/KXVTF2)) in which the residues substituted include two KXVTF motifs that underlie the WNK4-PP1 interaction (see localization of these motifs in Fig. 4-2) [41]. Substitutions were introduced with the QuikChange® Site-Directed Mutagenesis Kit using relevant oligonucleotide primers (listed in Table 4-1).
Figure 4-2. Structure of WNK4. Important functional domains and motifs are shown in colors: kinase domain (yellow), autoinhibitory domain (red), coiled-coil domain (blue), proline-rich domain (dark green), RFXV motifs (pale green) and KXVTF motifs (purple). Additional domains or motifs are also shown including: an ATP-binding site, phosphoacceptor serine residues in the kinase domain, (S331 and S335) and two SGK1- dependent phosphoacceptor serine residues (S1169 and S1196). Abbreviations: SGK1 = serum and glucocorticoid-regulated kinase 1, NH2 = amine group, COOH = carboxylic acid group.
4.5.3 Expression in Xenopus laevis oocytes and general protocol
Heterologous expression of WNK4 and KCC4 was achieved as described previously by injecting mature, stage IV or V oocytes with cDNA-derived cARNs (~5 ng for WNK4, ~12.5 ng for KCC4) and maintaining cells for 2-3 days at 18 ºC in Barth medium added with 2 mM furosemide [9, 15, 28]. In all studies, oocytes injected with H2O alone were used as controls.
Following this first incubation step, oocytes were rinsed several times in Barth medium to remove furosemide and subjected to additional incubation steps (at ~22 ºC) as also described in previous publications [9, 15, 28]. Fig. 4-3 is used to illustrate the general protocol exploited in greater detail. Some of the media used were designed to produce differences in Cl-i and cellular volume (Cvol) between certain conditions. Once the incubation steps were ended, oocytes were subjected to various analyses as described further below.
Figure 4-3. Schematics of the general protocol used. Two or three days after cRNA or H2O injection, oocytes were subjected to a general protocol that consisted of sequential incubation steps of various duration (step 1 = 48-72 h, step 2 = 60 min and step 3 = 30-45 min) in different media (see Table 4-2). Concentration of furosemide used was 2 mM, staurosporine 2 µM, okadaic acid 10 nM, calyculin A 100 nM, H332HPO4 50 µCi/ml, sulfo NHS-biotin 2 mM and 100 mM glycine.
4.5.4 Rationale behind the use of certain solutions
In the general protocol exploited, oocytes were incubated during 1 hour to induce changes in Cl-i or Cvol before various measurements (see Fig. 4-2, step 2). The solutions used were called 5 ; 125, 5 ; 200 and 55 ; 200 to indicate their Cl- concentration (first number) and osmolality (second number) (see Table 4-2). Under such circumstances, the effect of a change in Cl-i on carrier activity, expression or distribution can be assessed by comparing data obtained between conditions 5 ; 200 and 55 ; 200, while the effect of a change in Cvol can be assessed by comparing data obtained among conditions 5 ; 125 and 5 ; 200. In these studies, the effect of cell swelling is determined at low external Cl- (Cl-
o) to minimize differences in Cl-
i (induced by changes in water concentration) between conditions. Note that the manoeuvres used in this work have already been shown to induce substantial changes in cell volume and Cl-
[ion] (mM) Na+ K+ Cl- Ca2+ Mg2+ PO
42- SO42- HEP GLUC SUC OsM
FR 88 7 89 2 2 1 1 10 0 0 200* 5 ; 125 55 4.4 5 1.3 1.3 0.6 0.6 6.3 50.6 0 125 5 ; 200 55 4.4 5 1.3 1.3 0.6 0.6 6.3 50.6 75 200 55 ; 200 55 4.4 55 1.3 1.3 0.6 0.6 6.3 0 75 200 Barth 96.9 1 86.3 0.7 0 0.8 0.8 10 0 0 200 W 21 74 89 2 2 1 1 10 0 0 200
Table 4-2. Composition of various solutions. Several types of media (set a pH 7.4) were used to incubate Xenopus laevis oocytes during the course of various protocols. The Barth medium also contains 2.4 mM HCO3 and 0.7 mM NO32-. The asterisk signifies that Rb+ was used instead of K+. Another media was used to lyse oocytes (20 mM Tris-Cl, pH 8.0, 1 mM EDTA, 4 mM MgCl2, 1% Triton X-100 and 1 mM PMSF). In this Table, HEP = HEPES, GLUC = gluconate, SUC = sucrose.
4.5.5 Influx studies in Xenopus laevis oocytes
HA-KCC4 activity was determined through influx studies under various conditions (see Table 4-2). At the end of step 3, transport assays were ended with several rinses in an ice-cold medium supplemented with 10 uM ouabain, 250 uM furosemide and 125 uM bumetanide after which each oocyte was transferred to a microfruge and solubilized in 70% nitric acid. The resulting oocyte-containing solution was subsequently dehydrated on a warming plate, the pellet formed was suspended in 1 mL H2O and the final mixture was assayed for 85Rb+ content through atomic absorption spectrophotometry using a Zeeman atomic spectrometer AA240Z equipped with the Zeeman graphite tube atomizer GTA120 and the Spectra software (Varian). Data were expressed as KCC4-specific fluxes (85Rb+ for KCC4-expressing oocytes in the absence of furosemide - 85Rb+ for KCC4-expressing oocytes in the presence of furosemide) or as background-subtracted fluxes (85Rb+ for KCC4-expressing oocytes in the absence of furosemide - 85Rb+ for H
2O-injected oocytes in the absence of furosemide).
4.5.6 Expression studies
Cell surface KCC4 expression levels were determined under the conditions that were used for the functional studies (see Table 4-2). During step 2, however, incubation media were added with 2 mM sulfo NHS-biotine and at the end of step 3, assays were ended with several rinses in an ice-cold regular medium added with 100 mM glycine after which several oocytes were transferred to a microfuge (n = 60 to 80/microfuge). From there, cells were lysed in 20 mM Tris pH 8.0, 1 mM EDTA, 4 mM MgCl2, 10% glycerin, 1% Triton-X and 1 mM phenylmethylsulfonyl fluoride supplemented with protease inhibitors, homogenates obtained were mixed with 50 µl Dynabeads® MyOne™ Streptavidin T1 and cell surface proteins were purified onto the beads through repeated wash cycles. Ultimately, bead-bound cell surface KCC4 was detected through chemiluminescence-based Western blot analyses and KCC4-specific signals were quantified by band densitometry.
4.5.7 Phosphorylation studies
KCC4 phosphorylation levels were also determined under the conditions that were used for the functional studies (see Table 4-2). Before step 2, however, oocytes were preloaded during 3 h in Barth medium supplemented with 50 µCi/ml H332PO4 and the end of step 2, they were lysed immediately in 20 mM Tris pH 8.0, 1 mM EDTA, 4 mM MgCl2, 10% glycerin, 1% Triton-X and 1 mM phenylmethylsulfonyl fluoride supplemented with protease inhibitors [28]. Homogenates generated from these steps were mixed with the anti- myc antibody and Dynabeads® MyOne™ protein G (50 µl) after which bead-bound KCC4 was purified through repeated washes and separated by SDS-polyacrylamide electrophoresis for autoradiographic analysis.
4.5.8 Immunofluorescence
Spatial localization of KCC4 was carried out as previously described by us [15, 42]. Briefly, 10 µm oocyte cryosections were postfixed in 4% paraformaldehyde for 30 min after which they were incubated sequentially with a primary monoclonal antibody (mouse anti-c-Myc 1/100) and the Alexa Fluor 594-conjugated goat anti-mouse anti-IgG (1/500)
for 1 hour each time. KCC4-specific signals were microphotographed subsequently under confocal microscopy (Olympus FV-1000).
4.5.9 Sequence Analyses and Statistics
DNA characterizations were performed by restriction analyses and automated sequencing using vector-, KCC4- and WNK4-specific primers. For DNA or protein sequence analyses, a combination of programs was used, including DNAstar (Lasergene) and online bioinformatics tools (Prosite and Lalign server). Data (fluxes, normalized data, band densities, etc.) are presented in this work as means ± S.E. from repeated experiments (n = 3-5). Differences between groups of datasets were analyzed by Student 2-tail-t-test and considered statistically significant at P < 0.05.
4.6 Results
4.6.1 Basal regulation of KCC4 by WNK4
To investigate how WNK4 regulates KCC4, we studied the effect of WNK4 expression on activity and cell surface expression of KCC4 under three different conditions. A mutant kinase-dead WNK4 called WNK4(D318A) [36, 43] was used to determine whether the enzyme led to changes in carrier function or expression through its kinase activity or through other mechanisms. Results are presented in figure 4-4.
In panel A, it is seen that cell swelling increases KCC4 activity by ~8-fold (compare bar 1 and 4) as expected based on previous studies [36], whereas changes in Cl-
i is seen to have little if no effect (compare bars 4 and 7). As expected, coexpression of WNK4 is seen to abrogate the effect of cell swelling almost completely (compare bar 1 and 2), while coexpression of WNK4(D318A) is seen to have no effect under such circumstances (compare bar 1 and 3). These results suggest that swelling induces KCC4-mediated K+-Cl- cotransport by decreasing the availability or activity of an endogenous WNK, i.e., of its catalytic domain more specifically. As for the effect of WNK4 under isotonic conditions, no changes in ion cotransport were observed regardless of Cl-i (compare bar 4, 5, 7 and 8).
In panel B, where cell surface expression of KCC4 was measured through band densitometry and in panel C, where carrier expression was analyzed by immunofluorescence, WNK4 is found to have no effects on KCC4 distribution or synthesis regardless of the conditions used. In view of the large difference that was observed in between bar 1 and 4 in panel A, these observations are consistent with the idea that KCC4 acquires an active state in response to swelling-induced WNK inhibition by undergoing a conformational change at the cell surface.
Figure 4-4. WNK4 inhibits the activity of KCC4 but not its expression. A) Oocytes expressing HA-KCC4, HA-KCC4 + FLAG-WNK4 or HA-KCC4 + FLAG-WNK4(D318A) were preincubated in medium 5 ; 125, 5 ; 200 or 55 ; 200 with or without 2 mM furosemide after which they were assayed for 85Rb+ influx measurements (alongside with H2O-injected controls) in regular medium 2 mM furosemide + 10 µM ouabain. Data correspond to background-subtracted furosemide-sensitive influx and are shown as averages ± S.E. among four to six experiments (three to five oocytes / experiments). The asterisk is used to indicate that the data are statistically different compared to HA-KCC4 alone (P < 0.05). B)
Oocytes expressing myc-KCC4, myc-KCC4 + FLAG-WNK4 or myc-KCC4 + FLAG-