• Aucun résultat trouvé

From bud formation to flowering: transcriptomic state defines the cherry developmental phases of sweet cherry bud dormancy

N/A
N/A
Protected

Academic year: 2021

Partager "From bud formation to flowering: transcriptomic state defines the cherry developmental phases of sweet cherry bud dormancy"

Copied!
30
0
0

Texte intégral

(1)

HAL Id: hal-02503000

https://hal.archives-ouvertes.fr/hal-02503000

Preprint submitted on 9 Mar 2020

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License

bud dormancy

Noémie Vimont, Mathieu Fouche, José Campoy, Meixuezi Tong, Mustapha Arkoun, Jean-Claude Yvin, Philip Wigge, Elisabeth Dirlewanger, Sandra

Cortijo, Bénédicte Wenden

To cite this version:

Noémie Vimont, Mathieu Fouche, José Campoy, Meixuezi Tong, Mustapha Arkoun, et al.. From bud

formation to flowering: transcriptomic state defines the cherry developmental phases of sweet cherry

bud dormancy. 2020. �hal-02503000�

(2)

From bud formation to flowering: transcriptomic state defines the cherry developmental phases 1

of sweet cherry bud dormancy 2

3

Noémie Vimont

1,2,3

, Mathieu Fouché

1

, José Antonio Campoy

4,5,6

, Meixuezi Tong

3

, Mustapha Arkoun

2

, 4

Jean-Claude Yvin

2

, Philip A. Wigge

7

, Elisabeth Dirlewanger

1

, Sandra Cortijo

3#

, Bénédicte Wenden

1#

5 6

1UMR 1332 BFP, INRA, Univ. Bordeaux, 33882 Villenave d’Ornon, Cedex France; 2Agro Innovation International - Centre Mondial

7

d'Innovation - Groupe Roullier, 35400 St Malo, France; 3The Sainsbury Laboratory, University of Cambridge, Cambridge CB2 1LR,

8

United Kingdom; 4 Universidad Politécnica de Cartagena, Cartagena, Spain; 5 Universidad de Murcia, Murcia, Spain; 6Current address:

9

Department of Plant Developmental Biology, Max Planck Institute for Plant Breeding Research, 50829 Cologne, Germany; 7Leibniz-

10

Institute für Gemüse- und Zierpflanzenbau (IGZ), Plant Adaptation, Grossbeeren, Germany

11

#Corresponding authors: [email protected]; [email protected]

12 13 14

SUMMARY 15 16

● Bud dormancy is a crucial stage in perennial trees and allows survival over winter to ensure 17

optimal flowering and fruit production. Recent work highlighted physiological and molecular 18

events occurring during bud dormancy in trees and we aimed to further explore the global 19

transcriptional changes happening throughout dormancy progression.

20

● Using next-generation sequencing and modelling, we conducted an in-depth transcriptomic 21

analysis for all stages of flower buds in sweet cherry (Prunus avium L.) cultivars displaying 22

contrasted stages of bud dormancy.

23

● We observed that buds in organogenesis, paradormancy, endodormancy and ecodormancy 24

stages are characterised by specific transcriptional states, associated with different pathways.

25

We further identified that endodormancy can be separated in several phases based on the 26

transcriptomic state. We also found that transcriptional profiles of just seven genes are enough 27

to predict the main cherry tree flower bud dormancy stages.

28

● Our results indicate that transcriptional changes happening during dormancy are robust and 29

conserved between different sweet cherry cultivars. Our work also sets the stage for the 30

development of a fast and cost effective diagnostic tool to molecularly define the flower bud 31

stages in cherry trees.

32 33

KEY WORDS: Transcriptomic, RNA sequencing, time course, Prunus avium L., prediction, seasonal 34

timing 35

36

(3)

INTRODUCTION 37

38

Temperate trees face a wide range of environmental conditions including highly contrasted 39

seasonal changes. Among the strategies to enhance survival under unfavourable climatic conditions, 40

bud dormancy is crucial for perennial plants since its progression over winter is determinant for 41

optimal growth, flowering and fruit production during the subsequent season. Bud dormancy has long 42

been compared to an unresponsive physiological phase, in which metabolic processes within the buds 43

are halted by cold temperature. However, several studies have shown that bud dormancy progression 44

can be affected in a complex way by temperature and photoperiod (Heide & Prestrud, 2005; Allona et 45

al., 2008; Olsen, 2010; Cooke et al., 2012; Maurya et al., 2018). Bud dormancy has traditionally been 46

separated into three main phases: (i) paradormancy, also named “summer dormancy” (Cline &

47

Deppong, 1999); (ii) endodormancy, mostly triggered by internal factors; and (iii) ecodormancy, 48

controlled by external factors (Lang et al., 1987; Considine & Considine, 2016). Progression through 49

endodormancy requires cold accumulation whereas warmer temperatures, i.e. heat accumulation, drive 50

the competence to resume growth over the ecodormancy phase. Dormancy is thus highly dependent 51

on external temperatures, and changes in seasonal timing of bud break and blooming have been 52

reported in relation with global warming. Notably, advances in bud break and blooming dates in spring 53

have been observed in the northern hemisphere, thus increasing the risk of late frost damages (Badeck 54

et al., 2004; Menzel et al., 2006; Vitasse et al., 2014; Fu et al., 2015; Bigler & Bugmann, 2018) while 55

insufficient cold accumulation during winter may lead to incomplete dormancy release associated with 56

bud break delay and low bud break rate (Erez, 2000; Atkinson et al., 2013). These phenological 57

changes directly impact the production of fruit crops, leading to large potential economic losses 58

(Snyder & de Melo-abreu, 2005). Consequently, it becomes urgent to acquire a better understanding 59

of bud responses to temperature stimuli in the context of climate change in order to tackle fruit losses 60

and anticipate future production changes.

61

In the recent years, an increasing number of studies have investigated the physiological and molecular 62

mechanisms of bud dormancy transitions in perennials using RNA sequencing technology, thereby 63

giving a new insight into potential pathways involved in dormancy. The results suggest that the 64

transitions between the three main bud dormancy phases (para-, endo- and eco- dormancy) are 65

mediated by pathways related to phytohormones (Zhong et al., 2013; Chao et al., 2017; Khalil-Ur- 66

Rehman et al., 2017; Zhang et al., 2018), carbohydrates (Min et al., 2017; Zhang et al., 2018), 67

temperature (Ueno et al., 2013; Paul et al., 2014), photoperiod (Lesur et al., 2015), reactive oxygen 68

species (Takemura et al., 2015; Zhu et al., 2015), water deprivation (Lesur et al., 2015), cold 69

acclimation and epigenetic regulation (Kumar et al., 2016). Owing to these studies, a better

70

(4)

understanding of bud dormancy has been established in different perennial species (see for example, 71

the recent reviews (Beauvieux et al., 2018; Lloret et al., 2018; Falavigna et al., 2019). However we 72

are still missing a fine-resolution temporal understanding of transcriptomic changes happening over 73

the entire bud development, from bud organogenesis to bud break.

74

Indeed, the small number of sampling dates in existing studies seems to be insufficient to capture all 75

the information about changes occurring throughout the dormancy cycle as it most likely corresponds 76

to a chain of biological events rather than an on/off mechanism. Many unresolved questions remain:

77

What are the fine-resolution dynamics of gene expression related to dormancy? Are specific sets of 78

genes associated with dormancy stages? Since the timing for the response to environmental cues is 79

cultivar-dependant (Campoy et al., 2011; Wenden et al., 2017), are transcriptomic profiles during 80

dormancy different in cultivars with contrasted flowering date?

81

To explore these mechanisms, we conducted a transcriptomic analysis of sweet cherry (Prunus 82

avium L.) flower buds from bud organogenesis until the end of bud dormancy using next-generation 83

sequencing. Sweet cherry is a perennial species highly sensitive to temperature (Heide, 2008) and we 84

focused on three sweet cherry cultivars displaying contrasted flowering dates and response to 85

environmental conditions. We carried out a fine-resolution time-course spanning the entire bud 86

development, from flower organogenesis in July to spring in the following year when flowering occurs, 87

encompassing para-, enco- and ecodormancy phases. Our results indicate that transcriptional changes 88

happening during dormancy are conserved between different sweet cherry cultivars, opening the way 89

to the identification of key factors involved in the progression through bud dormancy.

90 91

MATERIAL AND METHODS 92

93

Plant material 94

Branches and flower buds were collected from four different sweet cherry cultivars with contrasted 95

flowering dates: ‘Cristobalina’, ‘Garnet’, ‘Regina’ and ‘Fertard’, which display extra-early, early, late 96

and very late flowering dates, respectively. ‘Cristobalina’, ‘Garnet’, ‘Regina’ trees were grown in an 97

orchard located at the Fruit Experimental Unit of INRA in Bourran (South West of France, 44° 19′ 56′′

98

N, 0° 24′ 47′′ E), under the same agricultural practices. ‘Fertard’ trees were grown in a nearby orchard 99

at the Fruit Experimental Unit of INRA in Toulenne, near Bordeaux (48° 51′ 46′′ N, 2° 17′ 15′′ E).

100

During the first sampling season (2015/2016), ten or eleven dates spanning the entire period from 101

flower bud organogenesis (July 2015) to bud break (March 2016) were chosen for RNA sequencing 102

(Table S1; Fig. 1a), while bud tissues from ‘Fertard’ were sampled in 2015/2016 (12 dates) and 103

2017/2018 (7 dates) for validation by qRT-PCR (Table S1). For each date, flower buds were sampled

104

(5)

from different trees, each tree corresponding to a biological replicate. Upon harvesting, buds were 105

flash frozen in liquid nitrogen and stored at -80°C prior to performing RNA-seq.

106

107

Measurements of bud break and estimation of the dormancy release date 108

For the two sampling seasons, 2015/2016 and 2017/2018, three branches bearing floral buds were 109

randomly chosen fortnightly from ‘Cristobalina’, ‘Garnet’, ‘Regina’ and ‘Fertard’ trees, between 110

November and flowering time (March-April). Branches were incubated in water pots placed under 111

forcing conditions in a growth chamber (25°C, 16h light/ 8h dark, 60-70% humidity). The water was 112

replaced every 3-4 days. After ten days under forcing conditions, the total number of flower buds that 113

reached the BBCH stage 53 (Meier, 2001; Fadón et al., 2015) was recorded. The date of dormancy 114

release was estimated as the date when the percentage of buds at BBCH stage 53 was above 50% after 115

ten days under forcing conditions (Fig. 1a).

116 117

RNA extraction and library preparation 118

Fig 1 Dormancy status under environmental conditions and RNA-seq sampling dates

(a) Evaluation of bud break percentage under forcing conditions was carried out for three sweet cherry

cultivars displaying different flowering dates in ‘Cristobalina’, ‘Garnet’ and ‘Regina’ for the early, medium

and late cultivar, respectively. The coloured dotted line corresponds to the dormancy release date, estimated

at 50% of buds at BBCH stage 53 (Meier, 2001). (b) Pictures of the sweet cherry buds corresponding to the

different sampling dates. (c) Sampling time points for the transcriptomic analysis are represented by

coloured stars. Red for ‘Cristobalina, green for ‘Garnet’ and blue for ‘Regina’.

(6)

Total RNA was extracted from 50-60 mg of frozen and pulverised flower buds using RNeasy Plant 119

Mini kit (Qiagen) with minor modification: 1.5% PVP-40 was added in the extraction buffer RLT.

120

RNA quality was evaluated using Tapestation 4200 (Agilent Genomics). Library preparation was 121

performed on 1 μg of high quality RNA (RNA integrity number equivalent superior or equivalent to 122

8.5) using the TruSeq Stranded mRNA Library Prep Kit High Throughput (Illumina cat. no. RS-122- 123

2103) for ‘Cristobalina’, ‘Garnet’ and ‘Regina’ cultivars. DNA quality from libraries was evaluated 124

using Tapestation 4200. The libraries were sequenced on a NextSeq500 (Illumina), at the Sainsbury 125

Laboratory Cambridge University (SLCU), using paired-end sequencing of 75 bp in length.

126 127

Mapping and differential expression analysis 128

The raw reads obtained from the sequencing were analysed using several publicly available software 129

and in-house scripts. The quality of reads was assessed using FastQC 130

(www.bioinformatics.babraham.ac.uk/projects/fastqc/) and possible adaptor contaminations and low 131

quality trailing sequences were removed using Trimmomatic (Bolger et al., 2014). Trimmed reads 132

were mapped to the peach (Prunus persica (L) Batsch) reference genome v.2 (Verde et al., 2017) using 133

Tophat (Trapnell et al., 2009). Possible optical duplicates were removed using Picard tools 134

(https://github.com/broadinstitute/picard). The total number of mapped reads of each samples are 135

given in Table S2. For each gene, raw read counts and TPM (Transcripts Per Million) numbers were 136

calculated (Wagner, 2003).

137

We performed a differential expression analysis on data obtained from the ‘Garnet’ samples. First, 138

data were filtered by removing lowly expressed genes (average read count < 3), genes not expressed 139

in most samples (read counts = 0 in more than 75% of the samples) and genes presenting little ratio 140

change (coefficient of variation < 0.3). Then, differentially expressed genes (DEGs) between bud 141

stages (organogenesis – 6 biological replicates, paradormancy – 3 biological replicates, endodormancy 142

– 10 biological replicates, dormancy breaking – 6 biological replicates, ecodormancy – 6 biological 143

replicates, see Table S1) were assessed using DEseq2 R Bioconductor package (Love et al., 2014), in 144

the statistical software R (R Core Team 2018), on filtered data. Genes with an adjusted p-value (padj) 145

< 0.05 were assigned as DEGs (Table S3). To enable researchers to access this resource, we have 146

created a graphical web interface to allow easy visualisation of transcriptional profiles throughout 147

flower bud dormancy in the three cultivars for genes of interest (bwenden.shinyapps.io/DorPatterns/).

148 149

Principal component analyses and hierarchical clustering 150

Distances between the DEGs expression patterns over the time course were calculated based on 151

Pearson’s correlation on ‘Garnet’ TPM values. We applied a hierarchical clustering analysis on the

152

(7)

distance matrix to define ten clusters (Table S3). For expression patterns representation, we normalized 153

the data using z-score for each gene:

154

𝑧 𝑠𝑐𝑜𝑟𝑒 = (𝑇𝑃𝑀 − 𝑚𝑒𝑎𝑛 ) 𝑆𝑡𝑎𝑛𝑑𝑎𝑟𝑑 𝐷𝑒𝑣𝑖𝑎𝑡𝑖𝑜𝑛 155

where TPM

ij

is the TPM value of the gene i in the sample j, mean

i

and standard deviation

i

are the mean 156

and standard deviation of the TPM values for the gene i over all samples.

157

Principal component analyses (PCA) were performed on TPM values from different datasets using the 158

prcomp function from R.

159

For each cluster, using data for ‘Garnet’, ‘Regina’ and ‘Cristobalina’, mean expression pattern was 160

calculated as the mean z-score value for all genes belonging to the cluster. We then calculated the 161

Pearson’s correlation between the z-score values for each gene and the mean z-score for each cluster.

162

We defined the marker genes as genes with the highest correlation values, i.e. genes that represent the 163

best the average pattern of the clusters. Keeping in mind that the marker genes should be easy to 164

handle, we then selected the optimal marker genes displaying high expression levels while not 165

belonging to extended protein families.

166 167

Motif and transcription factor targets enrichment analysis 168

We performed enrichment analysis on the DEG in the different clusters for transcription factor targets 169

genes and target motifs.

170

Motif discovery on the DEG set was performed using Find Individual Motif occurrences (FIMO) 171

(Grant et al., 2011). Motif list available for peach was obtained from PlantTFDB 4.0 (Jin et al., 2017).

172

To calculate the overrepresentation of motifs, DEGs were grouped by motif (grouping several genes 173

and transcripts in which the motif was found). Overrepresentation of motifs was performed using 174

hypergeometric tests using Hypergeometric {stats} available in R. Comparison was performed for the 175

number of appearances of a motif in one cluster against the number of appearances on the overall set 176

of DEG. As multiple testing implies the increment of false positives, p-values obtained were corrected 177

using False Discovery Rate (Benjamini & Hochberg, 1995) correction method using p.adjust{stats}

178

function available in R.

179

A list of predicted regulation between transcription factors and target genes is available for peach in 180

PlantTFDB (Jin et al., 2017). We collected the list and used it to analyse the overrepresentation of 181

genes targeted by TF, using Hypergeometric {stats} available in R, comparing the number of 182

appearances of a gene controlled by one TF in one cluster against the number of appearances on the 183

overall set of DEG. p-values obtained were corrected using a false discovery rate as described above.

184

Predicted gene homology to Arabidopsis thaliana and functions were retrieved from the data files

185

(8)

available for Prunus persica (GDR, 186

https://www.rosaceae.org/species/prunus_persica/genome_v2.0.a1).

187 188

GO enrichment analysis 189

The list for the gene ontology (GO) terms was retrieved from the database resource PlantRegMap (Jin 190

et al., 2017). Using the topGO package (Alexa & Rahnenführer, 2018), we performed an enrichment 191

analysis on GO terms for biological processes, cellular components and molecular functions based on 192

a classic Fisher algorithm. Enriched GO terms were filtered with a p-value < 0.005 and the ten GO 193

terms with the lowest p-value were selected for representation.

194 195

Marker genes qRT-PCR analyses 196

cDNA was synthetised from 1µg of total RNA using the iscript Reverse Transcriptase Kit (Bio-rad 197

Cat no 1708891) in 20 µl of final volume. 2 µL of cDNA diluted to a third was used to perform the 198

qPCR in a 20 µL total reaction volume. qPCRs were performed using a Roche LightCycler 480. Three 199

biological replicates for each sample were performed. Primers used in this study for qPCR are:

200

PavCSLG3 F: CCAACCAACAAAGTTGACGA , R: CAACTCCCCCAAAAAGATGA ; PavMEE9:

201

F: CTGCAGCTGAACTGGAACAG , R: ACTCATCCATGGCACTCTCC ; PavSRP:

202

F: ACAGGATCTGGAAAGCCAAG , R: AGGGTGGCTCTGAAACACAG ; PavTCX2:

203

F: CTTCCCACAACGCCTTTACG , R: GGCTATGTCTCTCAAACTTGGA ; PavGH127:

204

F: GCCATTGGTTGTAGGGTTTG , R: ATCCCATTCAGCATTCGTTC; PavUDP-GALT1 205

F: CAATGTTGCTGGAAACCTCA , R: GTTATTCCACATCCGACAGC ; PavPP2C 206

F: CTGTGCCTGAAGTGACACAGA , R: CTGCACTGCTTCTTGATTTG ; PavRPII 207

F: TGAAGCATACACCTATGATGATGAAG , R: CTTTGACAGCACCAGTAGATTCC ; PavEF1 208

F: CCCTTCGACTTCCACTTCAG , R: CACAAGCATACCAGGCTTCA . Primers were tested for non-specific 209

products previously by separation on 1.5% agarose gel electrophoresis and by sequencing each 210

amplicon. Realtime data were analyzed using custom R scripts. Expression was estimated for each 211

gene in each sample using a cDNA standard curve. For the visualization of the marker genes’ relative 212

expression, we normalized the qRT-PCR results for each marker gene by the average qRT-PCR data 213

for the reference genes PavRPII and PavEF1.

214 215

Bud stage predictive modelling 216

In order to predict the bud stage based on the marker genes transcriptomic data, we used TPM values 217

for the marker genes to train a multinomial logistic regression. First, all samples were projected into a 218

2-dimensional space using PCA, to transform potentially correlated data to an orthogonal space. The

219

(9)

new coordinates were used to train and test the model to predict the five bud stage categories, using 220

the LogisticRegressionCV function from the scikit-learn Python package (Pedregosa et al., 2011). The 221

model was 4-fold cross-validated to ensure the robustness of the coefficients and to reduce overfitting.

222

The model accuracy was calculated as the percentage of correct predicted stages in the RNA-seq 223

testing set. In addition, we tested the model on qRT-PCR data for ‘Fertard’ samples. For the modelling 224

purposes, expression data for the seven marker genes were normalized by the expression 225

corresponding to the October sample. We chose the date of October as the reference because it 226

corresponds to the beginning of dormancy and it was available for all cultivars. For each date, the 227

October-normalized expression values of the seven marker genes were projected in the PCA 2- 228

dimension plan calculated for the RNA-seq data and they were tested against the model trained on 229

‘Cristobalina’, ‘Garnet’ and ‘Regina’ RNA-seq data.

230 231

RESULTS 232

233

Transcriptome accurately captures the dormancy state 234

In order to define transcriptional changes happening over the sweet cherry flower bud 235

development, we performed a transcriptomic-wide analysis using next-generation sequencing from 236

bud organogenesis to flowering. According to bud break percentage (Fig. 1a), morphological 237

observations (Fig. 1b), average temperatures (Fig. S1) and descriptions from Lang et al., (1987), we 238

assigned five main stages to the early flowering cultivar ‘Garnet’ flower buds samples (Fig. 1b): i) 239

flower bud organogenesis occurs in July and August, ii) paradormancy corresponds to the period of 240

growth cessation in September, iii) during the endodormancy phase, initiated in October, buds are 241

unresponsive to forcing conditions therefore the increasing bud break percentage under forcing 242

conditions suggests that endodormancy was released on January 29th, 2016, thus corresponding to iv) 243

dormancy breaking, and v) ecodormancy starting from the estimated dormancy release date until 244

flowering.

245

We identified 6,683 genes that are differentially expressed (DEGs) between the defined bud 246

stages for the sweet cherry cultivar ‘Garnet’ (Table S3). When projected into a two-dimensional space 247

(Principal Component Analysis, PCA), data for these DEGs show that transcriptomes of samples 248

harvested at a given date are projected together (Fig. 2), showing the high quality of the biological 249

replicates and that different trees are in a very similar transcriptional state at the same date. Very 250

interestingly, we also observe that flower bud states are clearly separated on the PCA, with the 251

exception of organogenesis and paradormancy, which are projected together (Fig. 2). The first 252

dimension of the analysis (PC1) explains 41,63% of the variance and clearly represents the strength of

253

(10)

bud dormancy where samples on the right of the axis are in endodormancy or dormancy breaking 254

stages. The second dimension of the analysis (PC2) explains 20.24% of the variance and distinguishes 255

two main phases of the bud development: before and after dormancy breaking. We obtain very similar 256

results when performing the PCA on all genes (Fig. S2). These results indicate that the transcriptional 257

state of DEGs accurately captures the dormancy state of flower buds.

258

259

Bud stage-dependent transcriptional activation and repression are associated with different 260

pathways 261

We further investigated whether specific genes or signalling pathways could be associated with 262

the different flower bud stages. Indeed, the expression of genes grouped in ten clusters clearly shows 263

distinct expression profiles throughout the bud development (Fig. 3). Overall, three main types of 264

clusters can be discriminated: the ones with a maximum expression level during organogenesis and 265

paradormancy (cluster 1: 1,549 genes; cluster 2: 70 genes; cluster 3: 113 genes; cluster 4: 884 genes 266

and cluster 10: 739 genes, Fig. 3), the clusters with a maximum expression level during endodormancy 267

and around the time of dormancy breaking (cluster 5: 156 genes; cluster 6: 989 genes ; cluster 7: 648 268

genes and cluster 8: 612 genes, Fig. 3), and finally the clusters with a maximum expression level during 269

ecodormancy (cluster 9: 924 genes and cluster 10, Fig. 3). This result shows that different groups of 270

genes are associated with these three main flower bud phases. Interestingly, we also observed that, 271

during the endodormancy phase, some genes are expressed in October and November then repressed 272

Fig 2 Separation of samples by dormancy stage using differentially expressed genes

The principal component analysis was conducted on the TPM (transcripts per millions reads) values for the

differentially expressed genes in the cultivar ‘Garnet’ flower buds, sampled on three trees between July and

March.

(11)

in December (cluster 4, Fig. 3), whereas another group of genes is expressed in December (clusters 8, 273

5, 6 and 7, Fig. 3) therefore separating endodormancy in two distinct phases.

274

In order to explore the functions and pathways associated with the gene clusters, we performed 275

a GO enrichment analysis (Fig. 4, Fig. S3). GO terms associated with the response to stress as well as 276

biotic and abiotic stimuli were enriched in the clusters 2, 3 and 4, with genes mainly expressed during 277

organogenesis and paradormancy. During endodormancy (cluster 5), an enrichment for genes involved 278

in response to nitrate and nitrogen compounds was spotted. On the opposite, at the end of the 279

endodormancy phase (cluster 6, 7 and 8), we highlighted different enrichments in GO terms linked to 280

basic metabolisms such as nucleic acid metabolic processes or DNA replication but also to response 281

to alcohol and abscisic acid. Finally, during ecodormancy, genes in cluster 9 and 10 are enriched in 282

functions associated with transport, cell wall biogenesis as well as oxidation-reduction processes (Fig.

283

Fig 3 Clusters of expression patterns for differentially expressed genes in the sweet cherry cultivar

‘Garnet’

Heatmap for ‘Garnet’ differentially expressed genes during bud development. Each column corresponds to the gene expression for flower buds from one single tree at a given date. Clusters are ordered based on the chronology of the expression peak (from earliest – July, 1-dark green cluster – to latest – March, 9 and 10).

Expression values were normalized and z-scores are represented here.

(12)

4, Fig. S3). These results show that different functions and pathways are specific to flower bud 284

development stages.

285

Fig 4 Enrichments in gene ontology terms for biological processes and average expression patterns in the different clusters in the sweet cherry cultivar ‘Garnet’

(a) Using the topGO package (Alexa & Rahnenführer, 2018), we performed an enrichment analysis on GO

terms for biological processes based on a classic Fisher algorithm. Enriched GO terms with the lowest p-

value were selected for representation. Dot size represent the number of genes belonging to the clusters

associated with the GO term. (b) Average z-score values for each cluster. The coloured dotted line

corresponds to the estimated date of dormancy release.

(13)

Table 1. Enrichment in transcription factor targets in the different clusters 286

Based on the gene regulation information available for peach in PlantTFDB (Jin et al., 2017), overrepresentation of genes targeted by transcription factors was 287

performed using hypergeometric tests. p-values obtained were corrected using a false discovery rate: (***): adj. p-value < 0.001; (**): adj. p-value < 0.01; (*):

288

adj. p-value < 0.05.

289

Gene Name gene id Transcription Factor Cluster

Predicted TF

family Arabidopsis

homologous Predicted function Enrichment

p value

Enrichment adjusted p value

1 - Dark green

PavMYB63 Prupe.4G136300 1 - Dark green MYB AT1G79180 Myb-related protein 2,1E-05 6,7E-03 (**)

PavMYB93 Prupe.6G188300 1 - Dark green MYB AT1G34670 Myb-related protein 9,0E-04 3,2E-02 (*)

PavMYB40 Prupe.3G299000 8 - royal blue MYB AT5G14340 Myb-related protein 2,7E-04 1,7E-02 (*)

PavMYB17 Prupe.2G164300 - MYB AT3G61250 Myb-related protein 6,8E-05 7,2E-03 (**)

PavMYB94 Prupe.5G193200 - MYB AT3G47600 Myb-related protein 9,0E-05 7,2E-03 (**)

PavMYB60 Prupe.7G018400 - MYB AT1G08810 Myb-related protein 7,0E-05 7,2E-03 (**)

PavMYB61 Prupe.6G303300 - MYB AT1G09540 Myb-related protein 4,0E-04 2,1E-02 (*)

PavMYB3 Prupe.1G551400 - MYB AT1G22640 Myb-related protein 6,0E-04 2,8E-02 (*)

PavMYB67 Prupe.4G126900 - MYB AT3G12720 Myb-related protein 7,8E-04 3,1E-02 (*)

2 - grey Prupe.1G122800 - CAMTA AT4G16150 Calmodulin-binding transcription activator 3,1E-05 8,0E-03 (**)

3 - pink

PavWRKY40 Prupe.3G098100 3 - pink WRKY AT1G80840 WRKY transcription factor 8,4E-05 1,2E-02 (*)

Prupe.1G122800 - CAMTA AT4G16150 Calmodulin-binding transcription activator 4,9E-09 1,4E-06 (***)

PavWRKY11 Prupe.1G459100 - WRKY AT4G31550 WRKY transcription factor 4,7E-04 4,5E-02 (*)

5 - brown PavCBF4 Prupe.2G289500 - ERF AT5G51990 Dehydration-responsive element-binding protein 2,0E-04 5,7E-02 6 - orange

PavERF110 Prupe.6G165700 8 - royal blue ERF AT5G50080 Ethylene-responsive transcription factor 3,1E-04 5,2E-02 PavRVE8 Prupe.6G242700 8 - royal blue MYB AT3G09600 Homeodomain-like superfamily protein RVE8 4,3E-04 5,2E-02

PavRAP2.12 Prupe.3G032300 ERF AT1G53910 Ethylene-responsive transcription factor 4,9E-04 5,2E-02

8 - royal blue

PavRVE1 Prupe.3G014900 6 - orange MYB AT5G17300 Homeodomain-like superfamily protein RVE1 1,0E-03 3,6E-02 (*)

PavABI5 Prupe.7G112200 7 - red bZIP AT2G36270 ABSCISIC ACID-INSENSITIVE 5 6,6E-05 7,0E-03 (**)

PavABF2 Prupe.1G434500 8 - royal blue bZIP AT1G45249 abscisic acid responsive elements-binding factor 2,4E-06 7,5E-04 (***)

PavAREB3 Prupe.2G056800 - bZIP AT3G56850 ABA-responsive element binding protein 1,4E-05 2,2E-03 (**)

PavPIL5 Prupe.8G209100 - bHLH AT2G20180 phytochrome interacting factor 3-like 5 2,3E-04 1,9E-02 (*)

PavbZIP16 Prupe.5G027000 - bZIP AT2G35530 basic region/leucine zipper transcription factor 4,3E-04 2,7E-02 (*)

PavSPT Prupe.7G131400 - bHLH AT4G36930 Transcription factor SPATULA 5,6E-04 3,0E-02 (*)

PavBPE Prupe.1G263800 - bHLH AT1G59640 Transcription factor BPE 1,0E-03 3,6E-02 (*)

PavPIF4 Prupe.3G179800 - bHLH AT2G43010 phytochrome interacting factor 4 9,5E-04 3,6E-02 (*)

PavGBF3 Prupe.2G182800 - bZIP AT2G46270 G-box binding factor 3 1,1E-03 3,6E-02 (*)

9 - purple PavWRKY50 Prupe.1G407500 - WRKY AT5G26170 WRKY transcription factor 1,1E-04 1,8E-02 (*)

PavWRKY1 Prupe.3G202000 - WRKY AT2G04880 WRKY transcription factor 5,8E-05 1,8E-02 (*)

10 - yellow PavMYB14 Prupe.1G039200 5 - brown MYB AT2G31180 Myb-related protein 1,6E-04 3,9E-02 (*)

PavNAC70 Prupe.8G002500 - NAC AT4G10350 NAC domain containing protein 2,4E-04 3,9E-02 (*)

290

(14)

Specific transcription factor target genes are expressed during the main flower bud stages 291

To better understand the regulation of genes that are expressed at different flower bud stages, 292

we investigated the TFs with enriched targets (Table 1) as well as the enriched target promoter motifs 293

(Table S4) in the different gene clusters. Among the genes expressed during the organogenesis and 294

paradormancy phases (clusters 1, 2, 3 and 4), we observed an enrichment for motifs of several MADS- 295

box TFs such as AGAMOUS (AG), APETALA3 (AP3) and SEPALLATA3/AGAMOUS-like 9 296

(SEP3/AGL9) (Table S4), several of them potentially involved in flower organogenesis (Causier et 297

al., 2010). On the other hand, for the same clusters, results show an enrichment in MYB-related targets, 298

WRKY and ethylene-responsive element (ERF) binding TFs (Table 1, Table S4). Several members of 299

these TF families have been shown to participate in the response to abiotic factors. Similarly, we found 300

in the cluster 4 target motifs enriched for PavDREB2C (Table S4), potentially involved in the response 301

to cold (Lee et al., 2010). Interestingly, we identified an enrichment in the cluster 5 of targets for 302

CBF4, and of genes with motifs for several ethylene-responsive element binding TFs such as 303

PavDREB2C. We also observed an enrichment in the same cluster for genes with motifs for ABI5 304

(Table S4). All these TFs are involved in the response to cold, in agreement with the fact that genes in 305

the cluster 5 are expressed during endodormancy.

306

Genes belonging to the clusters 6, 7 and 8 are highly expressed during deep dormancy and we 307

found targets and target motifs for many TFs involved in the response to abiotic stresses. For example, 308

we found motifs enriched in the cluster 7 for many TFs of the C2H2 family, which is involved in the 309

response of wide spectrum of stress conditions, such as extreme temperatures, salinity, drought or 310

oxidative stress (Table S4, Kiełbowicz-Matuk, 2012; Liu et al., 2015). Similarly, in the cluster 8, we 311

also identified an enrichment in targets and motifs of many genes involved in the response to abscisic 312

acid (ABA) and to abiotic stimulus, such as PavABF2, PavAREB3, PavABI5 and PavDREB2C 313

(Koornneef et al., 1998; Lee et al., 2010). We also observe in this same cluster an enrichment for 314

targets of TFs involved in the response to light and temperature, such as PavPIL5, PavSPT, PavRVE1 315

and PavPIF4 (Table 1, Penfield et al., 2005; Olsen, 2010; Franklin et al., 2011; Doğramacı et al., 316

2014). Interestingly, we found that among the TFs with enriched targets in the clusters, only ten display 317

changes in expression during flower bud development (Table 1, Table S4, Fig. S4), including 318

PavABF2, PavABI5 and PavRVE1. Expression profiles for these three genes are very similar, and are 319

also similar to their target genes, with a peak of expression around the estimated dormancy release 320

date, indicating that these TFs are positively regulating their targets (Fig. S4).

321

Finally, genes belonging to the cluster 10 are expressed during ecodormancy and we find an 322

enrichment for targets of PavMYB14 (Table 1). Expression profiles suggest that PavMYB14 represses 323

expression of its target genes during endodormancy (Fig. S4), consistently with the functions of

324

(15)

Arabidopsis thaliana MYB14 that negatively regulates the response to cold (Chen et al., 2013).

325

Overall, these results show that a small number of TFs specifically regulate target genes during the 326

different flower bud stages.

327

Expression patterns highlight bud dormancy similarities and disparities between three cherry 328

tree cultivars 329

Since temperature changes and progression through the flower bud stages are happening 330

synchronously, it is challenging to discriminate transcriptional changes that are mainly associated with 331

one or the other. In this context, we also analysed the transcriptome of two other sweet cherry cultivars:

332

‘Cristobalina’, characterized by very early flowering dates, and ‘Regina’, with a late flowering time.

333

The span between flowering periods for the three cultivars is also found in the transition between 334

endodormancy and ecodormancy since ten weeks separated the estimated dates of dormancy release 335

between the cultivars: 9th December 2015 for ‘Cristobalina’, 29th January 2016 for ‘Garnet’ and 26th 336

February 2016 for ‘Regina’ (Fig. 1a). The transition from organogenesis to paradormancy is not well 337

documented and many studies suggest that endodormancy onset is under the strict control of 338

environment. Therefore, we considered that these two transitions occurred at the same time in all three 339

cultivars. However, the two months and half difference in the date of transition from endodormancy 340

to ecodormancy between the cultivars allow us to look for transcriptional changes associated with this 341

transition independently of environmental conditions. To do so, we compared the expression patterns 342

Fig 5 Separation of samples by dormancy stage and cultivar using differentially expressed genes The principal component analysis was conducted on the TPM (transcripts per millions reads) values for the differentially expressed genes in the flower buds of the cultivars ‘Cristobalina’ (filled squares), ‘Garnet’

(empty circles) and ‘Regina’ (stars). Each point corresponds to one sampling time in a single tree.

(16)

of the previously identified DEGs between the three contrasted cultivars throughout flower bud stages 343

(Fig. 1b). When projected into a PCA 2-components plane, all samples harvested from buds at the 344

same stage cluster together, whatever the cultivar (Fig. 5), suggesting that the stage of the bud has 345

more impact on the transcriptional state than time or external conditions.

346

Fig 6 Expression patterns in the selected seven clusters for the three cultivars

Expression patterns were analysed from August to March, covering bud organogenesis (O), paradormancy

(P), endodormancy (Endo), and ecodormancy (Eco). Dash lines represent the estimated date of dormancy

breaking, in red for ‘Cristobalina’, green for ‘Garnet’ and blue for ‘Regina’. (a) Average z-score patterns,

calculated from the TPM, for the genes belonging to the seven selected clusters and (b) TPM for the seven

marker genes from clusters 1, 4, 5, 7, 8, 9 and 10. Lines represent the average TPM, dots are the actual

values. SRP: STRESS RESPONSIVE PROTEIN; TCX2: TESMIN/TSO1-like CXC 2; CSLG3: Cellulose

Synthase like G3; GH127: Glycosyl Hydrolase 127; PP2C: Phosphatase 2C; UDP-GalT1: UDP-Galactose

transporter 1; MEE9: maternal effect embryo arrest 9.

(17)

To go further, we compared transcriptional profiles throughout the time course in all cultivars.

347

For this we analysed the expression profiles in each cultivar for the clusters previously identified for 348

the cultivar ‘Garnet’ (Fig. 6). Due to the low number of genes, clusters 2, 3 were not further studied in 349

the three cultivars and we considered that the expression patterns for the genes in cluster 6 were 350

redundant with clusters 5 and 7 therefore we simplified the analysis on seven clusters. In general, 351

averaged expression profiles for all clusters are very similar in all three varieties, with the peak of 352

expression happening at a similar period of the year. However, we can distinguish two main phases 353

according to similarities or disparities between cultivars. First, averaged expression profiles are almost 354

similar in all cultivars between July and November. This is especially the case for clusters 1, 4, 7, 8 355

and 9. On the other hand, we can observe a temporal shift in the peak of expression between varieties 356

from December onward for genes in clusters 1, 5, 8 and 10. Indeed, in these clusters, the peak or drop 357

in expression happens earlier in ‘Cristobalina’, and slightly later in ‘Regina’ compared to ‘Garnet’

358

(Fig. 6), in correlation with their dormancy release dates. These results seem to confirm that the 359

organogenesis and paradormancy phases occur concomitantly in the three cultivars while temporal 360

shifts between cultivars are observed after endodormancy onset. Therefore, similarly to the PCA 361

results (Fig. 5), the expression profile of these genes is more associated with the flower bud stage than 362

with external environmental conditions.

363 364

Flower bud stage can be predicted using a small set of marker genes 365

We have shown that flower buds in organogenesis, paradormancy, endodormancy and 366

ecodormancy are characterised by specific transcriptional states. In theory, we could therefore use 367

transcriptional data to infer the flower bud stage. For this, we selected seven marker genes, for clusters 368

1, 4, 5, 7, 8, 9 and 10, that best represent the average expression profiles of their cluster (Fig. 6).

369

Expression for these marker genes not only recapitulates the average profile of the cluster they 370

originate from, but also temporal shifts in the profiles between the three cultivars (Fig. 6b). In order to 371

define if these genes encompass as much information as the full transcriptome, or all DEGs, we 372

performed a PCA of all samples harvested for all three cultivars using expression levels of these seven 373

markers (Fig. S7). The clustering of samples along the two main axes of the PCA using these seven 374

markers is very similar, if not almost identical, to the PCA results obtained using expression for all 375

DEGs (Fig. 5). This indicates that the transcriptomic data can be reduced to only seven genes and still 376

provides accurate information about the flower bud stages.

377

To test if these seven markers can be used to define the flower bud stage, we used a multinomial 378

logistic regression modelling approach to predict the flower bud stage in our dataset based on the 379

expression levels for these seven genes (Fig. 7 and Fig. S8). We obtain a very high model accuracy

380

(18)

(100%) when the training and testing sets are randomly picked. These results indicate that the bud 381

stage can be accurately predicted based on expression data by just using seven genes. In order to go 382

further and test the model in an independent experiment, we analysed the expression for the seven 383

marker genes by RT-qPCR on buds sampled from another sweet cherry tree cultivar ‘Fertard’ for two 384

consecutive years (Fig. 7a). We achieved a high accuracy of 71% for our model when tested on RT- 385

qPCR data to predict the flower bud stage for the ‘Fertard’ cultivar (Fig. 7c and Fig. S8c). In particular, 386

the chronology of bud stages was very well predicted. This result indicates that these seven genes can 387

be used as a diagnostic tool in order to infer the flower bud stage in sweet cherry trees.

388

Figure 7. Expression for the seven marker genes allows accurate prediction of the bud dormancy stages in the late flowering cultivar ‘Fertard’ during two bud dormancy cycles

(a) Relative expressions were obtained by qRT-PCR and normalized by the expression of two reference constitutively expressed genes PavRPII and PavEF1. (b) Evaluation of the dormancy status in ‘Fertard’

flower buds during the two seasons using the percentage of open flower buds (BBCH stage 53). (c) Predicted

vs experimentally estimated bud stages. SRP: STRESS RESPONSIVE PROTEIN; TCX2: TESMIN/TSO1-

like CXC 2; CSLG3: Cellulose Synthase like G3; GH127: Glycosyl Hydrolase 127; PP2C: Phosphatase

2C; UDP-GalT1: UDP-Galactose transporter 1; MEE9: maternal effect embryo arrest 9.

(19)

Discussion 389

In this work, we have characterised transcriptional changes at a genome-wide scale happening 390

throughout cherry tree flower bud dormancy, from organogenesis to the end of dormancy. To do this, 391

we have analysed expression in flower buds at 11 dates from July 2015 to March 2016 for three 392

cultivars displaying different dates of dormancy release, generating 82 transcriptomes in total. This 393

resource, with a fine time resolution, reveals key aspects of the regulation of cherry tree flower buds 394

during dormancy (Fig. 8). We have shown that buds in organogenesis, paradormancy, endodormancy 395

and ecodormancy are characterised by distinct transcriptional states (Fig. 2, 3) and we highlighted the 396

different pathways activated during the main cherry tree flower bud dormancy stages (Fig. 4 and Table 397

1). Finally, we found that just seven genes are enough to accurately predict the main cherry tree flower 398

bud dormancy stages (Fig. 6, 7).

399

Figure 8. From bud formation to flowering: transcriptomic regulation of flower bud dormancy

Our results highlighted seven main expression patterns corresponding to the main dormancy stages. During

organogenesis and paradormancy (July to September), signalling pathways associated with flower

organogenesis and ABA signalling are upregulated. Distinct groups of genes are activated during different

phases of endodormancy, including targets of transcription factors involved in ABA signalling, cold response

and circadian clock. ABA: abscisic acid.

(20)

Global lessons from transcriptomic data on the definition of flower bud dormancy stages 400

Our results show that buds in organogenesis, paradormancy, endodormancy and ecodormancy 401

are characterised by distinct transcriptional states. This result is further supported by the fact that we 402

detected different groups of genes that are specifically expressed at these bud stages (Fig. 3).

403

Specifically, we found that the transcriptional states of flower buds during endodormancy and 404

ecodormancy are very different, indicating that different pathways are involved in these two types of 405

dormancy. This is further supporting previous observations that buds remain in endodormancy and 406

ecodormancy states under the control of different regulation pathways. Indeed, ecodormancy is under 407

the control of external signals and can therefore be reversed by exposure to growth-promotive signals 408

(Lang et al., 1987). On the opposite, endogenous signals control endodormancy onset and maintenance 409

and a complex array of signalling pathways seem to be involved in the response to cold temperatures 410

that subsequently leads to dormancy breaking (see for example Ophir et al., 2009; Horvath, 2009;

411

Considine & Considine, 2016; Singh et al., 2016; Lloret et al., 2018; Falavigna et al., 2019).

412

Another interesting observation is the fact that samples harvested during endodormancy can be 413

separated into two groups based on their transcriptional state: early endodormancy (October and 414

November), and late endodormancy (from December to dormancy breaking). These two groups of 415

samples are forming two distinct clusters in the PCA (Fig. 5), and are associated with different groups 416

of expressed genes. These results indicate that endodormancy could potentially be separated into two 417

periods: early and late endodormancy. However, we have to keep in mind that cold temperatures, 418

below 10°C, only started at the end of November. It is thus difficult to discriminate between 419

transcriptional changes associated with a difference in the bud stage during endodormancy, an effect 420

of the pronounced change in temperatures, or a combination of both. Alternative experiments under 421

controlled environments, similarly to studies conducted on hybrid aspen for example (Ruttink et al., 422

2007), could improve our knowledge on the different levels of endodormancy.

423

We also show that we can accurately predict the different bud stages using expression levels 424

for only seven marker genes (Fig. 7). This suggests that the definition of the different bud stages based 425

on physiological observation is consistent with transcriptomic profiles. However, we could detect 426

substantial discrepancies suggesting that the definition of the bud stages can be improved. Indeed, we 427

observe that samples harvested from buds during phases that we defined as organogenesis and 428

paradormancy cluster together in the PCA, but away from samples harvested during endodormancy.

429

Moreover, most of the genes highly expressed during paradormancy are also highly expressed during 430

organogenesis. This is further supported by the fact that paradormancy is a flower bud stage predicted 431

with less accuracy based on expression level of the seven marker genes. In details, paradormancy is 432

defined as a stage of growth inhibition originating from surrounding organs (Lang et al., 1987)

433

(21)

therefore it is strongly dependant on the position of the buds within the tree and the branch. Our results 434

suggest that defining paradormancy for multiple cherry flower buds based on transcriptomic data is 435

difficult and even raise the question of whether paradormancy can be considered as a specific flower 436

bud stage. Alternatively, we propose that the pre-dormancy period should rather be defined as a 437

continuum between organogenesis, growth and/or growth cessation phases. Further physiological 438

observations, including flower primordia developmental context (Fadón et al., 2015), could provide 439

crucial information to precisely link the transcriptomic environment to these bud stages.

440 441

Highlight on main functions enriched during dormancy: organogenesis, response to cold, to ABA 442

and to the circadian clock 443

We determined different functions and pathways enriched during flower bud organogenesis, 444

paradormancy, endodormancy and ecodormancy. We notably observe an enrichment for GO involved 445

in the response to abiotic and biotic responses, as well as an enrichment for targets of many TFs 446

involved in the response to environmental factors. In particular, our results suggest that PavMYB14, 447

which has a peak of expression in November just before the cold period starts, is repressing genes that 448

are expressed during ecodormancy. This is in agreement with the fact that AtMYB14, the PavMYB14 449

homolog in Arabidopsis thaliana, is involved in cold stress response regulation (Chen et al., 2013).

450

Although these results were not confirmed in Populus (Howe et al., 2015), two MYB DOMAIN 451

PROTEIN genes (MYB4 and MYB14) were up-regulated during the induction phase of dormancy in 452

grapevine (Fennell et al., 2015). Similarly, we identified an enrichment in target motifs for a 453

transcription factor belonging to the C-REPEAT/DRE BINDING FACTOR 2/DEHYDRATION 454

RESPONSE ELEMENT-BINDING PROTEIN (CBF/DREB) family in genes highly expressed during 455

endodormancy. These TFs have previously been implicated in cold acclimation and endodormancy in 456

several perennial species (Doǧramaci et al., 2010; Leida et al., 2012). These results are in agreement 457

with the previous observation showing that genes responding to cold are differentially expressed 458

during dormancy in other tree species (Ueno et al., 2013). Interestingly, we also identified an 459

enrichment in targets for four TFs involved in ABA-dependent signalling. First, PavWRKY40 is mostly 460

expressed during organogenesis, and its expression profile is very similar to the one of its target genes.

461

Several studies have highlighted a role of PavWRKY40 homolog in Arabidopsis in ABA signalling, in 462

relation with light transduction (Liu et al., 2013; Geilen & Böhmer, 2015) and biotic stresses (Pandey 463

et al., 2010). On the other hand, PavABI5 and PavABF2 are mainly expressed around the time of 464

dormancy release, like their target, and their homologs in Arabidopsis are involved in key ABA 465

processes, especially during seed dormancy (Lopez-Molina et al., 2002). These results are further 466

confirmed by the enrichment of GO terms related to ABA pathway found in the genes highly expressed

467

(22)

during endodormancy. Our observations suggest that genes potentially linked to ABA signalling are 468

expressed either during organogenesis or during dormancy release. These results are supported by 469

previous reports where genes involved in ABA signalling are differentially expressed during dormancy 470

in other tree species (Ruttink et al., 2007; Ueno et al., 2013; Zhong et al., 2013; Khalil-Ur-Rehman et 471

al., 2017; Zhang et al., 2018). It has also been shown that genes involved in other phytohormones 472

pathways, including auxin, ethylene, gibberellin and jasmonic acid, are differentially expressed 473

between bud stages in other perennial species (Zhong et al., 2013; Khalil-Ur-Rehman et al., 2017).

474

This is in agreement with our observation of an enrichment for GO terms for the response to jasmonic 475

acid, and of targets of TFs involved in the response to ethylene, in genes specifically expressed at 476

different flower bud stages.

477

In addition, we also identified an enrichment of targets for PavRVE8 and PavRVE1 among the genes 478

expressed around the time of dormancy release. These TFs are homologs of Arabidopsis MYB 479

transcription factors involved in the circadian clock. In particular, AtRVE1 seems to integrate several 480

signalling pathways including cold acclimation and auxin (Rawat et al., 2009; Meissner et al., 2013;

481

Jiang et al., 2016) while AtRVE8 is involved in the regulation of circadian clock by modulating the 482

pattern of H3 acetylation (Farinas & Mas, 2011). Our findings that genes involved in the circadian 483

clock are expressed and potentially regulate genes at the time of dormancy release are in agreement 484

with previous work indicating a role of the circadian clock in dormancy in poplar (Ibáñez et al., 2010).

485

To our knowledge, this is the first report on the transcriptional regulation of early stages of flower bud 486

development. We highlighted the upregulation of several pathways linked to organogenesis during the 487

summer months, including PavMYB63 and PavMYB93, expressed during early organogenesis, along 488

their targets, with potential roles in the secondary wall formation (Zhou et al., 2009) and root 489

development (Gibbs et al., 2014).

490 491

Development of a diagnostic tool to define the flower bud dormancy stage using seven genes 492

We find that sweet cherry flower bud stage can be accurately predicted with the expression of 493

just seven genes. It indicates that combining expression profiles of just seven genes is enough to 494

recapitulate all transcriptional states in our study. This is in agreement with previous work showing 495

that transcriptomic states can be accurately predicted using a relatively low number of markers (Biswas 496

et al., 2017). Interestingly, when there are discrepancies between the predicted bud stages and the ones 497

defined by physiological observations, the model always predicts that stages happen earlier than the 498

actual observations. For example, the model predicts that dormancy breaking occurs instead of 499

endodormancy, or ecodormancy instead of dormancy breaking. This could suggest that transcriptional 500

changes happen before we can observe physiological changes. This is indeed consistent with the

501

(23)

indirect phenotyping method currently used, based on the observation of the response to growth- 502

inducible conditions after ten days. Using these seven genes to predict the flower bud stage would thus 503

potentially allow to identify these important transitions when they actually happen.

504

We also show that the expression level of these seven genes can be used to predict the flower bud stage 505

in other conditions by performing RT-qPCR. This independent experiment has also been done on two 506

consecutive years and shows that RT-qPCR for these seven marker genes as well as two control genes 507

are enough to predict the flower bud stage in cherry trees. It shows that performing a full transcriptomic 508

analysis is not necessary if the only aim is to define the dormancy stage of flower buds. This would 509

offer an alternative approach to methods currently used such as assessing the date of dormancy release 510

by using forcing conditions. In addition, this result sets the stage for the development of a fast and cost 511

effective diagnostic tool to molecularly define the flower bud state in cherry trees. Such diagnostic 512

tool would be very valuable for researchers working on cherry trees as well as for plant growers, 513

notably to define the best time for the application of dormancy breaking agents, whose efficiency 514

highly depends on the state of dormancy progression.

515 516

Acknowledgments 517

We thank the Fruit Experimental Unit of INRA (Bordeaux-France) for growing and managing the 518

trees, and Teresa Barreneche, Lydie Fouilhaux, Jacques Joly, Hélène Christman and Rémi Beauvieux 519

for the help during the harvest and for the pictures. Many thanks to Dr Varodom Charoensawan 520

(Mahidol University, Thailand) for providing scripts for mapping and gene expression count 521

extraction. The PhD of Noemie Vimont was supported by a CIFRE grant funded by the Roullier Group 522

(St Malo-France) and ANRT (France).

523 524

Author contributions 525

SC, BW, ED and PAW designed the original research. MA and JCY participated to the project design.

526

NV performed the RNA-seq and analysed the RNA-seq with CS and BW. MF performed the RT- 527

qPCR. JAC performed the TF and motifs enrichment analysis. MT developed the model. NV, SC and 528

BW wrote the article with the assistance of all the authors.

529 530

Data availability 531

RNA-seq data: Gene Expression Omnibus GSE130426 532

Graphical web interface DorPatterns: bwenden.shinyapps.io\DorPatterns 533

534

(24)

References 535

Alexa A, Rahnenführer J. 2018. topGO: Enrichment Analysis for Gene Ontology. R package 536

version 2.34.0.

537

Allona I, Ramos A, Ibañez C, Contreras A, Casado R, Aragoncillo C. 2008. Review. Molecular 538

control of winter dormancy establishment in trees. Spanish Journal of Agricultural Research 6: 201–

539

210.

540

Atkinson CJ, Brennan RM, Jones HG. 2013. Declining chilling and its impact on temperate 541

perennial crops. Environmental and Experimental Botany 91: 48–62.

542

Badeck FW, Bondeau A, Böttcher K, Doktor D, Lucht W, Schaber JJ, Sitch S, Bottcher K.

543

2004. Responses of spring phenology to climate change. New Phytologist 162: 295–309.

544

Beauvieux R, Wenden B, Dirlewanger E. 2018. Bud Dormancy in Perennial Fruit Tree Species : A 545

Pivotal Role for Oxidative Cues. Frontiers in Plant Science 9: 1–13.

546

Benjamini Y, Hochberg J. 1995. Controlling the false discovery rate: a practical and powerful 547

approach to multiple testing. Journal of the Royal Statistical Society. Series B (Methodological) 57:

548

289–300.

549

Bigler C, Bugmann H. 2018. Climate-induced shifts in leaf unfolding and frost risk of European 550

trees and shrubs. Scientific Reports 8: 1–10.

551

Biswas S, Kerner K, Teixeira PJPL, Dangl JL, Jojic V, Wigge PA. 2017. Tradict enables accurate 552

prediction of eukaryotic transcriptional states from 100 marker genes. Nature Communications 8.

553

Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: A flexible trimmer for Illumina sequence 554

data. Bioinformatics 30: 2114–2120.

555

Campoy J a., Ruiz D, Egea J. 2011. Dormancy in temperate fruit trees in a global warming context:

556

A review. Scientia Horticulturae 130: 357–372.

557

Causier B, Schwarz-Sommer Z, Davies B. 2010. Floral organ identity: 20 years of ABCs.

558

Seminars in Cell and Developmental Biology 21: 73–79.

559

Chao WS, Doğramacı M, Horvath DP, Anderson J V., Foley ME. 2017. Comparison of 560

phytohormone levels and transcript profiles during seasonal dormancy transitions in underground 561

adventitious buds of leafy spurge. Plant Molecular Biology 94: 281–302.

562

Chen Y, Chen Z, Kang J, Kang D, Gu H, Qin G. 2013. AtMYB14 Regulates Cold Tolerance in 563

Arabidopsis. Plant Molecular Biology Reporter 31: 87–97.

564

Cline MG, Deppong DO. 1999. The role of apical dominance in paradormancy of temperate woody 565

plants: A reappraisal. Journal of Plant Physiology 155: 350–356.

566

Considine MJ, Considine JA. 2016. On the language and physiology of dormancy and quiescence 567

in plants. Journal of Experimental Botany 67: 3189–3203.

568

Références

Documents relatifs

dormancy was slightly more important on simultaneously defoliated and pinched or pruned shoots than on treated shoots (Fig.. 1 a or b) (data not

The objectives of this work were to identify candidate genes (CGs) involved in dormancy and flowering processes in sweet cherry, their mapping in two mapping progenies, the

7 هتقبس دقف ؛ةثيدحلا رئازجلا خيرات نم ةرتف ىَّطغ ْنإو عورشم هَّنأ امك ، يفاقَّثلا رئازجلا خيرات رصانع ةتفلا ةَّيدرف دوهج ، هتقفارو تاردابم

This work describes the genes expressed in flowering-related pathways in the citrus hybrid Microcitrangemonia, which shows early and constant flowering and compares the gene function

Response to auxin, gibberellin and brassinosteroid stimuli This category was obtained by merging three different on- tologies (responses to gibberellin, auxin stimulus and

La précision globale d’un estimateur est très satisfaisante puisqu’elle reste sous le seuil de 1 % quelle que soit la taille d’échantillon de 5 000 à 50 000 établissements ;

To test if chromatin state and gene expression can be directly compared using this protocol, we carried out RNA-seq

More intuitively, if a threshold is set on the p-values so that all genes with a p-value below this threshold are selected as differentially expressed, the FDR is the