• Aucun résultat trouvé

ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis

N/A
N/A
Protected

Academic year: 2022

Partager "ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis"

Copied!
12
0
0

Texte intégral

(1)

Supplementary Information

ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis

http://doc.rero.ch

Published in "1DWXUH&RPPXQLFDWLRQVGRLQFRPPV"

which should be cited to refer to this work.

(2)

b

c

d

Absolute Expression of PIN8

PIN8 TUB

0 2000 4000 6000 8000

TUB PIN8

e

Relative expression

0 2 4 6

8 PIN8

**

Salk_107965 (pin8-1) Salk_044651 (pin8-2)

Absolute Expression

0 2000 4000 6000 8000

a

Supplemental Figures

f

Col pin8-1 LAT52::PIN8

bp 298 204

http://doc.rero.ch

(3)

Supplemental Figure S1| PIN8expression pattern and loss or ectopic expression lines.

(a) Expression analysis of PIN proteins in pollen according to the publicly available microarray

data (https://www.genevestigator.ethz.ch/at/), the insert shows that PIN8 is expressed in pollens and pollen tubes in the PIN8::PIN8-GFP line.

(b) The expression analysis of PIN8 in different tissues according to the public available microarray data (https://www.genevestigator.ethz.ch/at/). The insert was the confirmation of the microarray data by RT-PCR analysis. Tubulin was used as a control. (c) Structure of the PIN8 gene with six exons and depiction of two T-DNA insertions characterizing as pin8-1 and pin8-2. (d) pin8-1 is knock out allele which was confirmed by RT-PCR analysis. RNA for RT-PCR analysis was isolated from flowers. Tubulin was used as a control. (e) The LAT52::PIN8 line had highly increased PIN8 transcription level compared to the wild type control. RNA for Q-PCR analysis was isolated from flowers. Tubulin was used as a relative control. Error bars represent standard error from the mean of three independent biological repeats (Student's Ttest, **P <0.01).(f)Pollen germination was normal in both pin8-1 and the LAT52::PIN8 line. Bar = 25 μm.

http://doc.rero.ch

(4)

Pollen Transmission(%) 0 20 40 60

$QWL*)3 $QWL$5)$& 2YHUODS

-0.5 0 0.5 1

Colocalization Factor

c

a b d

*

Supplemental Figure S2| PIN8::PIN8-GFP is functional.

The functional PIN8::PIN8-GFP was confirmed via rescuing pin8-1 loss function mutant pollen transmission ability, Error bars represent the standard error of more than 10 independent crosses (Student T test, *P<0.05).

Supplemental Figure S3| PIN8 subcellular localization.

(a-c) PIN8 (anti-GFP, green) is not colocalized with endosome (anti-ARF1, red) in the 35S::PIN8-GFP line. Bar = 5 μm.

(d) The colocalization factor (the highest is 1.0) was calculated by Zeiss software. For microscope observation, 3-day-old seedlings (n=6) and at least 5 areas were analyzed for each seedling. Error bars represent the standard error.

http://doc.rero.ch

(5)

0 50 100 150

NAA Export (% of initial export)

t(min.)

0.0 2.5 5.0 7.5 10.0 Col pin8

PIN8 OX PIN8 OX BFA

Supplemental Figure S5| Protoplast transport assays.

Protoplasts of PIN8OX showed a higher rate of NAA export. Error bars represent standard error of the mean, n = 3.

Supplemental Figure S4| PIN8 localization is insensitive to trafficking inhibitor brefeldin A.

The 35S::PIN8-GFP seedlings were treated with brefeldin A (BFA, 50μM) for 2 hours before observation. Bar=5 μm.

http://doc.rero.ch

(6)

Chloroplast Overlay 35S::PIN8-GFP

Supplemental Figure S6| PIN8 is localized at ER in protoplasts from transiently transfected Nicotiana benthamiana.

The red dots are chloroplasts, the bright green ring-like GFP signals corresponds to 35S::PIN8-GFP. Bar=10 μm

http://doc.rero.ch

(7)

a b

*

0 0.5 1.0 1.5

3H-IAA uptake(pmol/mg prot)

** **

Supplemental Figure S7| Biologically active auxins are preferred substrates of PIN8 action.

(a) The IAA uptake in vesicle fractions from PIN8 OX and the Col control was inhibited at the presence of the auxin analogous indole butyric acid (IBA, 1mM), NAA(1mM), 2,4-D(1mM), while the biologically inactive analogue benzoic acid (BA, 1mM) had no effect on the PIN8-mediated uptake of radiolabelled IAA. Error bars represent standard error of the mean, n = 3. (Student t test, *P<0.05, **P<0.05). Transport assays were performed as described in Material and Methods. ER-enriched membranes were incubated in 50 nM 3H-IAA fractions. Aliquots were taken at 45″ after start, filtered and washed. The radioactivity present in the filters was estimated by liquid scintillation counting and expressed as pmol of 3H-IAA / mg of total proteins.

(b) Auxin transport assays in mesophyll protoplasts from transiently transfected Nicotiana benthamiana indicated that IAA, not BA, was the preferred substrate of PIN8 action. IAA export analyses from N. benthamiana mesophyll protoplasts was analyzed 2-3 day agrobacterium-mediated co-transfection. Tobacco protoplast preparation and transport assays were identical to the described Arabidopsis protocol22 except that a 25% percoll gradient was used. Relative IAA/NAA export is calculated from effluxed radioactivity as follows:

((radioactivity in the medium at time t) - (radioactivity in the medium at time t=0)) * (100%)/

(radioactivity in the medium at t=0). Presented are average values from 3 independent protoplast infiltrations.

http://doc.rero.ch

(8)

5 6 7 8

0 2 4 6 8 10 12 14

Appar en t pH

Fracon

BCECF

Tonoplast

a

b

ER PM

15% Sucrose 55% Sucrose

* *

*

*

*

*

0 5 10 15

0 10 20 30 40 50 60

DPM mg

-1

pr ot ein

Seconds

ER 7 Col0

0 5 10 15

0 10 20 30 40 50 60

DPM mg

-1

pr ot ein

Seconds

ER9 Col0

0 5 10 15

0 10 20 30 40 50 60

DPM mg

-1

pr ot ein

Seconds

PM12 Col0

0 5 10 15

0 10 20 30 40 50 60

DPM mg

-1

pr ot ein

Seconds

Tonoplast4 Col0

http://doc.rero.ch

(9)

Supplemental Figure S8| pH status and auxin transport in active, sealed membrane vesicles from PIN8OX seedlings.

a) Apparent pH determined from 2′,7′-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF) fluorescence of washed vesicles incubated for 5 min ± Mg-ATP. Tonoplast fractions (4-6) and, to a lesser extent, lighter ER fractions (7) exhibit acidification in the presence of ATP More dense ER fractions (8, 9) exhibit slight ATP-induced alkalinization. Collapse of a H+ gradient by gramicidin resulted in neutral (buffer) pH readings. Readings below pH 6.5 were confirmed using Oregon Green. pH measurements BCECF (20 μg/mL) was added to 100 μL fractions which were then incubated on ice for 5 min, then centrifuged at 100,000 x g for 15 min. Pellets were washed with 500 μL buffer, centrifuged at 25,000 x g for 5 min and were resuspended in 100 μL for fluorometric assays (Synergy HT, Biotek, Burlington, VT).

Gramicidin (10 μM) was added to collapse gradients. Membrane fractions were analyzed by ELISA and/or western blotting with antisera for subcellular marker proteins AVP1,VHa1 for tonoplast, BIP, PDI for ER; AHA2, ABCB4 for PM). Values are means and SD, n=3. Asterisks indicate difference by Student’s t- test (P < 0.05)

b) ATP-treated lighter ER membranes (7) from lines overexpressing PIN8 accumulated 3H-IAA in short-term (60 s) uptake assays. Denser ER vesicles, tonoplast vesicles, and PM vesicles did not show a similar activity. Uptake was not inhibited by addition of 0.5 mM benzoic acid buffered with 5 mM BTP-MES (pH7.0). Assays were repeated twice with similar results. ER7, ER fraction 7; ER9, ER fraction 9; PM12, plasma membrane fraction 12; T4, tonoplast fraction 4. Total membranes from 6-day-old Arabidopsis seedlings were fractionated on a sucrose density gradient and assayed for pH and 3H-IAA uptake with and without addition of ATP.

http://doc.rero.ch

(10)

Free IAA (pmol/mg)

0 0.5

1

*

IAA Export (% of initial export)

0 50 100 150

* *

a b

b

0 10 20 30

Leaf Number

(16LL /8 DD)

Col

RPS5A

PIN5 OX PIN5 OX PIN8 OX PIN8 OX

c

**

*

**

0 2 4 6

Hypocotyl Length(mm)

a

Sup plemental Fig ure S 9| PIN5OX and PIN8OX have antagonistic functions.

(a) pin5 enhanced long hypocotyls phenotype of PIN8 OX. Error bars represent standard error from the mean of 2 independent experiments (n=44, Student T test, **P<0.05).

(b-c) The earlier flowering phenotype of the PIN8OX line was rescued in the PIN8OX PIN5OX line. Plants were grown under long-day conditions (16-hour light/8-hour dark).

Supplemental Figure S10 | PIN8 and PIN5 have antagonistic roles in both auxin transport and auxin homeostatic regul ations.

(a) The increased free IAA phenotype of the PIN8OX line was rescued in the PIN8OX PIN5OX line. Error bars represent standard error of the mean, n = 4 (Student T test, *P<0.05).

(b) Protoplasts of PIN8OX showed a higher rate of IAA export compared to the Col control, similar to pin5. Error bars represent standard error of the mean, n = 3. (Student T test, *P<0.05).

http://doc.rero.ch

(11)

Supplemental Tables

Supplemental Table S1

pin 8-1 pin5-5 Col

% (st. dev.) % (st. dev.) % (st. dev.)

aborted pollen 13.96 (15.07) 10.92 (11.26) 4.44 (2.26)

binuclear pollen 11.3 (4.23) 10.63 (3.9) 7.56 (2.67)

eccentric nuclei 5.3 (2.14) 5.96 (3.54) 2.15 (2.37)

misshaped MGU 15.22 (4.77) 16.25 (5.45) 8.56 (3.65)

linear MGU 21.74 (3.79) 20.21 (5.3) 5.92 (3.78)

1-nuclear pollen 1.65 (2.03) 1.46 (2.08) 0.73 (1.41)

Wt-looking 63.48 63.12 85.58

Supplemental Table S2

Cell Length, μm

Col 85± 3

PIN8 OX 175± 5

Measurements of the length of epidermal cells in hypocotyls of 5-day old seedlings of PIN8 OX and Col. The data represent the mean of 50 measurements from 5 seedlings. The difference between Col and PIN8 OX is significantly different (P<0.001).

http://doc.rero.ch

(12)

Supplemental Table S3

TUBF: ACTCGTTGGGAGGAGGAACT

TUBR: ACACCAGACATAGTAGCAGAAATCAAG

PIN8F: TGGCCATGTTCAGCTTAGGTC

PIN8R: ATGGCACTACTCCTTGAGGCA

LAT52F:ATCGGGCCCACCGCGGTGGCGGCCGCAAGCTT

LAT52R: ATCGGATCCGCCTTAATCCTTTTTTTTCTTGTGTTTTTACTTCGGTC

http://doc.rero.ch

Références

Documents relatifs

Since lateral root initiation is dependent on auxin coming from the apex via acropetal transport [7], the model predicted that a drop of reflux efficiency leads to a decrease of

Déterminez le nombre la médiane, le mode et la moyenne des données.. Arrondissez la moyenne à un décimal près

As shown in this comparison of its rather different decisions on Christianity and on Islam, previously the Court had played out one variant of pluralism against another, a

characterization of cultured bovine aortic endothelial cells and the effects of atriopeptin II and sodium nitroprusside on cellular and extracellular accumulation of cyclic GMP.

To test whether auxin-dependent physiological and developmental responses are affected in xrn4 mutants, we compared the incidence of extreme cotyledon epinasty, typical

We unambiguously identify IAA and related metabolites in isolated Arabidopsis vacuoles, suggesting a key role for the vacuole in intracellular auxin homoeostasis.. Moreover, local

One of the systemic problems faced by English education has been the little attention paid to the specific wission and needs of the English school network by a Ministry geared

The Act to Amend the Education Act, the Act Respecting School Elections and Other Legislative Provisions [Linguistic School Boards Act] (1997) eliminated aIl existing