• Aucun résultat trouvé

Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript

N/A
N/A
Protected

Academic year: 2021

Partager "Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript"

Copied!
33
0
0

Texte intégral

(1)

HAL Id: hal-01608770

https://hal.archives-ouvertes.fr/hal-01608770

Submitted on 27 May 2020

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its

cluster and of the host transcript

Perrine Rasschaert, Thomas Figueroa, Ginette Dambrine, Denis Rasschaert, Sylvie Laurent

To cite this version:

Perrine Rasschaert, Thomas Figueroa, Ginette Dambrine, Denis Rasschaert, Sylvie Laurent. Alter- native splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript. RNA Biology, Taylor & Francis, 2016, 13 (12), pp.1310-1322.

�10.1080/15476286.2016.1244600�. �hal-01608770�

(2)

Version postprint

Research Paper

Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript

Perrine Rasschaert1, Thomas Figueroa1, Ginette Dambrine1, Denis Rasschaert1,* and Sylvie Laurent1,2

1 Equipe Transcription et Lymphome Viro-Induit (TLVI), UMR 7261 CNRS, Université François Rabelais, Parc de Grandmont, 37200, Tours, France

2 Département de Santé Animale, INRA, 37380, Nouzilly, France

Received : 06 May 2016

Revised : 28 August 2016

Accepted : 29 September 2016

* To whom correspondence should be addressed. Tel: +33 2 47 36 74 57; Fax: +33 2 47 36 74 50; E-mail:

[email protected]

KEYWORDS: cluster of microRNAs, mirtron, splicing, long non-coding RNA, Marek’s disease virus

ABBREVIATIONS: ESE, exonic splicing enhancer; ESS,exonic splicing silencer; GaHV-2, Gallid herpesvirus type 2; ISE, intronic splicing enhancer; ISS, intronic splicing silencer; LAT, latency- associated transcripts; lncRNA, long non-coding RNA; miRNA, microRNA; MCM7, mini chromosome maintenance 7; MDV, Marek’s disease virus; MPC, Microprocessor complex; mRNA, messenger RNA; ncRNA, non-coding RNA; pri-miRNA, primary microRNA; shRNA, small hairpin RNA; SO- miRNA, splice site overlapping microRNA; snoRNA, small nucleolar RNA; SS, splice site; vTR, viral telomerase RNA

ABSTRACT

Interplay between alternative splicing and the Microprocessor may have differential effects on the expression of intronic miRNAs organised into clusters. We used a viral model — the LAT long non-

(3)

Version postprint

coding RNA (LAT lncRNA) of Marek’s disease oncogenic herpesvirus (MDV-1), which has the mdv1- miR-M8-M6-M7-M10 cluster embedded in its first intron — to assess the impact of splicing modifications on the biogenesis of each of the miRNAs from the cluster. Drosha silencing and alternative splicing of an extended exon 2 of the LAT lncRNA from a newly identified 3’ splice site (SS) at the end of the second miRNA of the cluster showed that mdv1-miR-M6 was a 5’-tailed mirtron. We have thus identified the first 5’-tailed mirtron within a cluster of miRNAs for which alternative splicing is directly associated with differential expression of the other miRNAs of the cluster, with an increase in intronic mdv1-miR-M8 expression and a decrease in expression of the exonic mdv1-miR-M7, and indirectly associated with regulation of the host transcript. According to the alternative 3’SS used for the host intron splicing, the mdv1-miR-M6 is processed as a mirtron by the spliceosome, dispatching the other miRNAs of the cluster into intron and exon, or as a canonical miRNA by the Microprocessor complex. The viral mdv1-miR-M6 mirtron is the first mirtron described that can also follow the canonical pathway.

(4)

Version postprint

INTRODUCTION

MicroRNAs (miRNAs) are small non-coding RNAs of  22 nts in length that inhibit gene expression by degrading or inhibiting the translation of messenger RNAs (mRNAs). They have a stem-loop structure that is cropped by the Microprocessor complex (MPC), which consists of at least the Drosha ribonuclease III and its cofactor DGCR8. The miRNA hairpins may be located in the introns or exons of coding and non-coding genes, or in the intergenic region. 1 Most miRNAs (an estimated 62%) are found in intronic regions, 2 and about a quarter of them are grouped into clusters. 3 With a few notable exceptions, 4 clustered intronic miRNAs are processed from the same primary transcript (pri-miRNA), corresponding to the host transcript. 1

The pri-miRNA is processed cotranscriptionally by the spliceosome and the MPC, to generate the spliced RNA and miRNA, respectively. The interplay between the splicing machinery and the MPC remains unclear. Several studies have suggested that Drosha carries out intronic miRNA biogenesis before the splicing reaction of the host intron is completed, 2,5 and other studies have highlighted direct positive or negative interactions between the MPC and the spliceosome. 6 For instance, spliceosome assembly at the 5’ splice site (SS) of the sixth intron of melastatin has been shown to promote Drosha recruitment to the hsa-mir-211 hairpin and to facilitate the cropping of this intronic miRNA, resulting in the mutual promotion of intron splicing and miRNA production. 7 In addition, the position of miRNA hairpins on the pre-RNA, their distance from splice sites, and the relative efficiency of cropping have a direct effect on the fate of the pre-RNA. 6 In particular, the presence of overlapping miRNA hairpins at alternative splice sites (SO-miRNA) of the host transcript leads to exclusive processing of the miRNA or of the spliced transcript, 8 as for exonic miRNAs. 6 Alternative splicing mechanisms, controlled by enhancer and silencer splicing regulatory elements in introns and exons (ISE/ISS and ESE/ESS, respectively), can also have differential effects on the expression of intronic miRNAs encoded by the same cluster. For instance, a recent study showed that splicing from an alternative 3’SS in intron 13 of MCM7 (mini chromosome maintenance 7) leads to the inclusion of the last miRNA of the hsa-miR- 106b-25 intronic cluster in an alternative exon and modification of the expression of hsa-mir-25 relative to that of the other miRNAs of the cluster. 9 Finally, the splicing machinery is also directly involved in the biogenesis of a minor class of intronic miRNAs bypassing Drosha processing: the mirtrons. These non-canonical miRNAs were originally identified in Drosophila and nematodes, before their description

(5)

Version postprint

in vertebrates. 10 The main characteristic of mirtrons is that the 5′ and 3′ ends of their hairpins correspond exactly to the splice site junctions and are directly processed by the spliceosome. By definition, a mirtron sequence includes all the intronic elements necessary for its processing by the spliceosome: 5’SS, branchpoint, polypyrimidine tract and 3’SS. The mirtron class includes 5’- and 3’- tailed mirtrons, two splicing-dependent miRNA variants processed first by splicing from one of the two SS junctions of the intron and then by exonuclease digestion of the tail. 11,12

Many miRNAs encoded by DNA viruses have been identified over the last decade, mostly in the genomes of herpesviruses, 13 including Marek’s disease virus (MDV-1 or GaHV-2, for Gallid herpesvirus type 2), 14 MDV-1 is an avian oncogenic herpesvirus that causes a highly malignant T- lymphoma within two to three weeks of infection in experimental conditions. Following primary lytic replication in B cells, MDV-1 establishes a latent infection in activated CD4+ T cells, the primary target for oncogenic transformation. 15,16 Like all herpesviruses, MDV-1 persists in cells during the latent cycle, which is associated with lymphomagenesis in this model. The non-coding RNAs (ncRNAs) of MDV-1, such as small nucleolar RNA (snoRNA) (vTR: viral telomerase RNA), miRNAs and long non- coding RNAs (lncRNAs), play an important role in lymphomagenesis. 17,18 We have previously shown that the LAT gene (for latency-associated transcripts, 11 kbp) encodes unspliced and alternatively spliced lncRNAs, consisting of at least 3 to 15 exons, 19 and is driven by a p53-dependent promoter. 20 It is the most strongly expressed gene during the latency associated with lymphomagenesis. No precise function or target has yet been demonstrated for the 11 kb unspliced transcript or for any of the spliced transcripts of the LAT lncRNA. Nevertheless, the first intron of the LAT gene contains the mdv1-miR-M8-M10 miRNA cluster, and the splicing of this intron is determined by the use of various 3’SS in association with a single 5’SS that is used for all LAT lncRNA alternative transcripts. 14,19 The mdv1-miR-M8-M10 cluster consists of four pre-miRNAs: mdv1-mir-M8, mdv1-mir-M6, mdv1-mir-M7 and mdv1-mir-M10, in the 5’ to 3’ direction. We and others have reported the differential expression for the various miRNAs of the mdv1-miR-M8-M10 cluster, 14,21-23 even though all these miRNAs are derived from the same primary LAT lncRNA. 20 The mdv1-mir-M8 and -M6 miRNAs are two of the most strongly expressed miRNAs from MDV-1 infection, with the expression of mdv1-mir-M10 being an order of magnitude weaker. Conflicting results have been reported concerning the expression of mdv1-mir-M7. Indeed, depending on the quantitative analysis method used, it may be found to be the most strongly expressed miRNA of MDV-1 or weakly expressed, like mdv1-mir-M10. 23

(6)

Version postprint

We therefore investigated the impact of the alternative splicing of the LAT lncRNA on the differential expression of its intronic mdv1-miR-M8-M10 cluster. Using splicing mutagenesis in minigenes and an established inducible sh-Drosha cell lineage, we were able to identify mdv1-mir-M6 as the first 5’-tailed mirtron within a cluster for which alternative splicing had differential effects on the biogenesis of the other three miRNAs of the cluster, dispatching them into intronic and exonic structures, and on the fate of the LAT lncRNA host transcript. Finally, we propose a model for the differential expression of the mdv1-miR-M8-M10 cluster by Drosha following either alternative splicing of intron 1 of the LAT lncRNA or alternative splicing of the 5’-tailed mirtron mdv1-mir-M6, involving two-step processing of the cluster.

RESULTS

Identification of a new 3’SS in the mdv1-miR-M8-M10 intronic cluster defining a large alternative exon 2 of LAT lncRNA

In previous studies, we showed that the miRNAs of the mdv1-miR-M8-M10 cluster have different individual levels of expression, despite being derived from the same LAT pri-miRNA. 19,20,23 Here, we assessed the impact of LAT lncRNA splicing on the expression of miRNAs from the mdv1-miR-M8- M10 cluster embedded in its first intron, alternatively spliced in 3’. 19 We therefore investigated whether alternative splicing of LAT lncRNA is involved in the differential expression of mdv1-miR-M8- M10 cluster of miRNAs, by performing various RT-PCRs on LAT lncRNA extracted from MDV-1 naturally infected MSB-1 cells with a forward primer (A463) targeting exon 1 and with three reverse primers, A89, binding to exon 2, M449 and M621 binding to intron 1 upstream and inside of the mdv1- miR-M8-M10 cluster of miRNAs, respectively (Fig. 1A). The RT-PCR with the A463/A89 primers, used to detect transcripts extending from exon 1 to exon 2, produced two types of expected amplicons: an unspliced 1725 bp amplicon, not corresponding to genomic amplification according to the findings for the RT negative control (RT-) (Fig. 1B), and a set of spliced transcripts of about 230 bp in length, corresponding to intron 1 splicing from its single 5’SS joined to two different previously described alternative 3’SS bordering exons 2A and 2B (Fig.1C). 19 The A463/M449 RT-PCR, with M449 binding to intron 1 in 5’ of the cluster of miRNAs (Fig. 1A and 1C), produced a unique amplicon of 598 bp corresponding to the unspliced transcript (Fig. 1D). Strikingly, the A463/M621 RT-PCR, with M621 also binding to intron 1 but between mdv1-miR-M6 and -M7 sequences (Fig. 1A and 1C), produced a

(7)

Version postprint

first amplicon of 945 bp corresponding to the unspliced transcript and a second amplicon of 200 bp in length (Fig. 1E). Sequencing of the 200 bp amplicon identified an effective alternative consensus 3’SS (CAG) at the end of the mdv1-mir-M6 sequence, allowing the binding of exon 1 to a new potential alternative exon 2, which we called “exonmiR” (Fig. 1C). Finally, the characterization of “exonmiR” as a newly large alternative exon 2 was confirmed by sequencing analysis of the 869 bp amplicon obtained from the RT-PCR A463/B139 (Fig. 1C), with B139 primer spanning the 3’ splice junction of intron 1 and exon 2A (Fig. 1A and 1C). Overall, the detection of this new alternative 3’SS at the end of mdv1-miR-M6-3P highlights an interesting splicing event within the mdv1-miR-M8-M10 cluster of miRNAs because it resulted in the miRNAs of the cluster being dispatched into intronic and exonic structures for mdv1-miR-M8-M6 and mdv1-miR-M7-M10, respectively.

Inhibition of the splicing of intron 1 affects only mdv1-miR-M6 biogenesis

We then investigated the role of the alternative splicing of the LAT lncRNA in intronic miRNA biogenesis and, more specifically, the involvement of exonmiR alternative splicing in the differential expression of the four miRNAs of mdv1-miR-M8-M10 cluster, using miniLAT-WT (pBS691 minigene), consisting of part of the LAT gene sequence, from the promoter to the fourth exon, which we had previously shown to yield the efficient production of miRNAs from the cluster. 20 We first ensured that miniLAT-WT splicing yielded products consistent with the LAT lncRNA transcripts naturally produced in MSB-1 cells. We transfected DT-40 cells, not infected with MDV, with miniLAT-WT and carried out RT-PCR, targeting the sequence extending from exon 1 to exon 2 with the A463/A89 primers (Fig. 2A and 2B). All three amplicons obtained of 1725, 230 and 1100 bp were cloned, sequenced and shown to correspond to unspliced, spliced exon 1-exons 2A/B transcripts and to a non-specific amplification of DT-40 cells transcripts, respectively. By performing RT-PCR with the A463/M621 primers, we also confirmed the existence of spliced exon 1-exonmiR transcripts of 200 bp in length with miniLAT-WT (Fig. 2C). Thus, the miniLAT-WT efficiently produced both the unspliced and the alternatively spliced transcripts described for the natural LAT lncRNA (Fig. 1C). 19 Building on these results, we investigated the impact of splicing inhibition on miRNA biogenesis, by mutating the single and necessary 5’SS in miniLAT-WT to generate miniLAT-5’SSm (Fig. 2A), which we used to transfect DT- 40 cells. RT-PCR for exon 1-exon 2 amplification revealed that spliced transcripts were produced despite the mutation of the constitutive 5’SS (Fig. 2B), from a cryptic consensus 5’SS (GU) located 22

(8)

Version postprint

cryptic 5’SS in the miniLAT-5’SSm to obtain the double-mutant miniLAT-5’SSmm (Fig. 2A). RT-PCR targeting exon 1/exon 2 or exonmiR on RNA extracted from miniLAT-5’SSmm-transfected DT-40 cells led to the specific amplification of only unspliced transcripts of 1725 bp and 945 bp, respectively (Fig.

2B and 2C), not corresponding to genomic amplification as support by RT negative control (Fig. 2B).

The sequencing of these products confirmed that splicing was completely abolished by the mutation of both the consensus and cryptic 5’SS of intron 1. Before assessing the effects of the inhibition of splicing on intronic mdv1-miR-M8-M10 cluster biogenesis by RT-qPCRs, we first checked that the expression of the miniLAT-WT and the miniLAT-5’SSmm in DT-40 cells was equivalent by performing semi-quantitative RT-PCRs with primers targeting exon 1 (A463/A464), shared by all the LAT transcripts, and with primers targeting GAPDH mRNA. As an equivalent expression for both the miniLATs construct was observed (1/1.04) (Fig. 2D), we then performed specific RT-qPCRs on the guide strand of each miRNA of the cluster, corresponding to the 5P strand. 23 Interestingly, we observed that the blocking of splicing had different effects on the relative expression of the miRNAs of the cluster for the miniLAT-5’SSmm with respect to the miniLAT-WT (Fig. 2E). Indeed, mdv1-mir-M6 expression levels decreased considerably, by 70%, whereas the relative expression levels of mdv1- mir-M8, -M7 and -M10 were not significantly affected by the inhibition of splicing (Fig. 2E). It thus appears that intron 1 splicing reaction is necessary for the efficient expression of mdv1-mir-M6 but not for the three other miRNAs of the cluster. These data indicate that alternative splicing of LAT lncRNA is clearly involved in the differential expression of mdv1-miR-M8-M10 cluster of miRNAs.

Microprocessor inhibition does not alter mdv1-miR-M6 expression and enhances exonmiR spliced LAT lncRNA level

Pre-mdv1-mir-M6 sequence analysis revealed that, in addition to the 3’SS located at the 3’ end of mdv1-mir-M6 sequence, this miRNA had several characteristic sequences common to other mirtrons, including a predicted consensus branchpoint sequence in its loop and a polypyrimidine tract in mdv1- miR-M6-3P (Fig. 3A). 24 This observation associated with the particular decrease in expression of mdv1-miR-M6 following splicing inhibition with the miniLAT-5’SSmm (Fig. 2B, 2E and 2F) led us to hypothesize that mdv1-mir-M6 could be a 5’-tailed mirtron. We tested the mdv1-mirtron-M6 hypothesis, by establishing two inducible MSB-1 lineages with the T-Rex System (Invitrogen), in which a short hairpin RNA (shRNA) targeting Drosha is expressed exclusively under tetracycline induction.

We assessed Drosha inhibition after sh-Drosha induction, by performing RT-PCR targeting Drosha

(9)

Version postprint

and GAPDH mRNAs on both these lineages, with and without the addition of tetracycline. Relative expression levels for Drosha showed that sh-Drosha induction was correlated with a mean inhibition of Drosha mRNA production of 55% (Fig. 3B). A similar inhibition of 51% of Drosha protein production by Drosha silencing was also confirmed by western blotting (Fig. 3C). We then compared the production of the hypothetical mdv1-mirtron-M6 and of the three other miRNAs of the cluster with that of the canonical gga-mir-M21 and the mirtron gga-mir-6615, by RT-qPCRs on the small RNAs extracted from validated sh-Drosha induction assays. Following Drosha silencing, the mdv1-mir-M8, -M7 and - M10 displayed a significant decrease in expression, of almost 70%, 45% and 30%, respectively, in agreement with the mean decrease of 45% observed for the canonical control gga-mir-21 (Fig. 3D).

On the other hand, the mdv1-mir-M6 and the gga-mir-6615 mirtron control were not affected by Drosha silencing (Fig. 3D). This result confirms that, by contrast to the three other miRNAs of the cluster, the expression of mdv1-mir-M6 does not depend on Drosha processing. To further support this result, the miniLAT-WT (splicing +) and miniLAT-5’SSmm (splicing -) were transfected in Microprocessor null cells (Fig. 3E), MEF KO-DGCR8. 25 We performed RT-qPCR on small RNAs to detect the viral miRNAs mdv1-miR-M8, -M6, -M7, -M10 and the murine cellular miRNAs controls: the canonical miRNA mmu-miR-21 and the mirtron mmu-miR-3547. 26 As expected and unlike the mirtron mmu-miR-3547 control, the canonical viral mdv1-miR-M8, -M7 and the cellular mmu-miR-21 were not expressed in MEF KO-DGCR8 cells (Fig. 3E). The efficient expression of mdv1-miR-M6 in miniLAT- WT was drastically decreased in miniLAT-5’SSmm transfected MEF KO-DGCR8 cells (Fig. 3E). Finally, as mdv1-miR-M10 was expressed in the MEF KO-DGCR8 cells from both the miniLAT-WT and the miniLAT-5’SSmm (Fig. 3E), our data indicate that mdv1-mir-M6 and -M10 are expressed independently from DGCR8 and confirm that the expression of mdv1-mir-M6 as a 5’-tailed mirtron depends on splicing whereas that of mdv1-miR-M10 does not.

In addition and acknowledging the complex crosstalk between the spliceosome and the MPC, 5,6,27 we investigated whether the inhibition of mdv1-miR-M8-M10 cluster of miRNAs processing following Drosha silencing altered alternative splicing of the first intron of LAT lncRNA by performing RT-PCRs with A463/A89 on the large RNAs extracted from MSB-1-Sh(-) and -Sh(+) cells (Fig. 3F). Besides the two expected amplicons of 1725 and 230 bp corresponding to the unspliced and exons 2A/2B spliced LAT lncRNA, respectively (Fig. 3F), electrophoresis analysis of the MSB-1-Sh(+) RT-PCR showed a

(10)

Version postprint

third amplicon of 980 bp corresponding to exonmiR spliced LAT lncRNA, which represented 9% of the three forms detected (Fig. 3F).

Exonisation of mdv1-miR-M7 in exonmiR decreases, but does not prevent its expression

Focusing on the detection of exonmiR spliced LAT lncRNA following sh-Drosha induction (Fig. 3F), we hypothesized that the processing of exonic mdv1-mir-M7 and -M10 by Drosha was responsible for exonmiR spliced LAT lncRNA destruction, as already described for exonic miRNAs and their host transcript. 10 To assess this hypothesis, we designed the miniLAT-E1EM, lacking the intron 1 sequence from its constitutive 5’SS to the 3’SS defining exonmiR and thus mimicking exon 1-exonmiR spliced transcripts (Fig. 4A). The miniLAT-WT and the miniLAT-E1EM were, then, transfected in DT-40 cells and semi-quantitative RT-PCRs of their transcripts relative expression showed comparable transcription levels for both minigenes (1/1.11) (Fig. 4B). As expected, exon 1-exon 2 RT-PCR performed on RNA extracts from DT-40 cells transfected with miniLAT-E1EM produced a unique amplicon corresponding to the expression of the mimicking exon 1-exonmiR spliced transcripts, consistent with the findings for the RT- control (Fig. 4C). Finally, the hypothesis was confirmed by the analysis of miRNA expression based on RT-qPCRs revealing that mdv1-mir-M7 and -M10 were effectively processed from exonmiR, but with a significantly lower level of expression (25% lower) for mdv1-mir-M7 with the miniLAT-E1EM than for miniLAT-WT (Fig. 4D).

Mdv1-mir-M7 negatively impacts exonmiR spliced LAT lncRNA expression

To further investigate the link observed between mdv1-mir-M7 processing and exonmiR spliced LAT lncRNA (Fig. 4D), we constructed miniLAT-∆7 lacking the pre-mdv1-mir-M7 sequence (Fig. 5A). We then performed RT-PCR on RNA extracts from DT-40 cells transfected with miniLAT-Δ7 and compared the amplicons obtained with those obtained with miniLAT-WT. The exon 1-exon 2 RT-PCR performed with primers A463/A89 on miniLAT-∆7 extracted RNA amplified four products of 230, 898, 1100 and 1643 bp (Fig. 5B). Three of them corresponded to the amplicons obtained with the miniLAT- WT (Fig. 2B): the exon 1-exon 2A/2B spliced transcripts (230 bp), the non-specific product (1100 bp) and the unspliced transcript deleted of the pre-mdv1-miR-M7 sequence (1643 bp), as confirmed by sequencing analyses. Interestingly, the fourth amplicon of 898 bp (Fig. 5C), not detected with the miniLAT-WT (Fig. 2B), corresponded to the exonmiR spliced transcript deleted of pre-mdv1-mir-M7

(11)

Version postprint

sequence. We further estimated that exonmiR splicing detection was increased of 1.45 times with the miniLAT-∆7 in comparison with the miniLAT-WT by performing the exon 1-exonmiR (A463/M621) and the exon 1 (A463/A464) semi-quantitative RT-PCRs (Fig. 5C), in agreement with an equivalent transcript expression from both minigenes (1/0.98) (Fig. 5C). This increase in exonmiR spliced transcript observed indicates that the presence of the exonic mdv1-mir-M7 is damaging for exonmiR spliced transcript expression (Fig. 5C).

Furthermore, we assessed the effects of mdv1-mir-M7 deletion and more precisely of the increase of exonmiR alternative splicing on the three other miRNAs of the cluster by performing RT-qPCR on miRNAs from miniLAT-∆7 relative to those from miniLAT-WT (Fig. 5D). The RT-qPCR analysis showed no effect on the weakly expressed mdv1-mir-M10, whereas levels of mdv1-mir-M8 with miniLAT-∆7 were twice those with miniLAT-WT (Fig. 5D), suggesting that the alternative splicing of exonmiR had a direct positive impact on mdv1-mir-M8 biogenesis (Fig. 5D). Finally, as expected, the strongest impact was that on the relative expression of the 5’-tailed mirtron mdv1-mir-M6, with an associated 2.8-fold increase in expression correlated with the upregulation of exonmiR splicing.

DISCUSSION

Our results provide new insight into the interplay between alternative splicing and the differential biogenesis of miRNAs, with the first demonstration of the existence of a 5’-tailed mirtron within a compact intronic cluster of pre-miRNAs, mdv1-mir-M6. Its biogenesis is Drosha and DGCR8 independent (Fig. 3D and E), greatly decreased by the inhibition of splicing (Fig. 2), increased by the splicing of exonmiR (Fig. 5) and is associated with an effective 3’SS (CAG) present at the 3’ end of mdv1-mir-M6 (Fig. 1). The first viral mirtron mdv1-mir-M6 is a 5’-tailed-mirtron with sequence properties in common with most of the mirtrons described in vertebrates. 26,28 Indeed, in addition to the 3’SS, this new mdv1-mir-M6 mirtron sequence also includes a consensus branchpoint sequence in its loop and a polypyrimidine tract in mdv1-miR-M6-3P (Fig. 3A). 24 However, whereas almost all the mirtrons described to date are processed from constitutively spliced introns, mdv1-mir-M6, like two previously described exceptions, the dme-mir-2494 and mmu-mir-6927 mirtrons, 26,29 is derived from an alternatively spliced intron.

One of the most interesting features of this novel mirtron is its position embedded in the middle of an intronic cluster of miRNAs. As the second miRNA of the mdv1-miR-M8-M10 cluster,

(12)

Version postprint

mdv1-mir-M6 biogenesis plays an active role in the differential expression of the miRNAs of the cluster systematically observed in the various libraries. 14,21-23 Its splicing as a mirtron dispatches the first pre- miRNA of the cluster, mdv1-mir-M8, to the intron, whereas the last two pre-miRNAs, mdv1-mir-M7 and -M10, are maintained in the alternative exonmiR. We proposed a model in which complex crosstalk between Drosha and the spliceosome is involved in differential mdv1-miR-M8-M10 expression, according to alternative splicing of the host intron 1 (Fig. 6): alternative splicing of exonmiR responsible for the mirtron processing or alternative splicing of the larger intron 1 leading to exon 1- exon 2A/B spliced transcript.

Based on exon 1-exonmiR alternative splicing and in accordance with intronic miRNA processing, 5 we suggest that mdv1-mir-M8 is initially cropped by Drosha from the intron during splicing reaction from the constitutive 5’SS to the 3’SS of the mdv1-mir-M6 mirtron (Fig. 6A, Step I). Mdv1-mir-M6 is then released by the debranching of this lariat and the 5’-tail may then be digested by an unknown potential exonuclease, as previously suggested, 10 to generate the pre-miRNA hairpin of mdv1-mir-M6 (Fig. 6A, Step I). The major consequence of mdv1-mir-M6 mirtron splicing is the exonisation of the two last miRNAs of the cluster, the patterns of expression of which are opposite to that of the exonmiR spliced LAT lncRNA (Fig. 3-5). In miniLAT-E1EM construct analysis (Fig. 5), we observed a co-existence of mdv1-miR-M7, -M10 and spliced LAT lncRNA, suggesting that part of the exonmiR spliced LAT lncRNA contains mdv1-miR-M7-M10 (Fig. 6A1, Step II), whereas the other part gives rise to these miRNAs being cropped by Drosha (Fig. 6A2, Step II). In MSB-1 cells and in minigenes analysis (Fig.

1B and 2B), the exonmiR spliced LAT lncRNA harboring mdv1-miR-M7 and -M10 was hardly detectable but when mdv1-miR-M7 and -M10 processing is inhibited following Drosha silencing (Fig.

3B-D) and when mdv1-miR-M7 is deleted (Fig. 5), exonmiR spliced LAT lncRNA detection increased (Fig. 3E and 5B). This suggests that the majority of exonmiR spliced LAT lncRNA undergoes degradation following mdv1-miR-M7 and -M10 processing by Drosha (Fig. 6A2, Step II), as described for transcripts harboring exonic miRNAs. 6

On the other hand, based on alternative splicing of intron 1 generating exon 1-exon 2A/B LAT lncRNA spliced transcripts, we suggest that the four pre-miRNAs of the cluster are cropped by Drosha from the larger intron 1, including the pre-mdv1-mir-M6 mirtron (Fig. 6B). This hypothesis is supported by several observations. First, the inhibition of intron 1 splicing with miniLAT-5’SSmm was associated with a residual level of mdv1-mir-M6 expression of 30% (Fig. 2). It thus appears that about 70% of mdv1-

(13)

Version postprint

mir-M6 is processed via the pathway involving exonmiR alternative splicing. Moreover, since the knockdown of Drosha was incomplete (Fig. 3B and C), we suggest that this mirtron can also follow the canonical pathway. In addition, a global analysis of miRNA deep sequencing data from MSB-1 cells revealed that a non-negligible part of the reads for the mdv1-miR-M6-3P sequence corresponded to 3’SS splicing of the mirtron (GAGAUCCCUGCGAAAUGACAG), and almost all the other reads ended with a uracil residue (GAGAUCCCUGCGAAAUGACAGU), as annotated in miRbase ((http://www.mirbase.org/). 23 This last uracil residue probably results from the classical 3’- monouridylation generally observed for 5’-tailed mirtrons, 30-32 but it may also be the signature from the genomic sequence of mdv1-mir-M6 cropping by Drosha, as confirmed by sequencing analyses of specific 5’RACE-PCR (Invitrogen) on non-capped RNAs from MSB-1 cells (data not shown).

Finally, whatever the pathway used for miRNA processing, our data indicate that differential expression of the mdv1-miR-M8-M10 cluster of miRNAs seems to be directly correlated with the alternative splicing of intron 1 of LAT lncRNA and strengthened by the temporal kinetics of the two- step processing pathway for miRNAs following mirtron splicing.

The differential expression of the miRNAs of the mdv1-miR-M8-M10 cluster is associated with spliceosome recruitment at alternative 3’SS, as observed for the hsa-miR-106b-25 intronic cluster of miRNAs. 9 Interestingly, various 3’SS are used for LAT lncRNA intron 1 splicing, 19 but only the newly discovered 3’SS defining exonmiR is included in the cluster sequence and operates via a mechanism in which splicing clearly plays an active part in regulating the expression of the miRNAs of the cluster and the host transcript. First, we observed that alternative splicing of exonmiR promoted expression of the canonical intronic mdv1-mir-M8, as observed when exonmiR splicing was enhanced with miniLAT-

∆7 (Fig. 5C and D). As an isolated intronic and canonical miRNA, mdv1-mir-M8 in intron 1-exonmiR lariat may be more accessible to the MPC and, therefore, easier to process, than from the large intron containing the secondary structure of the whole cluster. Furthermore, we observed that exonmiR splicing was associated with a decrease in the expression of mdv1-mir-M7 but not -M10 and with the downregulation of the LAT lncRNA (Fig. 4). Indeed, alternative splicing of the mdv1-mir-M6 mirtron appears to be involved in host transcript regulation, as previously hypothesized for the dme-mir-2494 and mmu-mir-6927alternative mirtrons. 26, 33 Moreover, fine-tuning of the regulation of mdv1-mir-M7 and LAT lncRNA is of the utmost importance for MDV-1 infection, because both play a key role in the latent cycle and the associated establishment of lymphomagenesis. 19,34 By contrast to mdv1-mir-M8

(14)

Version postprint

and -M7, we found that mdv1-mir-M10 expression was not altered by exonmiR alternative splicing event (Fig. 2E, 4D and 5D), although this exonic miRNA also takes part in the host transcript regulation (Fig. 4). Interestingly, we also observed that mdv1-mir-M10 expression was altered by Drosha silencing but it was correctly expressed in MEF KO-DGCR8 cells (Fig. 3E) suggesting that mdv1-mir-M10 could belong to the simtron family of miRNAs, described to be processed by Drosha independently from DGCR8 or the MPC. 35 Overall, our results reveal the existence of an interesting mechanism in which the alternative splicing of a mirtron present in a cluster is involved in the differential expression of miRNAs, because intronic mdv1-mir-M8 expression seems to be enhanced by mirtron biogenesis, whereas mdv1-mir-M7 and LAT lncRNA levels are downregulated and mdv1- mir-M10 is not impacted by this alternative splicing event (Fig. 3-5).

The crosstalk between the spliceosome and the MPC has various consequences, not only for miRNA biogenesis, but also for the fate of the host pre-RNA. For instance, various studies have shown that assembly of the spliceosome at splicing sites improves intronic miRNA processing by the MPC, whereas the inhibition of splicing has no effect on miRNA biogenesis. 5,6,27 Consistent with these findings, the Drosha processing of mdv1-mir-M8, -M7 and -M10 was not affected by a lack of spliceosome recruitment for intron 1 splicing with the miniLAT-5’SSmm construct (Fig. 2B, C and E).

This result also indicates that, by contrast to the intronic hsa-mir-211, the expression of which was decreased by 5’SS invalidation, 7 the processing of the canonical miRNAs of the LAT lncRNA by Drosha does not seem to be promoted by U1snRNP recognition of the 5’SS of intron 1.

In conclusion, in our herpesvirus model, we provide the first demonstration of the existence of a mirtron in the middle of a cluster of miRNAs. Many studies have demonstrated the complex influence of the MPC and the spliceosome on each other. Here, we describe an interesting new mechanism for this interplay, with the discovery of a 5’-tailed mirtron embedded in a compact cluster of miRNAs containing intronic, exonic, canonical or non-canonical miRNAs, produced by alternative splicing of a viral lncRNA. The biogenesis of this mirtron had differential effects on the three neighbouring miRNAs and on the host transcript.

MATERIALS AND METHODS

Cell lines

(15)

Version postprint

The MSB-1 cell line is derived from a spleen lymphoma induced by a virulent strain of MDV-1. 36 It was maintained in RPMI-1640 medium (Lonza) supplemented with 1 mM sodium pyruvate, 10% foetal bovine serum, and 5% chicken serum. The DT-40 B-cell line, which is derived from an avian leukosis virus-induced lymphoma, was cultured in Dulbecco’s modified Eagle’s medium (Lonza) supplemented with serum, in a similar manner. The MEF KO-DGCR8 (Novus Biologicals) cell line was grown in DMEM-Hi glucose (Gibco) supplemented with L-glutamine and 10% foetal bovine serum.

Minigene design

The miniLAT-WT (pBS691 minigene) construct containing the LAT lncRNA sequence from its promoter to the fourth exon has been described elsewhere. 20 We generated the mutated constructs miniLAT-5’SSm and miniLAT-5’SSmm, by amplifying the sequence of interest with mutated primers for the corresponding SS sequences, for direct PCR. For the miniLAT-E1EM construct, PCR was performed with overlapping primers designed to delete the intron 1 sequence from the constitutive 5’SS to the alternative 3’SS of the mdv1-miR-M6 mirtron defining exonmiR splicing, corresponding to the 142842 to 143586 region of the MDV-1 serotype RB-1B sequence (GenBank accession number RB-1B EF523390). For the miniLAT-∆7 construct, PCR was performed with an overlapping primer designed to delete the pre-mdv1-mir-M7 sequence corresponding to the 143702 to 143782 region of the RB-1B reference sequence. All plasmids were purified with the NucleoBond® Xtra Midi kit (Macherey-Nagel), and the sequences of all inserts from each construct were systematically verified (GATC Biotech).

Transfection and RNA extraction

DT-40 lymphoblastoid cells were transfected with minigenes by electroporation with an Amaxa® Biosystems Nucleofector® machine (Lonza). Cell density was adjusted to 3 x 106 cells/100 μl of Nucleofector® solution T (Lonza) containing 3 μg of minigenes. The cells were then electroporated in a 4-mm cuvette subjected to specific program B-023. Electroporated cells were recovered in 3 ml of complete medium and dispensed into a six-well plate. MEF cells were transfected with 1µg of minigene for 0.3X106 cells in P12 wells with Lipofectamine® 2000 (Invitrogen). They were harvested 48 hours after transfection for the extraction, in two different fractions, of small (<200 nts) and large (>200 nts) RNAs, which were treated by DNase, with a Nucleospin® MiRNA kit (Macherey-Nagel), according to the manufacturer’s instructions.

(16)

Version postprint

We reverse-transcribed 4 µg of large RNAs with a mixture of oligo(dT) and random primers (Eurogentec) and the Superscript® III reverse transcriptase (Invitrogen) at 55°C, to prevent any interference of the secondary structure with extension by the reverse transcriptase, as recommended by the manufacturer. DNase treatments of large RNAs were systematically confirmed by PCR analyses. A negative control for reverse transcription (RT-) was systematically carried out in the same conditions. The resulting cDNAs were amplified by PCR with the GoTaq® DNA polymerase (Promega).

The primers used for PCR to detect spliced and unspliced exon 1, exon 1–exon 2 or exon 1–exonmiR derived from miniLAT constructs or MSB-1 cells were as follows: A463 (exon 1 forward,

CGCTACCCGTGCGTTTGGCACAAGTTT), A464 (exon 1 reverse, CCTCTCAACTAGTCCGAGAGACCTGCGGTA), A89 (exon 2 reverse, AGACCACCGCGTCTATGTCGGA), M449 (intron 1 reverse,

GATATGTGGATCGGGAATCG), M621 (exonmiR reverse, GTTCGCGGCTCTCTTGGCTAGA) and B139 (alternative exon 2 reverse, ACCTGGAACGACAATGATCTCCGGACCGAGAACACAGTGA). All PCR products were inserted into pGEM®-T Easy (Promega) and the sequence of the corresponding inserts was verified (GATC Biotech). All sequences were analysed by comparison with the viral RB-1B sequence or the chicken genomic sequence, with Geneious software (www.geneious.com) and BLAST. The primers used for semi-quantitative RT-PCR analysis on the large RNAs extracted from DT-40 cells transfected with miniLATs were A463/A464 (exon 1) for the miniLATs expression and M450/M451 (forward TCCTCTCTGGCAAAGTCCAAG; reverse CACAACATACTCAGCACCTGC) for GAPDH mRNA amplifications. We then normalised miniLATs large RNA levels with respect to GADPH mRNA levels, on the basis of signal intensity calculations with Adobe Photoshop 6 software.

Quantitative RT-PCRs of the mdv1-miR-M8-M10 cluster

We used the miScript™ PCR System (Qiagen) to quantify mv1-miR-M8-5P (TATTGTTCTGTGGTTGGTTTCG), mdv1-miR-M6-5P (TGTTGTTCCGTAGTGTTCTCG), mdv1-miR-M7-5P (TGTTATCTCGGGGAGATCCCGA), mdv1-miR-M10-5P (GCGTTGTCTCGTAGAGGTCCAG), gga-miR-21-5P (TAGCTTATCAGACTGATGTTGA) ,gga-miR-6615-5P mirtron (TTGGGGACACCATCAGAACAGCCA),

and mmu-3547-3P mirtron (TGAGCACCACCCCTCTCTCAG) expression levels via the 2-∆∆Ct method. We subjected 1 µg of small RNAs from minigene transfections and 100 ng of small RNAs from Drosha silencing and MEF KO-DGCR8 transfection experiments to reverse transcription in a total volume of 20 µl, and 2 µl of a 1:10 dilution was used for quantitative PCR, as recommended by the manufacturer (Applied Biosystems). The U6snRNA (miScript™; Qiagen) the gga-miR-6582-3P mirtron

(17)

Version postprint

(CACTCTGGGTGTTTCTCTTGCAG) and the mmu-miR-6927-5P mirtron (GTGAGGGGATCCAGCCCAGGCT) were used as reference genes for the miniLATs Drosha-silencing and MEF KO-DGCR8 experiments, respectively. All q-PCRs were performed on the StepOnePlus™ Real-time PCR System (Applied Biosystems), in the conditions recommended by the manufacturer, and post-run dissociation curves were generated.

Drosha silencing in MSB-1 cells

A double-stranded sequence containing a shRNA directed against nucleotides 3119 to 3147 of the chicken Drosha gene (NM_001006379.1) was designed

(GGTACCGCAAGCAAGCTCCGAGATCTGTATGAGAACCTGACCCATTCTCATACAGATCTCGGAG CTTGCTTGTTTTTCTCGAG; with the sh-seed in bold characters and the sh-loop underlined) and synthesised (Eurogentec) with a poly(T) transcription termination motif (bold italics) at the 3’ end and KpnI and XhoI extensions (italics). After enzymatic digestion, the sh-Drosha insert was ligated into pcDNA™-4/TO (Invitrogen) digested with KpnI and XhoI to generate the pcDNA4/TO-shDrosha construct. The T-REx™ system (Invitrogen) was used according to the manufacturer's instructions, to generate stable MSB-1 cell lines with inducible expression of the shRNA against Drosha. MSB-1 cell lines expressing the Tet repressor were generated by transfecting 3 x 106 MSB-1 cells with 3 µg of the pcDNA6/TR plasmid in Nucleofector solution T (Lonza) by electroporation with Nucleofector®

program X-001. The pcDNA6/TR-transformed MSB-1 cells were selected by positive resistance methods, with 7.5 μg/ml blasticidin (Invitrogen). The cells were then transfected with the pcDNA4/TO- shDrosha expression plasmid and selected in medium supplemented with 125 µg/ml ZeocinTM (Invitrogen). Two independent stable MSB-1 cell lines with tetracycline- inducible sh-Drosha

expression, A and B, were established. In accordance with the manufacturer's instructions, cells were treated for six days with 1 µg/ml/24 h tetracycline, to inhibit the Tet repressor and allow the expression of sh-Drosha, or cultured in the same conditions but without tetracycline, as a control. The primers used for semi-quantitative RT-PCR analysis on the large RNAs extracted in sh-Drosha silencing experiments were A799/A780 (forward TCCCTGTCACGCTCCCTG; reverse

GCGACGATCTCCGGAGAGGAGCA) for the Drosha mRNA and M450/M451 (forward

TCCTCTCTGGCAAAGTCCAAG; reverse CACAACATACTCAGCACCTGC) for GAPDH mRNA amplifications. We then normalised Drosha mRNA levels with respect to GADPH mRNA levels, on the

(18)

Version postprint

sh-Drosha induction in MSB-1 cells, one million MSB-1 cells with (Sh+) and without (Sh-) the induction of sh-Drosha expression by the T-Rex system (Invitrogen) were treated with lysis buffer and proteins were separated by electrophoresis in 7.5% polyacrylamide gels containing SDS, as previously described (37). The bands were transferred to nitrocellulose membranes by capillary transfer and the membranes were incubated with blocking buffer (Odyssey). They were then probed with polyclonal rabbit anti-Drosha (Abcam ab85027, 1/100e) or mouse anti-GAPDH (Millipore, 1/2500e) primary antibodies, followed by monoclonal anti- rabbit and anti-mouse IRD-labelled secondary antibodies (Odyssey, 1/2500e). Immunoreactions were detected after excitation with light at wavelengths of 700 nm and 800 nm for anti-mouse and anti-rabbit antibodies, respectively. We then normalised Drosha protein levels with respect to GADPH protein levels.

FUNDING

This work was supported by grants from the “Ligue contre le Cancer Grand Ouest” (France) including the committees for “départements” 18, 29, 35, 36 and 37, a grant from the “Fonds Européen de Développement Régional” (FEDER) (www.europe-centre.eu) EXMIR (no. 2835-34204) and a grant from the Région Centre (www.regioncentre.fr) MIRES (no. 200900038264).

Conflict of interest statement. We have no conflict of interest to declare.

ACKNOWLEDGEMENTS

We thank Dr C. Dupuy for helpful discussions relating to this work and critical reading of the manuscript. We also thank M. André and I. Boumart for technical support.

(19)

Version postprint

REFERENCES

1. Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol 2009;

10:126-39.

2. Morlando M, Ballarino M, Gromak N, Pagano F, Bozzoni I, Proudfoot NJ. Primary microRNA transcripts are processed co-transcriptionally. Nat Struct Mol Biol 2008; 15:902-9.

3. Rearick D, Prakash A, McSweeny A, Shepard SS, Fedorova L, Fedorov A. Critical association of ncRNA with introns. Nucleic Acids Res 2011; 39:2357-66.

4. Ramalingam P, Palanichamy JK, Singh A, Das P, Bhagat M, Kassab MA, Sinha S, Chattopadhyay P. Biogenesis of intronic miRNAs located in clusters by independent transcription and alternative splicing. RNA 2014; 20:76-87.

5. Kim YK, Kim VN. Processing of intronic microRNAs. EMBO J 2007; 26:775-83.

6. Mattioli C, Pianigiani G, Pagani F. Cross talk between spliceosome and microprocessor defines the fate of pre-mRNA. Wiley Interdiscip Rev RNA 2014; 5:647-58.

7. Janas MM, Khaled M, Schubert S, Bernstein JG, Golan D, Veguilla RA, Fisher DE, Shomron N, Levy C, Novina CD. Feed-forward microprocessing and splicing activities at a microRNA-containing intron. PLoS Genet 2011; 7:e1002330.

8. Mattioli C, Pianigiani G, Pagani F. A competitive regulatory mechanism discriminates between juxtaposed splice sites and pri-miRNA structures. Nucleic Acids Res 2013; 41:8680-91.

9. Agranat-Tamir L, Shomron N, Sperling J, Sperling R. Interplay between pre-mRNA splicing and microRNA biogenesis within the supraspliceosome. Nucleic Acids Res 2014; 42:4640-51.

10. Curtis HJ, Sibley CR, Wood MJ. Mirtrons, an emerging class of atypical miRNA. Wiley Interdiscip Rev RNA 2012; 3:617-32.

11. Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC. Mammalian mirtron genes. Molecular cell 2007; 28:328-36.

(20)

Version postprint

12. Flynt AS, Greimann JC, Chung WJ, Lima CD, Lai EC. MicroRNA biogenesis via splicing and exosome-mediated trimming in Drosophila. Molecular cell 2010; 38:900-7.

13. Kincaid RP, Sullivan CS. Virus-encoded microRNAs: an overview and a look to the future.

PLoS Pathog 2012; 8:e1003018.

14. Burnside J, Bernberg E, Anderson A, Lu C, Meyers BC, Green PJ, Jain N, Isaacs G, Morgan RW. Marek's disease virus encodes MicroRNAs that map to meq and the latency-associated transcript. Journal of virology 2006; 80:8778-86.

15. Calnek BW. Marek's disease--a model for herpesvirus oncology. Crit Rev Microbiol 1986;

12:293-320.

16. Schat KA, Chen CL, Calnek BW, Char D. Transformation of T-lymphocyte subsets by Marek's disease herpesvirus. Journal of virology 1991; 65:1408-13.

17. Shkreli M, Dambrine G, Soubieux D, Kut E, Rasschaert D. Involvement of the oncoprotein c- Myc in viral telomerase RNA gene regulation during Marek's disease virus-induced lymphomagenesis.

Journal of virology 2007; 81:4848-57.

18. Zhao Y, Xu H, Yao Y, Smith LP, Kgosana L, Green J, Petherbridge L, Baigent SJ, Nair V.

Critical role of the virus-encoded microRNA-155 ortholog in the induction of Marek's disease lymphomas. PLoS Pathog 2011; 7:e1001305.

19. Strassheim S, Stik G, Rasschaert D, Laurent S. mdv1-miR-M7-5p, located in the newly identified first intron of the latency-associated transcript of Marek's disease virus, targets the immediate-early genes ICP4 and ICP27. J Gen Virol 2012; 93:1731-42.

20. Stik G, Laurent S, Coupeau D, Coutaud B, Dambrine G, Rasschaert D, Muylkens B. A p53- dependent promoter associated with polymorphic tandem repeats controls the expression of a viral transcript encoding clustered microRNAs. RNA 2010; 16:2263-76.

21. Burnside J, Morgan R. Emerging roles of chicken and viral microRNAs in avian disease. BMC Proc 2011; 5 Suppl 4:S2.

(21)

Version postprint

22. Morgan R, Anderson A, Bernberg E, Kamboj S, Huang E, Lagasse G, Isaacs G, Parcells M, Meyers BC, Green PJ, et al. Sequence conservation and differential expression of Marek's disease virus microRNAs. Journal of virology 2008; 82:12213-20.

23. Stik G, Muylkens B, Coupeau D, Laurent S, Dambrine G, Messmer M, Chane-Woon-Ming B, Pfeffer S, Rasschaert D. Small RNA cloning and sequencing strategy affects host and viral microRNA expression signatures. J Biotechnol 2014; 181:35-44.

24. Sibley CR, Seow Y, Saayman S, Dijkstra KK, El Andaloussi S, Weinberg MS, Wood MJ. The biogenesis and characterization of mammalian microRNAs of mirtron origin. Nucleic Acids Res 2012;

40:438-48.

25. Wang Y, Medvid R, Melton C, Jaenisch R, Blelloch R. DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self-renewal. Nat Genet 2007; 39:380-5.

26. Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC. Discovery of hundreds of mirtrons in mouse and human small RNA data. Genome research 2012; 22:1634-45.

27. Kataoka N, Fujita M, Ohno M. Functional association of the Microprocessor complex with the spliceosome. Mol Cell Biol 2009; 29:3243-54.

28. Westholm JO, Lai EC. Mirtrons: microRNA biogenesis via splicing. Biochimie 2011; 93:1897- 904.

29. Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC.

Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans. Genome research 2011; 21:286-300.

30. Bortolamiol-Becet D, Hu F, Jee D, Wen J, Okamura K, Lin CJ, Ameres SL, Lai EC. Selective Suppression of the Splicing-Mediated MicroRNA Pathway by the Terminal Uridyltransferase Tailor.

Molecular cell 2015; 59:217-28.

31. Reimao-Pinto MM, Ignatova V, Burkard TR, Hung JH, Manzenreither RA, Sowemimo I, Herzog VA, Reichholf B, Farina-Lopez S, Ameres SL. Uridylation of RNA Hairpins by Tailor Confines the Emergence of MicroRNAs in Drosophila. Molecular cell 2015; 59:203-16.

(22)

Version postprint

32. Westholm JO, Ladewig E, Okamura K, Robine N, Lai EC. Common and distinct patterns of terminal modifications to mirtrons and canonical microRNAs. RNA 2012; 18:177-92.

33. Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML. A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach. Genome research 2008;

18:957-64.

34. Morgan RW, Xie Q, Cantello JL, Miles AM, Bernberg EL, Kent J, Anderson A. Marek's disease virus latency. Current topics in microbiology and immunology 2001; 255:223-43.

35. Havens MA, Reich AA, Duelli DM, Hastings ML. Biogenesis of mammalian microRNAs by a non-canonical processing pathway. Nucleic Acids Res 2012; 40:4626-40.

36. Akiyama Y, Naito M, Kato S. Cell surface antigen and viral antigen of Marek's disease virus in lymphoid cells of the spleen from chickens inoculated with virulent strains. Biken J 1973; 16:91-4.

(23)

Version postprint

Figure 1. Detection of a new 3’SS inside mdv1-miR-M8-M10 cluster defining exonmiR, a large alternative exon 2 of LAT lncRNA. (A) Schematic diagrams of the LAT lncRNA from its first to 15th exon (grey boxes), containing the mdv1-miR-M8-M10 cluster of miRNAs in its first intron. Introns are represented by black lines. The primers used for RT-PCR analyses of large RNAs extracted from MSB-1 cells, naturally infected with MDV, are indicated by arrows. (B) Electrophoretic analyses of RT- PCR products obtained with A463/A89 with (RT+) or without (RT-) reverse transcriptase. Schematic diagrams of the unspliced (US) and spliced (S) transcripts are shown beside the corresponding amplicons. (C) Annotation of the exon 1 to exon 2 sequence of the LAT lncRNA. Exon 1 and 2 sequences are highlighted in dark grey and the alternative exonmiR is highlighted in light grey.

Primers are underlined, mdv1-miR-M8-M10 miRNA sequences are framed and splicing sites (5’SS or

(24)

Version postprint

3’SS) are indicated in bold typeface. (D) Electrophoretic analyses of RT-PCR products obtained with A463/M449 and A463/M621 (E). MW, Molecular weight markers are indicated, in bp.

(25)

Version postprint

Figure 2. Effect of splicing inhibition of LAT lncRNA intron 1 on the biogenesis of mdv1-miR-M8-M10 cluster. (A) Partial schematic diagrams of the three minigenes: MiniLAT-WT, MiniLAT-5’SSm and MiniLAT-5’SSmm (top to bottom). Exon 1 and exon 2 are shown as grey boxes and intron 1 of the miniLATs constructs containing the mdv1-miR-M8-M10 cluster of miRNAs is indicated by a black line.

Wild-type sequences and sequences with mutations of both the constitutive and alternative 5’SS of intron 1 are shown. The mutated nucleotides are underlined and schematically represented by one or two dots on the miniLAT-5’SSm and miniLAT-5’SSmm constructs, respectively. Primers A463, A464, M621 and A89, used for RT-PCR, are indicated by arrows. (B) Exon 1–exon 2 RT-PCR analyses performed with A463/A89 primers on large RNAs extracted from DT-40 cells transfected with the three miniLAT constructs (WT, 5’SSm and 5’SSmm), without (RT-) or with (RT+) reverse transcriptase.

Unspliced (US), spliced (S) and alternatively spliced (Alt. S) transcripts are schematically represented

(26)

Version postprint

with their corresponding lengths (bp). (NS) indicates the non-specific amplicon of DT-40 cells genomic transcripts, corresponding to the chicken IGF2PB3-mRNA (NM_001006359, nt 150-1282), as determined by sequencing analyses. Molecular weight (MW) markers are also shown, with their sizes indicated in bp on the left of the gel. (C) Electrophoretic analyses of exon 1–exonmiR RT-PCR products performed with A463/M621 primers on large RNAs extracted from DT-40 cells transfected with the miniLAT-WT and -5’SSmm constructs, with schematic diagrams of unspliced (US) and spliced (S) transcripts. (NS) indicates the non-specific amplicon of DT-40 cells genomic transcripts, corresponding to the chicken IGF2PB3-mRNA (NM_001006359, nt 662-1282), as determined by sequencing analyses. (D) Semi-quantitative RT-PCR analysis of miniLAT-WT and miniLAT-5’SSmm RNAs following exon 1 amplification, with GAPDH mRNA used as a reference. (E) Relative strand 5P levels for the mdv1-miR-M8-M10 miRNAs, as determined by RT-qPCR with the 2-(∆∆Ct) method and U6snRNA as the reference. The histograms correspond to the mean of triplicates for three independent transfections of DT-40 cells with miniLAT-WT (black) and miniLAT-5’SSmm (grey) constructs. Standard errors are shown. Significant differences in expression are indicated with an asterisk (*), for P<0.01 (t test).

(27)

Version postprint

Figure 3. Impact of the inhibition of the microprocessor on the expression of microRNAs and the detection of the exonmiR. (A) Annotation of the mdv1-mir-M6 mirtron hairpin sequence. Mdv1- miR-M6-5P and -3P strands are indicated, the putative branchpoint sequence in the loop is shown in grey letters and the exonmiR sequence is highlighted in grey. The 3’SS of the 5’-tailed-mirtron and the putative poly-pyrimidine tract are framed. (B) and (C) Drosha silencing in MSB-1 cell lines with a shRNA expressed in a tetracycline-dependent manner with the T-Rex system (Invitrogen). (B) Semi- quantitative RT-PCR analysis of Drosha mRNA extracted from cells with (+) and without (-) sh-Drosha induction, with GAPDH mRNA used as a reference. (C) Western blot analysis of Drosha protein silencing, with GAPDH protein used as a reference. (D) Relative expression of mdv1-miR-M8-5P,

(28)

Version postprint

33 and gga-miR-21-5P (chicken canonical miRNA control) in non-induced (black) and induced (grey) sh-Drosha lineages, as determined by RT-qPCR with the 2-(∆∆Ct) method and the gga-miR-6582-3P mirtron . 33 as a reference. Standard errors of two independent experiments (lineages A and B) carried out in triplicate are shown. Significant differences in expression are indicated with an asterisk (*), for P<0.01 (t test). (E) Relative expression of mdv1-miR-M8-5P, mdv1-miR-M6-5P, mdv1-miR-M7-5P, mdv1-miR-M10-5P, mmu-miR-3547-3P (murine mirtron control). 26 and mmu-miR-21-5P (murine canonical miRNA control) in MEF DGCR8 (-/-) cells transfected with miniLAT-WT (black) and miniLAT- 5’SSmm (grey), as determined by RT-qPCR with the 2-(∆∆Ct) method and the mmu-miR-6927-5P mirtron

.26 as a reference. Standard errors of two independent experiments carried out in triplicate are shown.

Significant differences in expression are indicated with an asterisk (*), for P<0.01 (t test). (F) RT-PCRs analyses of large RNAs extracted from MSB-1 cells with (Sh+) and without (Sh-) sh-Drosha induction.

Above, schematic diagrams of the LAT lncRNA from its first to 15th exon (grey boxes), containing the mdv1-miR-M8-M10 cluster of miRNAs in its first intron (black line). The primers used for exon 1 (A463/A464) and for exon 1-exon 2 (A463/A89) RT-PCRs analyses are indicated by arrows. Below, electrophoretic analyses of RT-PCR products obtained with A463/A89 without (RT-) or with (RT+) reverse transcriptase. Schematic diagrams of the unspliced (US) and spliced (S) transcripts are shown beside the corresponding amplicons with their relative expression indicated in the table . MW, Molecular weight markers are indicated, in bp.

(29)

Version postprint

Figure 4. Impact of exonmiR splicing on the biogenesis of mdv1-miR-M7 and –M10. (A) Schematic representation of the region from exon 1 to exon 2 (dark grey boxes) of the miniLAT-E1EM deleted of the intron 1 sequence from its 5’SS to the 3’SS of the mdv1-miR-M6 mirtron. ExonmiR (light grey box) harboring mdv1-miR-M7 and –M10 (black line) and the primers used for RT-PCR (arrows) are indicated. (B) Semi-quantitative RT-PCR analysis of miniLAT-WT and miniLAT-E1EM RNAs following exon 1 amplification, with GAPDH mRNA used as a reference. (C) Electrophoretic analyses of exon 1- exon 2 RT-PCR products obtained with A463/A89 primers, from large RNAs extracted from DT-40 cells transfected with the miniLAT-E1EM constructs with reverse transcriptase (RT+) (on the left) and without reverse transcriptase (RT-) (on the right). Unspliced (US) transcript is schematically represented with its length (bp). The sizes of the molecular weight (MW) markers are indicated. (D) Relative expression of mdv1-miR-M7-5P and mdv1-miR-M10-5P, determined by RT-qPCR with the 2-

(30)

Version postprint

(∆∆Ct)

method and U6snRNA as the reference. The histograms indicate the mean values of triplicates of three independent transfections of DT-40 cells with miniLAT-WT (black) and miniLAT-E1EM (grey) constructs. Standard errors are shown. Significant differences in expression are represented by one (*) asterisk, for P<0.05 (t test).

(31)

Version postprint

Figure 5. Effect of the mdv1-mir-M7 sequence deletion on exonmiR splicing and mdv1-mir-M8-M6 biogenesis. (A) Schematic representation of the region from exon 1 to exon 2 (grey boxes) of the miniLAT-∆7 construct containing the intronic mdv1-miR-M8-M10 cluster (black line) deleted of the pre- mdv1-mir-M7 sequence. Primers A463, A464 and A89 are indicated by arrows. (B) Electrophoretic analyses of A463/A89 RT-PCR products performed on large RNAs extracted from DT-40 cells transfected with the miniLAT-∆7 construct, with (RT+) or without (RT-) reverse transcriptase.

Unspliced (US) and spliced (S) transcripts are schematically represented with their lengths (bp). (NS) indicates the non-specific amplicon of DT-40 cells genomic transcripts, corresponding to the chicken IGF2PB3-mRNA (NM_001006359, nt 662-1282), as determined by sequencing analyses. The sizes of the molecular weight (MW) markers are indicated. (C) In black, semi-quantitative RT-PCRs analysis of miniLAT-WT and miniLAT-∆7 exonmiR spliced transcripts expression following exon 1-exonmiR

(32)

Version postprint

amplification (A463/M621), with exon 1 amplification (A463/A464) used as a reference. In grey, semi- quantitative RT-PCRs analysis of miniLAT-WT and miniLAT-∆7 RNAs following exon 1 amplification, with GAPDH mRNA used as a reference. (D) Relative expression of the 5P strand of the mdv1-miR- M8-M10 miRNAs, determined by RT-qPCR, with the 2-(∆∆Ct) method and snRNAU6 as the reference.

The histograms show the mean values of triplicates of three independent transfections of DT-40 cells with miniLAT-WT (black) and miniLAT-∆7 (grey) constructs. Standard errors are shown. Significant differences in expression are represented by one (*) asterisk, for P<0.01 (t test).

(33)

Version postprint

Figure 6. The two distinct pathways of mdv1-miR-M8-M10 cluster biogenesis according to intron 1 alternative splicing of the LAT lncRNA. Pathway (A) is a two-step processing pathway. In step I, with exon 1–exonmiR alternative splicing, mdv1-miR-M8 and mdv1-mirtron-M6 are processed by Drosha (black lightning) and splicing, respectively. In step II, mdv1-mir-M7 and -M10 are either maintained in functional LAT lncRNA spliced transcripts containing exonmiR (A1) or processed by Drosha from exon 1–exonmiR spliced transcripts leading to destruction of the LAT lncRNA transcripts (A2). In pathway B, which is a minor pathway for the mdv1-miR-M6 mirtron, the four pre-miRNAs of the cluster are cropped by Drosha, leading to expression of the miRNAs and the exon 1-exon 2 alternatively spliced LAT lncRNA transcripts.

Références

Documents relatifs

Using this technique I have described for the first time, and in the time course of several days, the developmental dynamics of the functional properties of newborn neurons before

Our proof of Theorem 2.7 is divided into two steps: after proving the criticality of B ∗ for ρ small enough, we compute the second order shape derivative of the Lagrangian

ةﺮﻳﻮﺒﻟا ﺔﻳﻻو ﻲﻓ .(. ﺎﻬﺘﻟازإو ﺎﻬﻨﻣ ﺪﺤﻟا ﻢﻴﻠﻌﺘﻟا مﺎﻈﻧ ﻰﻠﻋ ﺐﺠﻴﻓ ﺔﻴﺒﻠﺴﻟا تﺎﻤﺴﻟا ﺎﻣأ ، ﺎﻬﺘﻴﻤﻨﺗو ﺔﻴﺑﺎﺠﻳﻻا تﺎﻤﺴﻟا.. 7 4 - ﺚﺤﺒﻟا ﺔﻴﻤهأ : تﺎﻤ ﺳ ﺪ ﻳﺪﺤﺘﻓ

L’accès à ce site Web et l’utilisation de son contenu sont assujettis aux conditions présentées dans le site LISEZ CES CONDITIONS ATTENTIVEMENT AVANT D’UTILISER CE SITE WEB.

of brisding artillery benign gunfire a ratde of sabres shrill whine of shells as into the tattoo arena high above the crowd swings a wild trapeze suspending froms

Mouse hybridoma cells having CD44 cell surface receptors and anti- CD44 antibodies were used to establish a proof-of-concept for this method.. Both the capture antibodies and the

3 Plasma leptin levels (a) and epididymal white adipose tissue resistin mRNA expression levels (b) in euthyroid (open bars) and hypothyroid (black bars) pair-fed rats.. Means±SEM

We studied the influence of its associated ant species (Pachycondyla goeldii and Camponotus femoratus) on the physical characteristics of the plants, and, subsequently, on the