• Aucun résultat trouvé

TLR2 on blood monocytes senses dengue virus infection and its expression correlates with disease pathogenesis

N/A
N/A
Protected

Academic year: 2021

Partager "TLR2 on blood monocytes senses dengue virus infection and its expression correlates with disease pathogenesis"

Copied!
14
0
0

Texte intégral

(1)

TLR2 on blood monocytes senses dengue virus

infection and its expression correlates with disease

pathogenesis

José A. Aguilar-Briseño

1,6

, Vinit Upasani

1,2

, Bram M. ter Ellen

1

, Jill Moser

3

, Mindaugas Pauzuolis

1

,

Mariana Ruiz-Silva

1

, Sothy Heng

4

, Denis Laurent

4

, Rithy Choeung

5

, Philippe Dussart

5

, Tineke Cantaert

2

,

Jolanda M. Smit

1

& Izabela A. Rodenhuis-Zybert

1

Vascular permeability and plasma leakage are immune-pathologies of severe dengue virus

(DENV) infection, but the mechanisms underlying the exacerbated in

flammation during

DENV pathogenesis are unclear. Here, we demonstrate that TLR2, together with its

co-receptors CD14 and TLR6, is an innate sensor of DENV particles inducing in

flammatory

cytokine expression and impairing vascular integrity in vitro. Blocking TLR2 prior to DENV

infection in vitro abrogates NF-

κB activation while CD14 and TLR6 block has a moderate

effect. Moreover, TLR2 block prior to DENV infection of peripheral blood mononuclear cells

prevents activation of human vascular endothelium, suggesting a potential role of the

TLR2-responses in vascular integrity. TLR2 expression on CD14

+ + classical monocytes isolated in

an acute phase from DENV-infected pediatric patients correlates with severe disease

development. Altogether, these data identify a role for TLR2 in DENV infection and provide

insights into the complex interaction between the virus and innate receptors that may

underlie disease pathogenesis.

https://doi.org/10.1038/s41467-020-16849-7

OPEN

1Department of Medical Microbiology and Infection Prevention, University of Groningen and University Medical Center Groningen, 9700 RB Groningen, The

Netherlands.2Immunology Group, Institut Pasteur du Cambodge, International Network of Pasteur Institutes, Phnom Penh 12201, Cambodia.3Departments of Critical Care, Pathology & Medical Biology, Medical Biology section, University Medical Center Groningen, University of Groningen, 9700 RB Groningen, The Netherlands.4Kantha Bopha Hospital, Phnom Penh 12000, Cambodia.5Virology Unit, Institut Pasteur du Cambodge, International Network of Pasteur

Institutes, Phnom Penh 12201, Cambodia.6Present address: Department of Microbiology and Immunology, University of Iowa, Iowa City, IA 52242, USA.

✉email:[email protected];[email protected]

123456789

(2)

T

he four serotypes of dengue virus (DENV1-4) are

esti-mated to cause 390 million infections per year, of which 96

million manifest clinically

1

. Clinical outcomes of DENV

infection vary considerably and can be either limited to an acute

febrile illness referred to as dengue fever (DF), or progress to a

potentially fatal disease (severe dengue) encompassing dengue

hemorrhagic fever (DHF) and dengue shock syndrome (DSS)

2

.

Severe disease is associated with a transient increase in vascular

permeability due to endothelial dysfunction initiated by increased

levels of soluble inflammatory mediators, such as IL-1β and

TNF-α, released early in the course of infection

3,4

. Factors exacerbating

inflammation such as high viral titers and presence of

cross-reactive, infection-enhancing antibodies raised from previous

infection with another serotype, increase the risk of severe

dis-ease

5–7

. The mechanisms governing the initiation of excessive

inflammation however, remain poorly understood. Consequently,

there is currently no diagnostic marker indicative of severe

dis-ease nor specific treatment options available for DENV patients.

Cells of the innate immune system together with epithelial and

endothelial cells are responsible for the early activation of

inflam-matory responses to invading pathogens. Pattern-recognition

receptors (PRRs) expressed on these cells detect and respond to a

variety of pathogen-associated molecular patterns (PAMPs) as well

as to tissue-derived danger associated molecular patterns (DAMPs),

released from stressed or dying cells. Upon engagement, PRRs

activate intracellular signaling cascades inducing pro-inflammatory

responses

8

. Regulation of this response is crucial, since exacerbated

release of pro-inflammatory mediators is known to trigger adverse

effects including excessive endothelial inflammatory activation,

vascular permeability and hemorrhagic manifestations such as those

seen in severe dengue patients

9–11

.

Toll-like receptor 2 (TLR2) is one of the PRRs expressed on the

surface of immune cells. Although generally known as a sensor of

bacterial lipoproteins, TLR2 can also sense molecular patterns of

viruses

12–18

. The ligand-binding specificity of TLR2 is modulated

by its heterodimerization partners: TLR1 or TLR6 and

co-stimulatory molecules CD14 and CD36

8,19,20

. Engagement of the

TLR2 axis leads to activation of NF-κB pathway, increased gene

expression and release of inflammation-driving mediators such as

inter alia IL-1β and TNF-α. In human blood, expression and

activation of TLR2 has been shown to regulate the function of

many cell types including those representing early targets of

DENV replication, such as dendritic cells (DC’s) and

mono-cytes

21–23

. Chen et al., attributed TLR2-activation following

DENV infection to one of the nonstructural viral proteins,

non-structural protein 1 (NS1) that is released from cells replicating

the virus

24

. Notably, however, subsequent studies by two

inde-pendent groups debated Chen’s data demonstrating that NS1

protein in fact engages TLR4 instead of TLR2

25–27

and indicated

that the conclusions were compromised due to the use of impure

and misfolded Escherichia coli-derived recombinant NS1

26

. Thus,

to date, the mechanism and significance of TLR2-upregulation in

the context of DENV pathogenesis remains unknown.

In the current study, we examine TLR2 expression on PBMCs

isolated from 54 pediatric patients in the acute phase of DENV

infection with different disease outcomes. Furthermore, using an

in vitro PBMC infection and human vascular endothelium

acti-vation models, we investigate the function of TLR2 during DENV

infection. Altogether, our results identify TLR2 as a key regulator

of DENV-induced inflammation and a prognostic marker of

immunopathology.

Results

TLR2 on monocytes of acute patients correlates with disease

severity. Circulating monocytes represent a versatile and dynamic

cell population, composed of multiple subsets which differ in

phenotype, and function

28,29

. In humans, these discrete monocyte

subsets can be distinguished by the expression of CD14 and

CD16

28

. CD14

++

CD16

classical monocytes (CM) make up

∼85% of the circulating monocyte pool, whereas the remaining

∼15% consist of CD14

++

CD16

+

intermediate (IM) and CD14

+

CD16

++

non-classical monocytes (NM)

30,31

. Importantly, their

frequencies are influenced by inflammatory conditions

32

.

Pre-vious studies have shown that DENV infection in vivo increased

frequencies of either IM or NM

21,33

. In line with previous studies,

our patient cohort showed an overall increase in IM and NM

when compared to age-matched healthy controls (Fig.

1a and

Supplementary Fig. 1a). In addition, Azeredo et al.

21

demon-strated increased TLR2 expression on blood monocytes in

DENV-infected patients when compared to healthy controls yet

how TLR2 is distributed over the three monocyte subsets and its

potential impact on disease burden remain elusive

21,24

. To

investigate this, we isolated PBMCs from DENV-infected patients

during the acute phase of infection (n

= 54) and 15 age-matched

healthy donors (HD) and subsequently stained with an

anti-human TLR2 antibody or a conjugated isotype-matched antibody

as a control (Supplementary Fig. 1b). Patients were classified for

disease severity according to the WHO 1997 guidelines as

spe-cified in Methods section and their characteristics are listed in

Table

1. We proceeded to determine DENV infection in

mono-cyte subsets. To ensure detection of active DENV replication,

rather than viral uptake, we used a rabbit polyclonal antibody

against DENV non-structural protein 3 (NS3) and subsequently a

secondary antibody labeled with FITC. A non-specific rabbit

polyclonal antibody along with the same secondary antibody was

used as a negative control (Supplementary Fig. 2a, b). The

anti-NS3 staining was only performed on a subset of patient samples

that had a sufficient cell yield after PBMC thawing to perform a

good quality intracellular staining (n

= 15). In line with the above

studies, immunophenotyping of patients’ PBMCs showed that

both CM and IM had significantly higher expression (p < 0.0001,

two-tailed Mann–Whitney test) of TLR2 on their surface

com-pared to NM (Fig.

1b). However, when TLR2 expression in

DENV+ patients was compared to HD, all monocyte subsets

from HDs had significantly higher TLR2 expression (p < 0.0001,

two-tailed Mann–Whitney test) compared to DENV+ patients

(Fig.

1b). As the expression of TLR2 on monocytes during the

acute phase of DENV infection could vary according to the days

post-fever, we classified the DENV-positive patients according to

the number of days post-fever (day 2–5). TLR2 expression on

CM, IM and NM was not dependent on the number of days post

fever that the samples were obtained (Supplementary Fig. 3).

Interestingly, CM from patients who developed DHF/DSS

showed significantly higher expression of TLR2 when compared

to patients with mild disease (DF) (p < 0.01, two-tailed

Mann–Whitney test). No differences were observed for IM

while for NM, patients with severe dengue had marginally lower

percentage of TLR2 compared to DF patients (p < 0.05, two-tailed

Mann–Whitney test) (Fig.

1c). Similar results were yielded when

TLR2 expression was stratified based on the infecting serotype;

CM from patients who developed DHF/DSS following DENV1

and DENV2 infections showed significantly higher expression of

TLR2 when compared to those who developed DF (P < 0.05,

two-tailed Mann–Whitney test) (Supplementary Fig. 4a, b,

respec-tively) while no differences were observed for IM and NM

(Supplementary Fig. 4). Unfortunately, there were not enough

patients to evaluate the correlation between TLR2 expression and

disease severity following DENV serotypes 3 and 4. Notably, CM

and IM, but not NM, were the primary targets of DENV

repli-cation as measured by the percentage of cells positive for DENV

NS3 (Fig.

1d). The percentage of CM predominated in patients

(3)

a

c

b

d

e

0 25 50 75 100 0 25 50 75 100 CM IM NM CM IM NM 0 20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100 % of monoc yte p o p u lati on % of monoc yte p o p u lati on % TLR2 positive cells % TLR2 positive cells % NS3 positive cells CM IM NM HD DENV+ DF DHF/DSS CM IM NM CM IM NM

Fig. 1 Sustained high expression of TLR2 and increased frequency of monocytes correlates with DENV disease severity. a–e PBMCs were isolated from 15 age-matched healthy donors (HD) and 54 patients undergoing acute DENV infection (DENV+) who developed relatively mild (DF, n = 32) or severe (DHF/DSS,n = 22) disease. a Monocyte subsets distribution in healthy and DENV+ patients (two-tailed Mann–Whitney test, ****P < 0.0001). b Percentages of cells expressing TLR2 were determined for each monocyte subset (two-tailed Mann–Whitney test, ****P < 0.0001) and c stratified by disease severity (two-tailed Mann–Whitney test, *P < 0.05; **P < 0.01). d Percentages of NS3+ infected cells in DENV-positive patients (n = 15) stained intracellularly for DENV NS3 (two-tailed Mann–Whitney test, ***P < 0.001; ****P < 0.0001). e Monocyte subsets distribution in patients, stratified by disease severity (two-tailed Mann–Whitney test, *P < 0.05). CM classical monocytes, IM intermediate monocytes, NM non-classical monocytes. Bars represent median with interquartile range (IQR). Source data are provided as a Source datafile.

(4)

that developed severe disease (p < 0.5, two-tailed Mann–Whitney

test) while there were no significant changes in the percentages of

IM. In addition, patients that developed DF had a moderately

increased percentage of NM (P < 0.5, two-tailed Mann–Whitney

test) (Fig.

1e). Altogether, these data suggest that sustained high

levels of TLR2 on CM during the acute phase of DENV infection

are associated with severe disease development.

DENV2 engages TLR2/6 and CD14 to trigger NF-

κB activation.

To investigate if TLR2 plays a role during DENV infection, we

first

assessed whether TLR2 is able to sense DENV particles. To this end,

we used reporter cells HEK-Blue™ hTLR2 cells (InvivoGen) that

stably co-overexpress human TLR2/6/1, CD14 and

NF-κB/AP1-inducible SEAP (secreted embryonic alkaline phosphatase) genes.

Stimulation of TLR2 is monitored by the activation of NF-κB/AP1.

Synthetic lipopeptides PAM3CSK4 (PAM3) and PAM2CSK4

(PAM2), potent agonists of TLR2/1/CD14 and TLR2/6,

respec-tively, were used as positive controls in the assays. Interestingly, we

observed that DENV2 strain 16681 induces activation of

HEK-Blue™ hTLR2 cells (Fig.

2a) but not the parental HEK-Blue™

Null1 cells (Supplementary Fig. 5a). As shown in Fig.

2a, NF-κB

activation

was

not

dependent

on

viral

replication

as

UV-inactivation of the virus (UV-DENV) did not abrogate the

sensing, and increased with viral dose (Supplementary Fig. 5b).

Moreover, purified DENV virions [pDENV] activated NF-κB

demonstrating that molecular patterns present on the surface of

the virus particles eg. (pr)M/E proteins rather than a soluble factor

are responsible for the activation. DENV-mediated NF-κB activity

was significantly inhibited upon blocking the TLR2 receptor (p <

0.0001, paired one-tailed t test) and significantly attenuated by

blockage of the TLR2 co-receptors: TLR6 and CD14 (p < 0.001,

one-way ANOVA, Dunnett post hoc test) (Fig.

2b, c). Importantly,

PAM3 and our standard DENV preparations did not activate

HEK-Blue™ hTLR4 cells (Supplementary Fig. 5c, d), which only

respon-ded to LPS and TNF-α treatments. These results confirm the

spe-cificity of the HEK-TLR Blue system employed and imply that the

soluble form of DENV nonstructural protein 1 (NS1), previously

shown to signal through TLR4

25,26

, was not a confounding factor in

our experiments.

To evaluate the capacity of mosquito and human-derived

DENV to engage TLR2, we next compared the ability of DENV-2

16681 produced in mosquito C6/36 cells to activate NF-κB in the

HEK-Blue™ hTLR2 cells with that produced on monocyte-derived

DC’s and monocyte-derived macrophages (Mϕ). The

human-derived viruses were obtained by infecting monocyte-human-derived DC’s

and monocyte-derived Mϕ with C6/36-derived virus for 2 h, after

which the surplus of inoculating virus and incubation was

continued until 48hpi. Following titrations of DC-and Mϕ -derived

DENV2 preparations, HEK-Blue™ hTLR2 cells were exposed to

increasing numbers of virus particles i.e. multiplicity of genomes

(MOGs) to ensure fair comparison. Interestingly, DC-derived

DENV2 induced NF-κB activation on hTLR2 cells albeit ~3× lower

than the C6/36-derived virus at a similar MOG (Supplementary

Fig. 5b), suggesting that the structural differences between human

and mosquito-derived viruses modulate the TLR2 recognition.

Notably however, Mϕ-produced DENV2 did not induce NF-κB

activation at any of MOG tested, implying that TLR2 engagement

may be sensitive to changes in virion characteristics that are not

intrinsic to mosquito or human cells, but are cell-type specific. It is

important to mention however that due to the overall lower yield

of DENV released by macrophages, MOG of 4000 could not be

reached and thus more in-depth studies are needed to test the

premise of intra-host cell type-specific factors influencing TLR2

activation by DENV. Altogether, our data revealed that TLR2 has

the capacity to sense DENV virions.

While expressed at the plasma membrane, TLR2-induced

NF-κB activation is controlled by clathrin-mediated endocytosis

(CME), in which CD14 serves as an important upstream

regulator

34

. Accordingly, we used not-toxic concentrations of

various perturbants of endocytic pathways, to dissect whether

CME is required for TLR2 to sense DENV. Specifically, pit-stop

(PS), an inhibitor of clathrin-pit formation was used to inhibit

CME, NH

4

Cl was used to neutralize the pH of intracellular

compartments; wortmannin (W), a PI3K inhibitor affecting

phagocytosis and macropinocytosis served as a negative control

35

.

Chloroquine, chlorpromazine and dynasore were excluded from

the experiments due to their high level of cytotoxicity

(Supplementary Fig. 6). PS and NH

4

Cl significantly reduced but

did not abrogate NF-κB activation mediated by PAM3 (p < 0.05,

one-way ANOVA, Dunnett post hoc test) and DENV (p < 0.05,

one-way ANOVA, Dunnett post hoc test), whereas no significant

effect was seen for PAM2 (Fig.

2d). As expected, wortmannin

treatment did not alter TLR2-mediated NF-κB activation by any

of the agonists. Thus, activation of TLR2/6/CD14 axis by DENV

Table 1 Demographic data and clinical parameters of the studied population.

Studied population Total patients (n = 54) DFN = 32 DHF/DSS 22 (DHF−12; DSS−10) Healthy donors (n = 15) Age 8.14 ± 4.01 8.29 ± 4.29 7.29 ± 3.67 10.08 ± 4.06 M/F ratio 0.8 0.9 0.7 1.5 Weight (kg) 22.7 23.7 21.2 29.3 Height (cm) 121.1 122.6 119.3 127.5 Temperature (°C) 37.6 38.0 37.1 NA Hematocrit (%) 42.8 38.0 44.0 Platelets (×109/L) 93.7 116.3 65.0

Day of fever (Mean) 3.6 3.3 3.9

DENV1 8 5 3 DENV2 37 21 16 DENV3 0 0 0 DENV4 3 3 0 N/A 6 3 3 NS1+ 32 21 11 PCR+ 48 30 18

Viral load (copies/ml) (Median, IQR) 2.2 × 104

(7.4 × 103– 3.4 × 105) 1.2 × 105 (1.4 × 104– 1.2 × 106) 7.6 × 103 (6.3 × 103– 3.5 × 104) Secondary infection 74% 65% 90%

(5)

occurs at the plasma membrane and can be potentiated by

internalization of the complex via CME.

Interestingly, many viruses, including DENV, hijack CME to

gain access to internal compartments of host cells

36,37

. Moreover,

CD14 and its unknown co-receptor has been previously proposed

to act as an attachment receptor for DENV

38

. We therefore

hypothesized that TLR2/CD14-dependent CME facilitates DENV

entry to establish infection. Accordingly, we tested if blockade of

TLR2 or its co-receptors had any impact on the percentage of

infected cells and/or virus production. Since, due to technical

issues, we could not exploit the same NS3 antibody as we used in

our patient cohort, we tested the accumulation of E protein and

a

PS W NH4Cl

c

d

αTLR1 αTLR6 αCD14

PAM3 PAM2 DENV2 PAM3 PAM2 DENV2

e

f

b

αTLR2

Mock PAM3 DENV2

g

αTLR1 αTLR6 αCD14 αTLR2 αTLR1 αTLR6 αCD14 αTLR2 0 5 10 15 20 25 PBMC's - 48 hpi HEK-BlueTM hTLR2 cells - 24 hpi

2.0 100 80 60 40 20 + + + + + + + + + + + + + + + + + + 0 100 80 60 40 20 0 0 10,000 MFI CD14 20,000 30,000 r = 0.4768 CM IM NM P < 0.001 1.5 1.0 0.5 NF-kB stimulation [OD630]

% of NF-kB stimulation relative to the agonist

125 100 75 50 25 0 12.5 10.0 7.5 5.0 2.5 0.0

% of NF-kB stimulation relative to the agonist

0.0 2.0 1.5 1.0 0.5 NF-kB stimulation [OD630] 0.0 – + – + – + CC PAM3 DENV2 UV-DENV2 pDENV2

% DENV positive cells

% DENV positive cells

% DENV positive cells

TLR1 TLR6 TLR2 TLR2 TLR2 CD14 TLR6 CD14 + + + + + + + +

(6)

used UV-inactivated DENV to ensure we do not detect incoming

virus in our assay (Supplementary Fig. 7a, b, and Supplementary

Fig. 8a). As shown in Fig.

2e, blockage of TLR2, CD14 (P <

0.0001, one-way ANOVA, Dunnett post hoc test) and to a lesser

extent that of TLR6 (P < 0.05, one-way ANOVA, Dunnett post

hoc test), reduced the number of DENV-Ag-positive HEK-Blue™

hTLR2 cells. Consistent with these results, in PBMCs, specific

blocking of TLR2 (P < 0.0001, one-way ANOVA, Dunnett post

hoc test) and CD14 (P < 0.0001, one-way ANOVA, Dunnett post

hoc test) but not that of TLR1/6 significantly decreased the

frequency of DENV Ag-positive monocytes (Fig.

2f, and

Supplementary Fig. 8b for isotype controls). These data might

explain why among the three monocyte subsets, the

TLR2-positive CD14

++

monocytes (Fig.

1d) expressed the highest level

of DENV NS3 during acute DENV infection and why CD14

expression correlates with DENV replication in vivo (Fig.

2g).

Counterintuitively, however, despite the significant decrease in

the frequency of DENV-Ag-positive cells, TLR2 and CD14

blockage had little to no effect on viral production in both cell

models (Supplementary Fig. 9). There was also no clear

correlation between the expression of TLR2 (percentage of

positive cells and MFIs) and the viral load in our patient’s cohort

(Supplementary Fig. 10a, b), suggesting that

TLR2/CD14-dependent CME does not significantly contribute to progeny

virus release and/or other cells such as DCs

39

are the main source

of the virus. Altogether, these data indicate that host cells utilize

TLR2/6/CD14 mediated NF-κB activation as a quick innate

mechanism to sense DENV infection.

TLR2-mediated sensing of DENV is virus strain rather than

the serotype-specific. We proceeded to investigate whether

TLR2-engagement is a PAN-dengue phenomenon. All four

DENV serotypes had the ability to activate NF-κB in a

TLR2-dependent manner (Table

2) yet, not all strains and/or genotypes

of the same serotype had that property. Other mosquito-borne

viruses including West Nile Virus (WNV), Zika virus (ZIKV),

and chikungunya virus (CHIKV), did not activate NF-κB in this

system (Table

2). Interestingly, despite the varying ability of

several DENV2 16681 preparations used in this study to activate

NF-κB, all of them infected the HEK-Blue™ hTLR2 cells and

PBMCs in TLR2/CD14-dependent manner (Fig.

2e, f). Thus,

TLR2-mediated NF-κB activation but not TLR2 axis-mediated

infection appears to be DENV strain/genotype specific.

In vitro DENV infection upregulates TLR2 and CD16 on

monocytes. To further substantiate the role of TLR2 as a

reg-ulator of inflammatory responses, we isolated PBMCs from

healthy, DENV-seronegative, donors and infected them under

TLR2 axis blocking and non-blocking conditions with DENV2

16681 strain at multiplicities of infection (MOI) of 10, as

described previously

40

. To gain further insights into the possible

repercussions of TLR2-engagement on PBMCs, we used virus

preparations that had a differential capacity to activate

HEK-Blue™ hTLR2 reporter cells (Table

2). To discriminate between

pathways triggered due to sensing and/or by replication, an equal

dose of UV-inactivated virus was used as a control in all

experiments. Regardless of virus preparation, in vitro DENV

infection of monocytes (within PBMCs) increased the mean

fluorescent intensity (MFI) of TLR2 (Fig.

3a and Supplementary

Fig. 11) and the percentage of TLR2-positive cells (Fig.

3b). In

contrast, UV-DENV (Fig.

3a, b) and PAM3CSK4 (Supplementary

Fig. 12a, b) did not upregulate TLR2 expression when compared

to mock-infected cells. In addition, neither DENV infection nor

TLR2 agonists had an effect on the expression of TLR2 on

lym-phocytes (Supplementary Fig. 12c, d). Notably, the increase in

TLR2 expression following in vitro-infection was in contrast to

the data collected from our ex vivo samples (Fig.

1b) but in line

with previous

findings

21

. Importantly, PBMCs isolated from adult

healthy and DENV-seronegative donors in the Netherlands

expressed similar levels of TLR2 as our pediatric HD in

Cam-bodia. This might suggest that monocyte responses and thereby

the regulation of TLR2 expression on the surface of these cells

depends on the age, genetic background and/or past DENV

infection. Thus, in vitro DENV infection but not ex vivo infection

leads to the selective upregulation of TLR2 on monocyte

fractions.

Fig. 2 DENV engages TLR2/6 and CD14 to activate NF-κB and to establish infection. a NF-κB activation in HEK-Blue™ hTLR2 cells (mock-) treated with PAM3CSK4 (PAM3, 25 ng/mL), DENV2 (MOG1000), UV-I DENV2 (MOG1000) or purified DENV2 (pDENV2) (MOG1000) for 24 h (n = 3 one-way ANOVA, Dunnett post hoc test, ***P < 0.001). OD630 values represent induction of NF-κB. b, c NF-κB activation in HEK-Blue™ hTLR2 cells pretreated for 2 h withbαTLR2 (n = 3, one-tailed paired t test, ***P < 0.001; ****P < 0.0001) or c αTLR1, αTLR6 and αCD14 (15 µg/mL) before exposure to PAM3 (25 ng/mL), PAM2CSK4 (PAM2, 1 ng/mL) or DENV2 (MOG1000) for 24 h (n = 3, one-way ANOVA, Dunnett post hoc test, *P < 0.05; **P < 0.01; ***P < 0.001).d NF-κB activation in HEK-Blue™ hTLR2 pretreated for 1 h with endocytosis inhibitors pitstop (PS, 60 µM), ammonium chloride (NH4Cl, 50 mM) and wortmannin (W, 2µM) prior to exposure to PAM3 (25 ng/mL), PAM2 (1 ng/mL) or DENV2 (MOG1000) for 24 h (n = 3, one-way ANOVA, Dunnett post hoc test, *P < 0.05). Percentages of DENV (E)—positive cells were determined by flow cytometry in e HEK-Blue™ hTLR2 cells (n = 5, one-way ANOVA, Dunnett post hoc test, *P < 0.05; ****P < 0.0001) or f monocytes in the context of PBMCs, in the presence or absence of TLR2 axis blockade after 24 and 48 h, respectively (n = 3, three donors and three different DENV2 preparations, one-way ANOVA, Dunnett post hoc test, ****P < 0.0001). Bars represent the mean ± SEM. CC (cellular control), PAM2, PAM3, and DENV2 as controls of their respective blocking/treatment conditions. N refers to the number of independent biological experiments unless otherwise specified. g Correlation of mean fluorescence intensity (MFI) of CD14 expression on different monocyte subsets and DENV infection (NS3) in our patient’s cohort. Statistical differences were determined by Spearman correlation analysis. Source data are provided as a Source datafile.

Table 2 TLR2 engagement by DENV is strain speci

fic.

Virus Strain TLR2/NF-κB activation

DENV1 16007 +++ Hawaii − DENV2 16681 +++/++a NGC +++ TSV01 + DENV3 16562 +++ H87 − DENV4 1036 + H241 − ZIKV SL0216 − WNV NY99 − CHIKV LR OPY1 −

Source data are provided as a source datafile.

++ NF-kB activation is half the triggered by PAM3CSK4, + 10–20% activation of NF-kB in comparison to PAM3CSK4,− Does not trigger NF-kB activation.

(7)

Immunophenotyping of in vitro-infected cells showed that

both DENV and UV-DENV significantly increased the

frequen-cies of CM (P < 0.0102 and P < 0.0022, respectively, unpaired

one-tailed t test) and NM (P < 0.0088 and P < 0.0123, respectively,

unpaired one-tailed t test) while the IM population was decreased

(P < 0.0001 and P < 0.0012, respectively, unpaired one-tailed t

test) when compared to mock-treated PBMCs (Supplementary

Fig. 12e). This indicates that sensing of virions is enough to

trigger a shift in the monocyte subpopulations. This effect was,

however, independent of TLR2, since TLR2 block did not prevent

the increase in CM numbers (Supplementary Fig. 12e). Similar

results were obtained for PAM3 (Supplementary Fig. 12f),

suggesting that other receptors are involved in this process.

Notably, we found that active DENV infection but not

UV-DENV, significantly increased the expression of CD16 in

intermediate and non-classical monocytes (p < 0.0136 and p <

0.0099, respectively, paired one-tailed t test) (Fig.

3c, d).

Moreover, this upregulation was in control of TLR2 and TLR6

but not that of TLR1, as blockade of TLR2 and TLR6 significantly

reduced (P < 0.0211 and P < 0.0383, respectively, paired

one-tailed t test) the upregulation of CD16 induced by DENV

infection (Fig.

3d). Remarkably, in patients, expression of CD16

was negatively associated with the percentage of DENV-infected

cells (Supplementary Fig. 13) suggesting that TLR2/6-mediated

CD16 upregulation might serve as an antiviral mechanism. This

would explain, at least in part, why sustained levels of TLR2

expression on NM correlated with mild disease (Fig.

1c). There

was no difference in the expression of CD14 after DENV

infection with or without blocking conditions (Fig.

3c).

TLR2

controls

DENV

infection-induced

inflammatory

responses of PBMC. Activation of blood cells as a consequence of

DENV infection leads to the production of inflammatory

cyto-kines, which in turn activates human endothelial cells and can

lead to the loss of their barrier function

3,41–43

. To test whether

TLR2 engagement during DENV infection of PBMCs contributed

to the vascular responses, we incubated human umbilical vein

endothelial cells (HUVEC) with supernatants of infected PBMCs,

as described in Fig.

4a. Endothelial cell activation was assessed by

quantification of surface and/or mRNA expression of E-selectin,

vascular cell adhesion protein 1 (VCAM-1), intercellular adhesion

molecule 1 (ICAM-1) and inflammatory mediators including

IL-6, IL-8, MCP-1, and CXCL6. To ensure that the activation of

endothelial cells was due to soluble inflammatory mediators

excreted by infected PBMCs rather than the presence of the virus

itself, HUVEC were incubated with an equal number of GEc as

those present in the supernatants of infected PBMCs. Incubation

for six hours did not lead to the upregulation of adhesion

molecules when compared to LPS (positive control)

(Supple-mentary Fig. 14a, b). Thus, endothelial cell activation observed

a

b

c

No ab – + + + – + + + – + + + – + + + No ab

d

αTLR1 αTLR6 αTLR2 αTLR1 αTLR6 αTLR2 4 3 2 1 0 3 2 1 0

TLR2 MFI fold change to mock

MFI fold change

(to relativve mock)

3

2

1

0

MFI fold change

(to relativve mock)

CM IM NM CM IM IM NM Mock DENV2 UV-DENV2 DENV2 UV-DENV2 CD16 CD16 CD14 NM % TLR2 positive cells 0 20 40 60 80 100

Fig. 3 Active DENV infection upregulates TLR2 and increases CD16 expression in a TLR2/TLR6 dependent manner. PBMCs from healthy donors were (mock-) treated withαTLR2, αTLR1 and αTLR6 (5 µg/mL) for 2 h prior to infection with DENV2 at MOI of 10 or its UV-inactivated equivalent (UV-DENV2) for 48 h.a MFI of TLR2 expression (n = 5, five different donors and up to 4 different DENV2 preparations, paired one-tailed t test, *P < 0.05; **P < 0.01, ***P < 0.001) and b Percenatge of TLR2-positive cells within each of monocytes subset (n = 5, five different donors and up to four different DENV2 preparations, paired one-tailedt test, *P < 0.05; **P < 0.01, ***P < 0.001, ****P < 0.0001). c CD14 and CD16 expression were detected for total monocytes in blocking and non-blocking condition (n = 2, two different donors and three different viral preparations, paired one-tailed t test, *P < 0.05; **P < 0.01) and d per monocyte subset (n = 2, two different donors and three different viral preparations, paired one-tailed t test, *P < 0.05; **P < 0.01). CM classical monocytes, IM intermediate monocytes and NM: non-classical monocytes. Data represented as fold-changes in MFI relative to the respective mock or as a percentage of positive cells of the respective marker. Bars represent mean ± SEM. Source data are provided as a Source datafile.

(8)

with the supernatants of infected PBMCs was due to soluble

mediators excreted upon infection in PBMCs (Fig.

4b, c) and not

due to the carryover of the virus. Surprisingly, blocking TLR2 on

PBMCs prior to exposure to DENV infection abolished

inflam-matory responses and significantly attenuated endothelial

acti-vation as evidenced by decreased expression of adhesion

molecules (Fig.

4b), mRNA levels of their respective genes

(Fig.

4c) as well as reduced transcription of inflammatory

cyto-kines and chemocyto-kines such as IL-6, IL-8, MCP-1, and CXL6

(Fig.

4d). Supernatants from UV-DENV treated PBMCs led to a

relatively mild activation of HUVEC when compared to

infec-tious DENV (Fig.

4c, d; Supplementary Fig. 15a, b), despite potent

activation of NF-κB in HEK-Blue™ hTLR2 by UV-DENV

(Fig.

2a). Additionally, isotype control antibody block did not

have an effect on the vascular responses of PBMCs infected with

DENV2 (Supplementary Fig. 15c). Moreover, the TLR2 block had

no effect on the soluble inflammatory responses of PBMCs

treated with the TLR4/CD14 agonist LPS, indicating that the

effect observed for DENV infection is indeed TLR2-specific

(Supplementary Fig. 15d).

Increased levels of IL-1β and TNF-alpha have been reported to

be present in the plasma of DENV patients and may contribute to

increased endothelial permeability

3

. To determine whether

endothelial activation during DENV infection was due to the

presence of these cytokines, we measured the intracellular

accumulation of IL-1β and TNF-alpha in DENV-infected PBMCs

(Supplementary

Fig.

16).

As

expected,

positive

control

PAM3CSK4 induced the intracellular accumulation of IL-1β

and TNF-α in the concentration and TLR2-dependent manner

(Supplementary Fig. 17a, b). Interestingly, at the concentration

tested only the intracellular accumulation of IL-1β was

sig-nificantly reduced by prior TLR2 blockade (Supplementary

Fig. 17a), suggesting that differential pathways down-stream of

TLR2- trigger the production of these cytokines

44

. Indeed,

TLR2 signaling may also lead to the activation of the

inflammasome pathway that contributes to the production of

IL-1β

45,46

. Alternatively, signal integration of different PRR can

lead to different and non-additive immune responses

47,48

.

Importantly, at 12 hpi we did not detect TNF-α accumulation

following exposure to DENV2 (Supplementary Fig. 17c) while

IL-1β accumulation was evident in the monocyte fraction of three

out of four tested donors and depending on the donor was

induced by exposure to either infectious (DENV) or

non-infectious virus UV-DENV (Supplementary Fig. 17d). None of

the treatments induced intracellular accumulation of both

cytokines in the lymphocytic fraction of the PBMCs

(Supple-mentary Fig. 17e, f). Therefore, we analyzed inflammatory

mediators released from the cells throughout 48 h of infection.

Interestingly, the concentrations of IP-10 (P < 0.01, one-way

ANOVA, Dunnett post hoc test), IFN-α2 (P < 0.05, one-way

b

d

DENV2

UV-DENV2 UV-DENV2DENV2

c

DENV2

UV-DENV2 UV-DENV2DENV2 UV-DENV2DENV2 UV-DENV2 DENV2

a

DENV2 UV-DENV2 0 2 4 6 8 20 80 25 20 15 10 5 0 60 40 20 0 15 10 5 0 IL-6 IL-8

E-Selectin VCAM-1 ICAM-1

E-Selectin VCAM-1 ICAM-1

0 2 4 6 8 No-ab MOI: 10 Infection treatment PBMCs and supernatant collection Activation markers: protein and gene expression

analysis α-TLR2 αTLR2 No-ab αTLR2 No-ab αTLR2 –2 h 0 hpi 0 hpi HUVEC 6 hpi 48 hpi PBMCs

MFI fold change to to control

mRNA fold change to

GAPDH

mRNA fold change to

GAPDH

mRNA fold change to

GAPDH 80 400 300 200 100 0 60 40 20 0

mRNA fold change to

GAPDH

mRNA fold change to

GAPDH 80 60 40 20 0

mRNA fold change to

GAPDH

mRNA fold change to

GAPDH

MCP-1 CXCL6

Fig. 4 Active DENV infection induces inflammatory mediators in a TLR2-dependent manner. a HUVEC were incubated for 6 h with cell-free supernatants from PBMCs infected in the presence or absence of TLR2 blockade.b Boxplots show the fold-changes in surface expression of E-selectin, VCAM-1 and ICAM-1 compared to the respective mock (n = 4, paired one-tailed t test, *P < 0.05; **P < 0.01). The horizontal line represents the median and the whiskers the minimum and maximum values.c Fold-changes in gene expression levels ofE-selectin, VCAM-1, and ICAM-1 relative to the respective mock (n = 2). d Fold-changes in gene expression levels of IL-6, IL-8, MCP-1, and CXCL6 relative to the respective mock (n = 2). N refers to the number of independent biological experiments in HUVEC. Source data are provided as a Source datafile.

(9)

ANOVA, Dunnett post hoc test), IFN-β (P < 0.05, one-way

ANOVA, Dunnett post hoc test) and IFN-λ1 (P < 0.01, one-way

ANOVA, Dunnett post hoc test) were significantly higher in the

supernatants from DENV2-infected PBMCs in comparison from

those of UV-DENV2-stimulated PBMCs (Supplementary Fig. 18),

while only a slight increase was observed for TNF-α, IL-6, IL-10

and IFN-γ (Supplementary Fig. 18). Additionally, UV-DENV2

also induced production of TNF-α, IL-1β, IL-6 and IFN-λ2/3

(Supplementary Fig. 18), however not as potently as the

replicative virus. Remarkably, blocking TLR2 and CD14 but not

TLR1/6 or the use of control antibody (Fig.

5

and Supplementary

Fig. 19), significantly decreased the production of IFN-β (P < 0.01,

one-way ANOVA, Dunnett post hoc test) and IFN-λ1 (P < 0.01)

induced by active DENV infection, while the production of

TNF-α was marginally reduced in these conditions (Fig.

5). The levels

of IFN-α2 were moderately reduced when blocking CD14 but not

when blocking other TLR2 (co-) receptors, while only the block of

TLR2 was able to reduce the levels of IP-10 (Fig.

5). The TLR2

axis block did not impair the levels of IL-1β, IL-6, IL-10, and

IFN-γ induced by DENV infection (Supplementary Fig. 20).

Alto-gether, these results support the DENV replication- dependent

and TLR2-mediated production of inflammatory mediators

capable to activate endothelial cells in vitro (Fig.

4) and highlight

that variety of pathways cross-talking following TLR2

axis-dependent and inaxis-dependent sensing of DENV infection. In

addition, it is important to note that the observed variations in

cytokine production following (UV-) DENV infections were

donor-

rather

than

virus

preparation-dependent,

further

αTLR1 αTLR6 αCD14 αTLR2 2500 400 300 200 100 0 Mock TNF-α IFN-β IP-10 IFN-α2 IFN-λ1 DENV2 2000 1500 1000 pg/mL pg/mL pg/mL pg/mL pg/mL 500 300 600 500 400 300 200 100 0 250 200 150 100 50 8000 6000 4000 2000 0 0 0 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + +

Fig. 5 TLR2/CD14-dependent cytokines induced by DENV2 infection. PBMCs from healthy donors were (mock)—treated with αTLR2, αTLR1, αTLR6 (5µg/mL) and αCD14 (3 µg/mL) for 2 h prior to infection with DENV2 at MOI of 20 for 48 h (n = 2, two different donors and 3 different DENV2 preparations, one-way ANOVA, Dunnett post hoc test, **P < 0.01). Cytokine production was measured by flow cytometry using LegendPlex. Each boxplot in the graphs shows the production in picograms per milliliter (pg/mL) of the respective cytokine. The horizontal line represents the mean and the bottom and top of the box show the minimum and the maximum values. Source data are provided as a Source datafile.

(10)

highlighting the inherent differences in TLR2-mediated sensing

of DENV infection between the overexpression system

HEK-Blue™ hTLR2 and primary monocytes, which are equipped with

multiple PRRs. Altogether, our data show that TLR2 sensing of

dengue virus infection induces production of inflammatory

mediators, which in turn can activate endothelial cells.

Discussion

By analyzing TLR2 expression and the frequencies of the different

monocyte subsets in a DENV-infected pediatric cohort, we

identified a prognostic value of TLR2 expression in disease

pathogenesis. We show that in children, DENV infection lead to

the overall decrease in the TLR2 expression on the surface of all

monocyte subsets when compared to age-matched HD. Notably,

the sustained relatively high expression of TLR2 in acute infection

on CM was associated with severe disease development while

profound reduction in TLR2 expression correlated with mild

disease. The functional analyses uncovered the ability of TLR2/6/

CD14 to sense DENV infection and to drive infection-mediated

inflammatory responses leading to activation of human vascular

endothelium. On the other hand, however, TLR2 and CD14

co-receptors increased the infected cell mass thereby revealing a

pro-viral role for TLR2. Altogether, our data provided evidence for the

critical and dual role of TLR2 in DENV infection and

infection-mediated immune responses.

Our data have identified TLR2 as a potent regulator of immune

responses following DENV infection. TLR2 together with TLR4

have been shown to play an important role in the induction of

inflammation during many infectious diseases

49

. For instance,

single-nucleotide polymorphisms occurring in the TLR2/1/6 axis

have been reported to influence the course of chlamydiosis,

leprosy and hepatitis B and C virus infections

50

. Notably, during

the course of DENV infection, TLR2 appears to have a both

protective and unfavorable role for the host. Although high

fre-quencies of TLR2-expressing CM correlated with severe disease,

the opposite trend, albeit less strong, was noted for non-classical

monocytes. The seemingly contrasting roles of TLR2 on CM and

NM are likely to be linked to their distinct functions. CM are

equipped with various PRRs and scavenger receptors that

recognize PAMPS, remove microorganisms, lipids, and dying cells

via phagocytosis and are thus, involved in sensing and inducing

inflammatory responses to stress-inducing factors. In contrast, NM

or patrolling monocytes have a unique role in protecting

endo-thelial integrity by removing damaged cells and debris. Moreover,

once activated, NM differentiate into anti-inflammatory

macro-phages to repair damaged tissues, thereby promoting wound

healing and the resolution of inflammation

51–54

. The functions of

TLR2 on these monocyte subsets may also be dictated by the

differential expression of CD14, CD16, TLR10, CD36

20,55–58

and/

or other receptors capable of modulating DENV infection and

DENV-infection-mediated responses

59,60

.

Changes in monocytes and monocyte subset distributions have

been associated with many inflammatory diseases, though their

relevance for disease pathogenesis is poorly understood

21,32,33

.

DENV infection has been shown to lead to an increase in

fre-quencies of IM (from ~5 in healthy to ~10 % in DENV patients)

accompanied by a modest decrease (~77% in healthy to ~63% in

frequencies of CM

21,33

. Based on their inflammatory makeup,

prevalence of CM and IM in the blood of DENV patients could be

linked to exacerbated inflammation and severe disease.

Interest-ingly, even though DENV infection increased the frequencies of

IM and NM compared to HD, this increase did not differentiate

between the severity groups. In fact, in our patient cohort, only

the increased frequency of CM correlated with severe disease

development. Notably however, in vitro, we observed a similar

shift in monocyte subsets distribution with UV-inactivated

DENV as with the infectious virus while only the latter led to

TLR2-mediated CD16 upregulation and release of inflammatory

mediators. Altogether, this suggests that changes in monocyte

distribution cannot be considered as a direct and a sole marker of

inflammatory responses.

Differential surface expression of TLR2 on CM of patients with

relatively mild disease symptoms (DF) and those who progressed

to severe disease (DHF/DSS) suggests a distinct regulation of

TLR2 expression in these patients. Based on our data and that of

others’

34

TLR2-axis-mediated NF-κB activation is partially

dependent on CME. Thus, the reduction of TLR2 expression on

the surface of CM during viremia observed in patients with DF

might indicate that activation of the DENV infection-mediated

TLR2 axis led to TLR2/ligand internalization, and ultimately

desensitization of the monocytes to TLR2-engaging PAMPs and

DAMPS

61

. In addition, TLR2 complex internalization might also

result in more balanced inflammatory and antiviral immune

responses, since internalization is required to induce IFN type I

producing signaling cascades

18

. At the same time, and

con-sidering the ability of TLR2 blockade to limit the number of

DENV-Ag-positive monocytes, it is internalization would also

impede the ability of the virus to infect these cells. Conversely, a

sustained relatively high TLR2 surface expression following

DENV infection, as seen on CM of patients that developed severe

disease, could be suggestive of a reduced internalization of the

TLR2 complex. In this scenario, prolonged sensing of TLR2—

engaging PAMPs and DAMPS would lead to mainly

pro-inflammatory responses and a relatively higher number of

infected monocytes. The exact mechanisms governing TLR2

expression following DENV sensing and/or infection remain to

be elucidated and will be the focus of our future studies.

Importantly, reduced TLR2 surface expression following infection

may also mirror the release of soluble TLR2, the levels of which

were shown to be elevated in some infection and inflammatory

conditions

62–64

. Moreover, plasma levels of soluble TLR2 were

found to be associated with a resolution of inflammation

64

.

The engagement of TLR2 was independent of the ability of

DENV to replicate and relied on the sensing of the viral particle

suggesting the involvement of structural proteins expressed on the

virus surface [E, (pr)M] in the engagement of this PRR rather than

any of the

five non-structural proteins (NS1- NS5). This is in stark

contrast to Chen et al., who attributed TLR2-mediated responses

following DENV infection to the NS1 protein

24

. Importantly,

subsequent studies have provided evidence that NS1 protein

engages with TLR4 instead of TLR2

25–27

. Interestingly, regardless

of Chen et al. results obtained with NS1 protein, their data from

DENV–infected TLR6 KO mice are in fact, in consonance with

our present

findings and corroborate the potentially unfavorable

for the host role of the TLR2 axis in DENV infection in vivo.

DENV produced in mosquito cells triggered stronger

TLR2-dependent NF-κB activation than the DC- and Mθ-derived virus.

This suggests that the virus transmitted during the blood meal is

likely to initiate and more significantly contribute to

TLR2-mediated inflammation. The reason for the differences in the

capacity to activate TLR2 axis depending on the virus origin is yet

unclear however is likely attributable to the host- and/or cell-type

specific modifications on the surface of the virus particle. For

instance, differential glycosylation patterns of two potential

N-linked glycosylation sites on the DENV E protein produced in

mosquito and primary human DCs influence their capacity to

interact with DENV receptors, DC-SIGN and L-SIGN, and thus

may dictate DENV tropism in vivo

65

. Interestingly, E protein is

not the only protein on the surface of the virion that can be

glycosylated. DENV prM protein contains a single glycosylation

site, and although prM is cleaved by furin during viral

(11)

maturation, a substantial fraction of uncleaved prM is present on

some DENV particles. In fact, DENV exists as a number of

dif-ferent viral forms depending on the degree of maturation. PrM

-containing fully immature and partially mature DENV virions

are particularly abundant in mosquito and mammalian tumor cell

lines-produced viral preparations

66,67

. On the other hand, DENV

produced in primary cells

68

and human circulating DENV1

vir-ions

69

seem to show a higher degree of maturity than those

produced in cell lines. Considering the reduced ability of human

primary cell derived DENV2 to engage TLR2 described in our

study, it will thus be important to address how both glycosylation

and maturation levels of the virions influence TLR2-mediated

responses during infection. Unfortunately, due to the limited

amount of sample obtained from our pediatric cohort, we could

not assess the effect of the human circulating virus in our in vitro

systems. However, we are currently assessing the role of

imma-ture dengue particles in our in vitro models.

The results obtained in PBMCs did not entirely mirror the

results obtained in HEK-Blue™ TLR2 cells since the UV-irradiated

virus preparation did not activate NF-κB to the same extent as the

replicative virus. The level of NF-κB/AP1 activation measured in

the reporter cell lines is unlikely to reflect the variety of different

immunomodulators that can be released down-stream of TLR2 in

primary immune cells. The differences in cytokine levels

pro-duced between active DENV infection and UV-DENV in PBMCs

may reflect the differential expression, as well as the crosstalk of

different PRR’s in sensing replicative and non-replicative virions,

which do not occur, or are not detectable in the NF-kB/AP-1

reported system

48,70

. Indeed, by UV-irradiating the virus, we

likely impeded the endosomal sensing of viral ssRNA by TLR7/8,

which ultimately might have affected the potentiating effect of

TLR2/7/8 cross talk

71

. Moreover, the TLR2/CD14-dependent

production of IFN-λ1, which has been described to be released by

dendritic cells in a TLR3 dependent manner

72

, may suggest the

possibility of TLR2/TLR3 cross talk

73

. Indeed, in human DC’s the

stimulation of TLR2 blocked the induction of cytokines that are

controlled by TLR3

47

. Further studies are required to elucidate

the cross talk of different PRR’s in the course of DENV infection.

Our study provides fundamental insights into the function of

TLR2 in the course of DENV infection, however some limitations

should also be considered. Nearly 74% of our cohort included

patients undergoing secondary infections implying that they had

pre-existing cross-reactive antibodies circulating in the blood at the

time of sampling. Our in vitro infection model, however, did not

address the infection enhancing or neutralizing effects of

dengue-specific antibodies on TLR2-mediated immune responses

60

. For

instance, the phenomenon of antibody-dependent enhancement

(ADE) of infection, postulating that sub neutralizing

concentra-tions of DENV-specific antibodies, can facilitate an additional

mode of entry, thereby enhancing DENV infection and the

aber-rant inflammatory responses seen in DHF/DSS patients.

Addi-tionally, the presence of DENV-Ab immunocomplexes is likely to

influence TLR2/CD14-mediated responses

60

. Lastly, considering

the role of TLR2 and TLR4 in detecting bacterial PAMPS, it will be

important to address the effect of common co-morbidities

including bacterial and parasitic co-infections or microbial

translocation

6,7,74,75

, on DENV pathogenesis and prognosis.

In conclusion, our data identified a fundamental role of cell

surface-expressed TLR2 as a regulator of inflammatory responses in

the course of DENV infection. DENV infection modulates TLR2

expression on monocytes, which depending on their co-stimulatory

markers contribute to infection-mediated inflammatory responses

that may underlie severe disease development. Consequently, our

study disclosed the TLR2 axis as a potential pharmacological target

which may mitigate the pathogenesis of severe disease. Finally,

sustained high expression of TLR2 in DENV patients that progress

to severe disease indicate a potential prognostic value of TLR2 on

blood monocytes.

Methods

Ethics statement. Ethical approval was obtained from the National Ethics Com-mittee of Health Research of Cambodia. Written informed consent was obtained from all participants or the guardians of participants under 16 years of age before inclusion in the study.

DENV patient recruitment. Blood samples were obtained from hospitalized children (≥2 years) who presented with dengue-like symptoms at the Kanta Bopha Hospital in Phnom Penh, Cambodia. The time-point for collection of blood samples was within 96 h of appearance of fever in the patient. A second blood sample was collected upon discharge from the hospital. Patients were classified according to the WHO 1997 criteria upon hospital discharge2. Plasma leakage was

confirmed by at least one of the following manifestations: 1/ a rise in the hematocrit equal to or >20% above average for age, sex and population in the admission sample (reference percentages: http://www.hematocell.fr/index.php/les-cellules-du-

sang/15-les-cellules-du-sang-et-de-la-moelle-osseuse/valeurs-normales-de-lhemogramme-selon-lage/129-hemogramme-selon-lage) or 2/A drop in the

hematocrit following volume-replacement treatment equal to or >20% of baseline and follow up visit or discharge (between 1 and 3 days after initial sample) or 3/Signs of plasma leakage such as pleural effusion and ascites by ultrasound.

Laboratory diagnosis. Serum specimens were tested for presence of DENV using nested qRT-PCR at the Institut Pasteur in Cambodia, the National Reference Center for arboviral diseases in Cambodia76. NS1 positivity was determined using rapid

diagnostic tests (combo test for NS1 and IgM/IgG detection, SD Bioline Dengue Duo kits from Standard Diagnostics—Kyonggi-do, Korea). Anti-DENV IgM was measured with an in-house IgM-capture ELISA (MAC-ELISA), as previously described77. Patients were diagnosed as acute DENV-infected as following: a

posi-tive qRT-PCR or NS1 at hospital admission, or seroconversion from anti-DENV IgM negative to anti-DENV IgM positive during the hospital stay. Samples from patients positive for DENV were further tested with hemagglutination inhibition (HI) test to determine primary/secondary DENV infection as per WHO criteria2.

Patient PBMC phenotyping. Human peripheral blood mononuclear cells (PBMCs) were isolated from blood samples of DENV-positive patients and age-matched healthy controls using Ficoll-Paque density gradient centrifugation and frozen in 10% DMSO until analysis. PBMCs were thawed in RPMI supplemented with fetal bovine serum (FBS), washed and counted in phosphate-buffered saline/ bovine serum albumin. PBMCs were stained for surface markers using the fol-lowing antibodies: TLR2 PE (1:25, clone TL2-1, #309707), CD14 APC (1:50, clone 63D3, #467117), CD16 PE-Cy7 (1:250, clone 3G8, #302016), CD19 AF488 (1:50, clone HIB19, #302219), CD3 BV510 (1:50, clone OKT3, #317332), CD4 PerCP/ Cy5.5 (1:50, clone OKT4, #317428), CD45RO APC-Cy7 (1:25, clone UCHLI, #304228) and CD56 BV421 (1:25, clone 5.1H11, #362552), all purchased from BioLegend, and analysed on a FACSCanto II (BD). Isotype-matched antibody labelled with PE (1:25, clone MOPC-173, #400211, BioLegend) was used as negative control for comparing TLR2 expression. Due to the inability of the DENV envelope-directed 4G2 antibody (Millipore) to detect virus infection in our patients’ PBMCs, we used the recently characterized rabbit polyclonal anti-DENV NS3 antibody. The anti-NS3 staining panel was only performed on a subset of patients as more PBMC are required for a good quality intracellular staining. Sufficient cell yield after PBMC thawing was used as selection criteria to perform the staining. Briefly, PBMCs were fixed and permeabilized using True nuclear transcription factor buffer set (BioLegend) and stained intracellularly using a rabbit anti-DENV NS3 antibody (10 µg/mL, #GTX124252, GeneTex) or rabbit IgG Iso-type control (10 µg/mL, #910801, BioLegend) followed by goat anti-rabbit IgG conjugated with AF488 (1:500, #ab150077, Abcam). Data were analyzed using the FlowJo software (BD Biosciences).

Cells. PBMCs were isolated by standard density gradient centrifugation procedures with Ficoll-Paque™ Plus (GE Healthcare) from buffy coats obtained with written informed consent from healthy, anonymous volunteers, in line with the declaration on Helsinki (Sanquin Bloodbank, Groningen, the Netherlands). The PBMCs were cryopreserved at−196 °C. Aedes albopictus C6/36 cells were maintained in MEM supplemented with 10% FBS, 25 mM HEPES, 7.5% sodium bicarbonate, penicillin (100 U/mL), streptomycin (100μg/mL), 200 mM glutamine and 100 µM non-essential amino acids at 30 °C. HEK-Blue™ hTLR2, Blue™ hTLR4 and HEK-Blue™ Null2 cell lines (InvivoGen) were cultured in DMEM supplemented with FBS, penicillin (100 U/mL), streptomycin (100μg/mL) and maintained according to the manufacturer’s instructions. VERO-E6 and VERO-WHO were cultured as the HEK cells with the addition of 10 mM HEPES and 200 mM glutamine. BHK-15 were cultured as the VERO cells with the addition of 100μM of non-essential amino acids. Primary human umbilical vein endothelial cells (HUVEC) (Lonza, the Netherlands) were cultured in EBM-2 supplemented with EGM-2 endothelial growth SingleQuot kit supplement & growth factors (Lonza, the Netherlands). All

(12)

of the cell lines used in our experiments were tested negative for the presence of Mycoplasma spp. using a commercial functional method (Lonza, the Netherlands) and/or in-house qPCR assay adapted from Baronti et al.78.

Viruses. DENV1 (strains 16007, Hawaii), DENV2 (strains 16681, NGC, TSVO1), DENV3 (strains H87, 16562) and DENV4 (strains 1036, H241), were produced in the Aedes albopictus C6/36 cell line as described before79. Briefly, and 80%

con-fluent monolayer of cells was infected at multiplicity of infection (MOI) of 0.1. Depending on the serotype, virus progeny was harvested at 72 or 168 h post infection (hpi). Purification was performed as described by Ayala-Nuñez et al.35.

WNV strain NY99 was propagated in Vero cells as described before80. CHIKV (La

Reunion OPY1) was a gift from A. Merits (University of Tartu, Estonia), and was produced from infectious cDNA clones and passaged twice in Vero E6 cells81.

ZIKV (SL0216) was a gift from M.J. van Hemert (LUMC, the Netherlands); virus was produced in Vero E6 cells and harvested at 72hpi. Viral preparations were analyzed with respect to the infectious titer and the number of genome equivalents copies. The infectivity of DENV and WNV were determined by measuring the number of plaque-forming units (PFU) by plaque assay on BHK-15 cells and the number of genome-equivalent copies (GEc) by quantitative RT-PCR (RT-qPCR), as described previously82,83. For CHIKV and ZIKV, the infectious virus titer was

determined by standard plaque assay on Vero-WHO and Vero E6 cells, respec-tively and for CHIKV, reverse transcriptase quantitative PCR (RT-qPCR) was used to determine the number of genome equivalents copies (GEc)84. Virus inactivation

was performed by 1.5 h incubation of virus aliquots under UVS-28.8 watt Lamp. Inactivation to below level of detection 35 PFU/mL was confirmed using standard plaque assay on BHK-15 cells as described previously84. Briefly, for plaque assays,

cells were seeded in a 12-well plate. In all, 24 h later, cells were infected with 10-fold serial dilutions of the viral samples. At 2hpi cells were overlaid with 1% seaplaque agarose (Lonza, Swiss) prepared in 2x MEM. Plaques were counted at 44hpi for CHIKV, 72hpi for ZIKV and WNV, and 120hpi for DENVs. GEc were determined via RT-qPCR using a StepOne Real-Time PCR instrument (Applied Biosystems, Foster City, CA, USA). RNA extraction was performed using a QIAmp viral RNA mini kit (QIAGEN, Venlo, The Netherlands). cDNA synthesis from viral RNA was performed using Omniscript (QIAGEN) and the primers 5′-ACAGGCTATGGCA CTGTTACGAT-3′ (forward), 5′-TGCAGCAACACCATCTCATTG-3′ (reverse) for DENV, 5′AGCTCCGCGTCCTTTACCA-3′ (forward), 5′-GCCAAATTGT CCTGGTCTTCCT-3′ (reverse) for CHIKV, and (5′-GTTGGCGGCTGTTTTCT TTC-3′ (forward), 5′-GGGATCTCCCAGAGCAGAATT-3′ (reverse) for WNV. For qPCR the TaqMan probes 5′-FAM-AGTGCTCTCCAAGAACGGGCCTCG-T AMRA-3′, 5′-FAMCACTGTAACTGCCTATGCAAACGGCGAC-TAMRA-3′ and 5′-FAM–AATGGCTTATCACGATGCCCGCC–TAMRA-3′ (Eurogentec, Maas-tricht, The Netherlands) were used for DENVs, CHIKV and WNV, respectively. DNA amplification was performed for 40 cycles of 15 s at 95 °C and 60 s at 60 °C. The number of GEC was determined using a standard curve (correlation coeffi-cient > 0.995) of a quantified cDNA plasmid containing either the DENV prM and E sequence, the CHIKV E1 sequence or the non-structural genes of WNV NY99. All virus preparations used in this study were tested negative for Mycoplasma spp. using a commercial functional method (Lonza, the Netherlands) and/or in-house qPCR assay adapted from Baronti et al.78.

In vitro infections. PBMCs (1 × 106cell/mL) or HEK (5 × 104cells/mL) cells were

treated with 5μg/mL or 15 μg/mL, respectively of anti-hTLR2-IgA (clone B4H2, #maba2-htlr2), pab-hTLR6-IgG (polyclonal, #pab-hstlr6), pab-hTLR1-IgG (poly-clonal, #pab-hstlr1), anti-hCD14-IgA (clone D3B8, #maba-hcd14), human IgA2 isotype control (clone T9C6, #maba2-ctrl) or normal rat PAb IgG control blocking antibodies (InvivoGen, #pab-sctr) for 2 h followed by treatment with PAM3CSK4 (600 ng/mL, InvivoGen), LPS (1μg/mL, InvivoGen), DENV2 (MOI of 10 or its equivalent number of GEc (MOG of 1000) and UV-I DENV2 (MOG 1000 or MOG 3500) for 4, 6, 18, 24, 48, and 72 h). Since the production anti-hCD14IgA (clone B4H2) was discontinued, in experiments assessing the role of CD14 in DENV-infection, anti-hCD14-IgG (clone D3B8, #mabg-hcd14) and its Human IgG1 iso-type control were used (#bgal-mab1, both from InvivoGen). For viral production analysis, cells were washed after infection and media replenished (600 µL), 24 h later supernatants were collected and preserved at−80 °C. For endothelial cells activation analysis, cell-free supernatants were collected at 4, 24, 48, and 72 h post infection/treatment and preserved at−80 °C.

Monocyte subsets, TLR2 expression, and intracellular cytokines measure-ments. Surface expression of TLR2, CD14 and CD16 was measured on PBMCs directly after thawing of the cells, after treatments with the blocking antibodies but prior to infection and 24 and 48 h post infection/treatment with the agonists. Briefly, PBMCs were stained with Fixable Viability Dye eFluor 780 (1:500, #65-0865), CD282 (TLR2) PE (1:10, clone TL2.1, #12-9922-41), CD14 eFluor 450 (1:20, clone 613D, #48-0149-41) and CD16 APC (1:20, clone CB16, #17-0168-41). All purchased from eBioscience. Cells werefixed and washed with FACs buffer (PBS 1x, 2% FBS). Intracellular accumulation of TNF-α and IL-1β was measured at 6 h and 18 h post infection/treatment, respectively. Briefly, Brefeldin A (10 μg/mL, BioLegend) was added 6 h prior cytokine detection. PBMCs where then incubated withfixable viability dye eFluor 780. Cells were fixed, permeabilized and

intracellularly stained with TNF-α eFluor 450 (1:10, clone MAb11, #48-7349-41) or IL-1β FITC (1:5, clone B-A15, #BMS127FI), both from eBioscience. Samples were measured on a FACSverseflow cytometer (BD Biosciences). Isotype-matched antibodies labelled with PE (1:10, clone eBM2a), eFluor 450 (1:20, clone P3.6.2.8.1), APC (1:20, clone P3.6.2.8.1) and FITC (1:5, clone P3.6.2.8.1) (eBioscience) were used as controls to compare the expression of each marker. Data were analyzed using the Flowjo software (BD Biosciences).

NF-κB reporter assay. Human embryonic kidney reporter cell lines (HEK-Blue™ hTLR2 and HEK-Blue™ Null2 cells; 5 × 104cells/well) were infected or treated as

described in previous sections in a 96-wellflat bottom plate for 24 h at 37 °C, 5% CO2 atmosphere. To test if endocytosis is required for NF-κB stimulation, wort-mannin (Sigma Aldrich), pitstop 2 (Sigma Aldrich), dynasore (Sigma Aldrich), chloroquine (Sigma Aldrich), chlorpromazine (Sigma Aldrich) or ammonium chloride (NH4Cl, Merck) were added 1 h before infection or treatment with the agonist. After 24 h post infection or treatment, analysis of NF-κB stimulation was assessed by mixing the supernatants with QUANTI-Blue™ (InvivoGen). Absor-bance was measured at 630 nm using Synergy™ HT multi-mode microplate reader (BIOTEK). PAM3CSK4 (25 ng/mL) and PAM2CSK4 (1 ng/mL) were used as positive controls for hTLR2 cells, TNF-α (50 ng/mL, InvivoGen) for positive control in Null2 cells, and LPS (10 ng/mL) as a positive control for hTLR4 cells.

In vitro infection frequency and titration analyses. DENV infection was mea-sured by intracellular detection of the envelope E virus protein. Briefly, cells were stained intracellularly using a mouse anti-DENV E antibody (1:800, clone D1-4G2-4-15, Millipore, #MAB10216) followed by rabbit anti-mouse IgG-coupled to AF647 (1:2000, ThermoFisher, #A-21446). Unstained cells, mock-infected cells plus ondary antibody, mock-infected plus detection pair and infected cells plus sec-ondary antibody were included as controls in every experiment. UV-DENV was used as a control in PBMCs. Samples were measured on a FACSverse cytometer (BD Biosciences) and data were analyzed with Flowjo (BD Biosciences). For viral production, supernatants from infected HEK-Blue™ hTLR2 and human PBMC’s were analyzed by plaque assay and RT-qPCR as previously described82,83.

Endothelial cell activation assay. HUVEC were incubated with cell-free super-natants from infected and/or pre-treated PBMCs. In addition, direct DENV2 infection, exposure to UV-DENV2, RPMI media and TLR2/4 agonists PAM3CSK4 and LPS, served as controls. After 6 h of stimulation, cells were either lysed and stored at−20 °C for gene expression analysis or used directly for the expression analysis of activation markers using FACS. For FACS, cells were stained with the following antibodies CD62E E-selectin PE (1:100, clone HCD62E, #322606), CD106 VCAM-1 APC (1:100, clone STA, #305810) and CD54 ICAM-1 FITC (1:100, clone HCD54, #322720). Isotype-matched controls labelled with PE (1:100, clone RMG2a-62, #407107), APC (1:100, clone RMG1-1, #406609) and FITC (1:100, clone RMG1-1, #406605) were used as negative controls for comparing E-selectin, VCAM-1 and ICAM-1 expression, respectively. All surface staining antibodies were from BioLegend. Data were collected using a MACSQuant cyt-ometer (Miltenyi Biotec) and analyzed using the Flowjo software (BD Biosciences). For gene expression analysis, total RNA was isolated from HUVEC using a RNeasy Plus Mini Kit (Qiagen, Leusden, The Netherlands), according to the manufacturer’s instructions. RNA integrity was checked, cDNA synthesized and RT-qPCR per-formed using the ViiA 7 system (Applied Biosystems/ThermoFisher Scientific) as previously described85. Assay on demand primers were from Applied Biosystems

(Nieuwerkerk aan de IJssel, The Netherlands) included GADPH (Glyceraldehyde-3-phosphate dehydrogenase, Hs99999905_m1), E-selectin (Hs00174057_m1), VCAM-1 (vascular cell adhesion molecule-VCAM-1, Hs00365486_mVCAM-1), ICAM-VCAM-1 (intracellular adhesion molecule-1, Hs00164932_m1), IL-6 (Interleukin-6, Hs00174131_m1), IL-8 (Interleukin-8, Hs00174103_m1), MCP-1 (Monocyte chemotactic protein-1, Hs00234140_m1), CXCL6 (C-X-C Motif Chemokine Ligand 6, Hs00605742_g1). Duplicate real-time PCR analyses were performed for each sample, and the obtained threshold cycle (CT) values were averaged. Gene expression was nor-malized to the expression of housekeeping gene (GAPDH) resulting in theΔCT value. The relative mRNA level was calculated by 2−ΔCT.

Cytokine and chemokine determination. Protein levels of IL-1β, TNF-α, IL-6, IL-8, IL-10, IL-12p70, IP-10, GM-CSF, IFN-α2, IFN-β, IFN-γ, IFN-λ1, and IFN-λ2/3 were determined in cell-free supernatants using the human anti-virus response panel (13-plex, LEGENDplex™, BioLegend, #740390). Data were collected using a FACSverse flow cytometer (BD Biosciences) and analyzed using LEGENDplex™ v8.0 (BioLegend). Statistical analysis. Data analysis was performed using Prism 6.01 (Graphpad, USA). For patients’ data analysis two-tailed Mann–Whitney test was used to compare the data between groups where a p < 0.05 was considered significant. Unless indicated otherwise, data are shown as media ± SD or SEM. One-way Anova followed by Dunnet’s post hoc test was used for comparisons vs experimental controls. Paired one-tailed Student’s t-test, unpaired one-tailed Student’s t-test or two-tailed Mann–Whitney test were used to determine statistical significance of single experimental results. Correlations were determined by Pearson or Spearman

Références

Documents relatifs

A part les grandes psychopathologies connues, Binswanger a individualisé des vécus faisant ainsi apparaître la classification en elle- même comme « l’égarement », la « fuite

VOTRE TRAVAIL: Si vous faites un métier en lien avec la création, les arts ou la communication, ce mois est fait pour vous, tant vous serez performant, prin- cipalement.

[r]

Zunächst nimmt sich der Grundsatz- beitrag von Dietl einer Frage an, mit der sich die Sportökonomie schon seit gerau- mer Zeit beschäftigt (und sicher noch wei- ter beschäftigen

collect information from the instructors about RQ3a (What are the instructors’ goals regarding measurement and uncertainty teaching?) and RQ3b (How do instructors

Using one of these mAbs, named 1H11, pTLR2 was found on cells of the innate immune system, including monocytes, macrophages, and granulocytes, but not on pe- ripheral

We analyzed and compared the gene expression profiles of paired CD14 + monocyte samples and corresponding adipose tissue samples before and after lifestyle-induced weight loss

Rectal temperatures (A), percentage of D110-positive monocytes in dogs of group III (severe clinical signs with demyelinating lesions due to CDV infection in