[PDF] Top 20 Regulation of the mechanosensitive gene PtaZFP2
Has 10000 "Regulation of the mechanosensitive gene PtaZFP2" found on our website. Below are the top 20 most common "Regulation of the mechanosensitive gene PtaZFP2".
Regulation of the mechanosensitive gene PtaZFP2
... Regulation of the mechano-sensitive gene PtaZFP2 Gourcilleau ...variability of frequencies and ...syndrome of growth responses has been called ... Voir le document complet
2
Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter
... was of interest to examine the AOX protein levels of the wild-type strain culti- vated in the same growth ...against the AOX of ...than the monoclonal antibody ... Voir le document complet
13
Development and optimization of a new gene regulation system controlled by nutrition applicable for gene therapy
... Induction of the AARE-controlled expression of TRAIL in response to an EAA starvation leads to apoptosis in glioblastoma cell line (A) Gli36-Luc cells were infected with lentiviral vectors containing ... Voir le document complet
2
Global Gene Regulation in Metabolic Networks
... in the switching domain Depending on the directions of the vector elds f(x) and g(x), Filippov's con- struction may not allow for uniqueness of solutions in the switching ... Voir le document complet
19
Characterization and expression analysis under bending and other abiotic factors of PtaZFP2, a poplar gene encoding a Cys2/His2 zinc finger protein
... studying the common aspects of abiotic stress responses demonstrated that at an early point, nine genes were up-regulated during all stress responses in Arabidopsis (Kilian et ...described. The ... Voir le document complet
13
Amphioxus functional genomics and the origins of vertebrate gene regulation
... to the peer review of this ...and gene family ...coordinated the project. F.M., I.M., P.W.H.H. and M.I. wrote the main text, with input from all ... Voir le document complet
30
Inducibility by pathogen attack and developmental regulation of the rice Ltp1 gene
... Developmental regulation and tissue-specificity of the activity of the promoter of the Ltp1 gene in transgenic rice plants harbouring the p1176Gus ... Voir le document complet
18
Strain Mechanosensing Quantitatively Controls Diameter Growth and PtaZFP2 Gene Expression in Poplar
... presents the effect of a single controlled bending on the diameter growth of young poplars and on the expression of a mechanosensitive gene, ...PtaZFP2. ... Voir le document complet
10
Patrocles: a database of polymorphic miRNA-mediated gene regulation
... 5’ UACUGUCAUUGUAUUCAAAUCUCAACGUUCCAUUAUUUUAAUA 3’ :I: II II: II:IIIII 3’ GGUGUGUGAAGGAAUGUAAGGU miR -206 Clop, A., Marcq, F., Takeda, H., Pirottin, D., Tordoir, X., Bibé, B., Bouix, J., Caiment, F., Elsen, J.M., ... Voir le document complet
28
Chromosome-Biased Binding and Gene Regulation by the Caenorhabditis elegans DRM Complex
... and gene regulation are ...feature of the worm DRM complex as a whole, since the localization patterns of all but one DRM subunit are autosome-enriched, as are a class of ... Voir le document complet
17
Reconstruction of gene regulation networks from microarray data by Bayesian networks
... to the organization committee of ModGraph satellite day of JOBIM 2009 for permission to refer to this ...for the cooperation and the instruction of my tutors ...Professor ... Voir le document complet
5
Patrocles: a database of polymorphic miRNA-mediated gene regulation in vertebrates
... NoE), the Belgian Science Pol- icy organisation (SSTC Genefunc, BioMAGNet PAI), the Fonds National de la Recherche Scientifique (FNRS), the Communauté française de Belgique (Game, BIOMOD ARC) and ... Voir le document complet
1
Isolation, sequence, and regulation by oxygen of the yeast HEM13 gene coding for coproporphyrinogen oxidase
... cereuis- iae is subject to a negative control by oxygen and heme’ and this regulation operates at the pretranslational level: the enzyme activity, together with the stead[r] ... Voir le document complet
8
Gene regulation of the avian malaria parasite Plasmodium relictum, during the different stages within the mosquito vector
... copies of AP2 genes indicate that there are 342 several transcriptional factors that are associated and active at different time points, indicating the ... Voir le document complet
32
Preparing for Transmission: Gene Regulation in Plasmodium Sporozoites
... detection of transcripts and proteins depends on their concentration and on the sensitivity of the ...absence of its cognate protein because of translational repression or ... Voir le document complet
14
Monitoring the regulation of gene expression in a growing organ using a fluid mechanics formalism
... as the analysis of single roots have revealed a steep rela- tive elemental growth rate gradient between the meristem and the elongation zone, which is usually smoothed when pooling data from ... Voir le document complet
14
Patrocles: a database of polymorphic miR-mediated gene regulation in vertebrates
... machinery gene sequence SNPs (non-synonymous, stop/frameshift, splicing site) pDSPs altering machinery gene product concentration CNVs encompassing machinery genes (human, mouse, rat) eQTL ... Voir le document complet
25
Nuclear life of the voltage-gated Cacnb4 subunit and its role in gene transcription regulation.
... immunoprecipitation of the β 4 /B56δ/PP2A complex. Again the β 4 human mutation, by preventing the association with B56δ, also prevents the interaction with ...aspects of β 4 in ... Voir le document complet
16
TACAN is an essential component of the mechanosensitive ion channel responsible for pain sensing
... underlies the mechanosensitivity of ...through the expression of ...5A). The knockdown was validated using a neuroblastoma (N2A) cell line (Coste et ...reducing the expression ... Voir le document complet
20
Cross-regulation and interaction between eukaryotic gene regulatory processes
... 10 of the 20 annotated miRNA genes that we identified as candidates but did not confidently classify as miRNA genes because the predicted miRNA* species was not ...Four of seven genes without ... Voir le document complet
134
Sujets connexes