TLR2 on blood monocytes senses dengue virus
infection and its expression correlates with disease
pathogenesis
José A. Aguilar-Briseño
1,6
, Vinit Upasani
1,2
, Bram M. ter Ellen
1
, Jill Moser
3
, Mindaugas Pauzuolis
1
,
Mariana Ruiz-Silva
1
, Sothy Heng
4
, Denis Laurent
4
, Rithy Choeung
5
, Philippe Dussart
5
, Tineke Cantaert
2
✉
,
Jolanda M. Smit
1
& Izabela A. Rodenhuis-Zybert
1
✉
Vascular permeability and plasma leakage are immune-pathologies of severe dengue virus
(DENV) infection, but the mechanisms underlying the exacerbated in
flammation during
DENV pathogenesis are unclear. Here, we demonstrate that TLR2, together with its
co-receptors CD14 and TLR6, is an innate sensor of DENV particles inducing in
flammatory
cytokine expression and impairing vascular integrity in vitro. Blocking TLR2 prior to DENV
infection in vitro abrogates NF-
κB activation while CD14 and TLR6 block has a moderate
effect. Moreover, TLR2 block prior to DENV infection of peripheral blood mononuclear cells
prevents activation of human vascular endothelium, suggesting a potential role of the
TLR2-responses in vascular integrity. TLR2 expression on CD14
+ + classical monocytes isolated in
an acute phase from DENV-infected pediatric patients correlates with severe disease
development. Altogether, these data identify a role for TLR2 in DENV infection and provide
insights into the complex interaction between the virus and innate receptors that may
underlie disease pathogenesis.
https://doi.org/10.1038/s41467-020-16849-7
OPEN
1Department of Medical Microbiology and Infection Prevention, University of Groningen and University Medical Center Groningen, 9700 RB Groningen, The
Netherlands.2Immunology Group, Institut Pasteur du Cambodge, International Network of Pasteur Institutes, Phnom Penh 12201, Cambodia.3Departments of Critical Care, Pathology & Medical Biology, Medical Biology section, University Medical Center Groningen, University of Groningen, 9700 RB Groningen, The Netherlands.4Kantha Bopha Hospital, Phnom Penh 12000, Cambodia.5Virology Unit, Institut Pasteur du Cambodge, International Network of Pasteur
Institutes, Phnom Penh 12201, Cambodia.6Present address: Department of Microbiology and Immunology, University of Iowa, Iowa City, IA 52242, USA.
✉email:[email protected];[email protected]
123456789
T
he four serotypes of dengue virus (DENV1-4) are
esti-mated to cause 390 million infections per year, of which 96
million manifest clinically
1. Clinical outcomes of DENV
infection vary considerably and can be either limited to an acute
febrile illness referred to as dengue fever (DF), or progress to a
potentially fatal disease (severe dengue) encompassing dengue
hemorrhagic fever (DHF) and dengue shock syndrome (DSS)
2.
Severe disease is associated with a transient increase in vascular
permeability due to endothelial dysfunction initiated by increased
levels of soluble inflammatory mediators, such as IL-1β and
TNF-α, released early in the course of infection
3,4. Factors exacerbating
inflammation such as high viral titers and presence of
cross-reactive, infection-enhancing antibodies raised from previous
infection with another serotype, increase the risk of severe
dis-ease
5–7. The mechanisms governing the initiation of excessive
inflammation however, remain poorly understood. Consequently,
there is currently no diagnostic marker indicative of severe
dis-ease nor specific treatment options available for DENV patients.
Cells of the innate immune system together with epithelial and
endothelial cells are responsible for the early activation of
inflam-matory responses to invading pathogens. Pattern-recognition
receptors (PRRs) expressed on these cells detect and respond to a
variety of pathogen-associated molecular patterns (PAMPs) as well
as to tissue-derived danger associated molecular patterns (DAMPs),
released from stressed or dying cells. Upon engagement, PRRs
activate intracellular signaling cascades inducing pro-inflammatory
responses
8. Regulation of this response is crucial, since exacerbated
release of pro-inflammatory mediators is known to trigger adverse
effects including excessive endothelial inflammatory activation,
vascular permeability and hemorrhagic manifestations such as those
seen in severe dengue patients
9–11.
Toll-like receptor 2 (TLR2) is one of the PRRs expressed on the
surface of immune cells. Although generally known as a sensor of
bacterial lipoproteins, TLR2 can also sense molecular patterns of
viruses
12–18. The ligand-binding specificity of TLR2 is modulated
by its heterodimerization partners: TLR1 or TLR6 and
co-stimulatory molecules CD14 and CD36
8,19,20. Engagement of the
TLR2 axis leads to activation of NF-κB pathway, increased gene
expression and release of inflammation-driving mediators such as
inter alia IL-1β and TNF-α. In human blood, expression and
activation of TLR2 has been shown to regulate the function of
many cell types including those representing early targets of
DENV replication, such as dendritic cells (DC’s) and
mono-cytes
21–23. Chen et al., attributed TLR2-activation following
DENV infection to one of the nonstructural viral proteins,
non-structural protein 1 (NS1) that is released from cells replicating
the virus
24. Notably, however, subsequent studies by two
inde-pendent groups debated Chen’s data demonstrating that NS1
protein in fact engages TLR4 instead of TLR2
25–27and indicated
that the conclusions were compromised due to the use of impure
and misfolded Escherichia coli-derived recombinant NS1
26. Thus,
to date, the mechanism and significance of TLR2-upregulation in
the context of DENV pathogenesis remains unknown.
In the current study, we examine TLR2 expression on PBMCs
isolated from 54 pediatric patients in the acute phase of DENV
infection with different disease outcomes. Furthermore, using an
in vitro PBMC infection and human vascular endothelium
acti-vation models, we investigate the function of TLR2 during DENV
infection. Altogether, our results identify TLR2 as a key regulator
of DENV-induced inflammation and a prognostic marker of
immunopathology.
Results
TLR2 on monocytes of acute patients correlates with disease
severity. Circulating monocytes represent a versatile and dynamic
cell population, composed of multiple subsets which differ in
phenotype, and function
28,29. In humans, these discrete monocyte
subsets can be distinguished by the expression of CD14 and
CD16
28. CD14
++CD16
−classical monocytes (CM) make up
∼85% of the circulating monocyte pool, whereas the remaining
∼15% consist of CD14
++CD16
+intermediate (IM) and CD14
+CD16
++non-classical monocytes (NM)
30,31. Importantly, their
frequencies are influenced by inflammatory conditions
32.
Pre-vious studies have shown that DENV infection in vivo increased
frequencies of either IM or NM
21,33. In line with previous studies,
our patient cohort showed an overall increase in IM and NM
when compared to age-matched healthy controls (Fig.
1a and
Supplementary Fig. 1a). In addition, Azeredo et al.
21demon-strated increased TLR2 expression on blood monocytes in
DENV-infected patients when compared to healthy controls yet
how TLR2 is distributed over the three monocyte subsets and its
potential impact on disease burden remain elusive
21,24. To
investigate this, we isolated PBMCs from DENV-infected patients
during the acute phase of infection (n
= 54) and 15 age-matched
healthy donors (HD) and subsequently stained with an
anti-human TLR2 antibody or a conjugated isotype-matched antibody
as a control (Supplementary Fig. 1b). Patients were classified for
disease severity according to the WHO 1997 guidelines as
spe-cified in Methods section and their characteristics are listed in
Table
1. We proceeded to determine DENV infection in
mono-cyte subsets. To ensure detection of active DENV replication,
rather than viral uptake, we used a rabbit polyclonal antibody
against DENV non-structural protein 3 (NS3) and subsequently a
secondary antibody labeled with FITC. A non-specific rabbit
polyclonal antibody along with the same secondary antibody was
used as a negative control (Supplementary Fig. 2a, b). The
anti-NS3 staining was only performed on a subset of patient samples
that had a sufficient cell yield after PBMC thawing to perform a
good quality intracellular staining (n
= 15). In line with the above
studies, immunophenotyping of patients’ PBMCs showed that
both CM and IM had significantly higher expression (p < 0.0001,
two-tailed Mann–Whitney test) of TLR2 on their surface
com-pared to NM (Fig.
1b). However, when TLR2 expression in
DENV+ patients was compared to HD, all monocyte subsets
from HDs had significantly higher TLR2 expression (p < 0.0001,
two-tailed Mann–Whitney test) compared to DENV+ patients
(Fig.
1b). As the expression of TLR2 on monocytes during the
acute phase of DENV infection could vary according to the days
post-fever, we classified the DENV-positive patients according to
the number of days post-fever (day 2–5). TLR2 expression on
CM, IM and NM was not dependent on the number of days post
fever that the samples were obtained (Supplementary Fig. 3).
Interestingly, CM from patients who developed DHF/DSS
showed significantly higher expression of TLR2 when compared
to patients with mild disease (DF) (p < 0.01, two-tailed
Mann–Whitney test). No differences were observed for IM
while for NM, patients with severe dengue had marginally lower
percentage of TLR2 compared to DF patients (p < 0.05, two-tailed
Mann–Whitney test) (Fig.
1c). Similar results were yielded when
TLR2 expression was stratified based on the infecting serotype;
CM from patients who developed DHF/DSS following DENV1
and DENV2 infections showed significantly higher expression of
TLR2 when compared to those who developed DF (P < 0.05,
two-tailed Mann–Whitney test) (Supplementary Fig. 4a, b,
respec-tively) while no differences were observed for IM and NM
(Supplementary Fig. 4). Unfortunately, there were not enough
patients to evaluate the correlation between TLR2 expression and
disease severity following DENV serotypes 3 and 4. Notably, CM
and IM, but not NM, were the primary targets of DENV
repli-cation as measured by the percentage of cells positive for DENV
NS3 (Fig.
1d). The percentage of CM predominated in patients
a
c
b
d
e
0 25 50 75 100 0 25 50 75 100 CM IM NM CM IM NM 0 20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100 % of monoc yte p o p u lati on % of monoc yte p o p u lati on % TLR2 positive cells % TLR2 positive cells % NS3 positive cells CM IM NM HD DENV+ DF DHF/DSS CM IM NM CM IM NMFig. 1 Sustained high expression of TLR2 and increased frequency of monocytes correlates with DENV disease severity. a–e PBMCs were isolated from 15 age-matched healthy donors (HD) and 54 patients undergoing acute DENV infection (DENV+) who developed relatively mild (DF, n = 32) or severe (DHF/DSS,n = 22) disease. a Monocyte subsets distribution in healthy and DENV+ patients (two-tailed Mann–Whitney test, ****P < 0.0001). b Percentages of cells expressing TLR2 were determined for each monocyte subset (two-tailed Mann–Whitney test, ****P < 0.0001) and c stratified by disease severity (two-tailed Mann–Whitney test, *P < 0.05; **P < 0.01). d Percentages of NS3+ infected cells in DENV-positive patients (n = 15) stained intracellularly for DENV NS3 (two-tailed Mann–Whitney test, ***P < 0.001; ****P < 0.0001). e Monocyte subsets distribution in patients, stratified by disease severity (two-tailed Mann–Whitney test, *P < 0.05). CM classical monocytes, IM intermediate monocytes, NM non-classical monocytes. Bars represent median with interquartile range (IQR). Source data are provided as a Source datafile.
that developed severe disease (p < 0.5, two-tailed Mann–Whitney
test) while there were no significant changes in the percentages of
IM. In addition, patients that developed DF had a moderately
increased percentage of NM (P < 0.5, two-tailed Mann–Whitney
test) (Fig.
1e). Altogether, these data suggest that sustained high
levels of TLR2 on CM during the acute phase of DENV infection
are associated with severe disease development.
DENV2 engages TLR2/6 and CD14 to trigger NF-
κB activation.
To investigate if TLR2 plays a role during DENV infection, we
first
assessed whether TLR2 is able to sense DENV particles. To this end,
we used reporter cells HEK-Blue™ hTLR2 cells (InvivoGen) that
stably co-overexpress human TLR2/6/1, CD14 and
NF-κB/AP1-inducible SEAP (secreted embryonic alkaline phosphatase) genes.
Stimulation of TLR2 is monitored by the activation of NF-κB/AP1.
Synthetic lipopeptides PAM3CSK4 (PAM3) and PAM2CSK4
(PAM2), potent agonists of TLR2/1/CD14 and TLR2/6,
respec-tively, were used as positive controls in the assays. Interestingly, we
observed that DENV2 strain 16681 induces activation of
HEK-Blue™ hTLR2 cells (Fig.
2a) but not the parental HEK-Blue™
Null1 cells (Supplementary Fig. 5a). As shown in Fig.
2a, NF-κB
activation
was
not
dependent
on
viral
replication
as
UV-inactivation of the virus (UV-DENV) did not abrogate the
sensing, and increased with viral dose (Supplementary Fig. 5b).
Moreover, purified DENV virions [pDENV] activated NF-κB
demonstrating that molecular patterns present on the surface of
the virus particles eg. (pr)M/E proteins rather than a soluble factor
are responsible for the activation. DENV-mediated NF-κB activity
was significantly inhibited upon blocking the TLR2 receptor (p <
0.0001, paired one-tailed t test) and significantly attenuated by
blockage of the TLR2 co-receptors: TLR6 and CD14 (p < 0.001,
one-way ANOVA, Dunnett post hoc test) (Fig.
2b, c). Importantly,
PAM3 and our standard DENV preparations did not activate
HEK-Blue™ hTLR4 cells (Supplementary Fig. 5c, d), which only
respon-ded to LPS and TNF-α treatments. These results confirm the
spe-cificity of the HEK-TLR Blue system employed and imply that the
soluble form of DENV nonstructural protein 1 (NS1), previously
shown to signal through TLR4
25,26, was not a confounding factor in
our experiments.
To evaluate the capacity of mosquito and human-derived
DENV to engage TLR2, we next compared the ability of DENV-2
16681 produced in mosquito C6/36 cells to activate NF-κB in the
HEK-Blue™ hTLR2 cells with that produced on monocyte-derived
DC’s and monocyte-derived macrophages (Mϕ). The
human-derived viruses were obtained by infecting monocyte-human-derived DC’s
and monocyte-derived Mϕ with C6/36-derived virus for 2 h, after
which the surplus of inoculating virus and incubation was
continued until 48hpi. Following titrations of DC-and Mϕ -derived
DENV2 preparations, HEK-Blue™ hTLR2 cells were exposed to
increasing numbers of virus particles i.e. multiplicity of genomes
(MOGs) to ensure fair comparison. Interestingly, DC-derived
DENV2 induced NF-κB activation on hTLR2 cells albeit ~3× lower
than the C6/36-derived virus at a similar MOG (Supplementary
Fig. 5b), suggesting that the structural differences between human
and mosquito-derived viruses modulate the TLR2 recognition.
Notably however, Mϕ-produced DENV2 did not induce NF-κB
activation at any of MOG tested, implying that TLR2 engagement
may be sensitive to changes in virion characteristics that are not
intrinsic to mosquito or human cells, but are cell-type specific. It is
important to mention however that due to the overall lower yield
of DENV released by macrophages, MOG of 4000 could not be
reached and thus more in-depth studies are needed to test the
premise of intra-host cell type-specific factors influencing TLR2
activation by DENV. Altogether, our data revealed that TLR2 has
the capacity to sense DENV virions.
While expressed at the plasma membrane, TLR2-induced
NF-κB activation is controlled by clathrin-mediated endocytosis
(CME), in which CD14 serves as an important upstream
regulator
34. Accordingly, we used not-toxic concentrations of
various perturbants of endocytic pathways, to dissect whether
CME is required for TLR2 to sense DENV. Specifically, pit-stop
(PS), an inhibitor of clathrin-pit formation was used to inhibit
CME, NH
4Cl was used to neutralize the pH of intracellular
compartments; wortmannin (W), a PI3K inhibitor affecting
phagocytosis and macropinocytosis served as a negative control
35.
Chloroquine, chlorpromazine and dynasore were excluded from
the experiments due to their high level of cytotoxicity
(Supplementary Fig. 6). PS and NH
4Cl significantly reduced but
did not abrogate NF-κB activation mediated by PAM3 (p < 0.05,
one-way ANOVA, Dunnett post hoc test) and DENV (p < 0.05,
one-way ANOVA, Dunnett post hoc test), whereas no significant
effect was seen for PAM2 (Fig.
2d). As expected, wortmannin
treatment did not alter TLR2-mediated NF-κB activation by any
of the agonists. Thus, activation of TLR2/6/CD14 axis by DENV
Table 1 Demographic data and clinical parameters of the studied population.
Studied population Total patients (n = 54) DFN = 32 DHF/DSS 22 (DHF−12; DSS−10) Healthy donors (n = 15) Age 8.14 ± 4.01 8.29 ± 4.29 7.29 ± 3.67 10.08 ± 4.06 M/F ratio 0.8 0.9 0.7 1.5 Weight (kg) 22.7 23.7 21.2 29.3 Height (cm) 121.1 122.6 119.3 127.5 Temperature (°C) 37.6 38.0 37.1 NA Hematocrit (%) 42.8 38.0 44.0 Platelets (×109/L) 93.7 116.3 65.0
Day of fever (Mean) 3.6 3.3 3.9
DENV1 8 5 3 DENV2 37 21 16 DENV3 0 0 0 DENV4 3 3 0 N/A 6 3 3 NS1+ 32 21 11 PCR+ 48 30 18
Viral load (copies/ml) (Median, IQR) 2.2 × 104
(7.4 × 103– 3.4 × 105) 1.2 × 105 (1.4 × 104– 1.2 × 106) 7.6 × 103 (6.3 × 103– 3.5 × 104) Secondary infection 74% 65% 90%
occurs at the plasma membrane and can be potentiated by
internalization of the complex via CME.
Interestingly, many viruses, including DENV, hijack CME to
gain access to internal compartments of host cells
36,37. Moreover,
CD14 and its unknown co-receptor has been previously proposed
to act as an attachment receptor for DENV
38. We therefore
hypothesized that TLR2/CD14-dependent CME facilitates DENV
entry to establish infection. Accordingly, we tested if blockade of
TLR2 or its co-receptors had any impact on the percentage of
infected cells and/or virus production. Since, due to technical
issues, we could not exploit the same NS3 antibody as we used in
our patient cohort, we tested the accumulation of E protein and
a
PS W NH4Clc
d
αTLR1 αTLR6 αCD14PAM3 PAM2 DENV2 PAM3 PAM2 DENV2
e
f
b
αTLR2
Mock PAM3 DENV2
g
αTLR1 αTLR6 αCD14 αTLR2 αTLR1 αTLR6 αCD14 αTLR2 0 5 10 15 20 25 PBMC's - 48 hpi HEK-BlueTM hTLR2 cells - 24 hpi2.0 100 80 60 40 20 + + + + + + + + + + + + + + + + + + 0 100 80 60 40 20 0 0 10,000 MFI CD14 20,000 30,000 r = 0.4768 CM IM NM P < 0.001 1.5 1.0 0.5 NF-kB stimulation [OD630]
% of NF-kB stimulation relative to the agonist
125 100 75 50 25 0 12.5 10.0 7.5 5.0 2.5 0.0
% of NF-kB stimulation relative to the agonist
0.0 2.0 1.5 1.0 0.5 NF-kB stimulation [OD630] 0.0 – + – + – + CC PAM3 DENV2 UV-DENV2 pDENV2
% DENV positive cells
% DENV positive cells
% DENV positive cells
TLR1 TLR6 TLR2 TLR2 TLR2 CD14 TLR6 CD14 + + + + + + + +
used UV-inactivated DENV to ensure we do not detect incoming
virus in our assay (Supplementary Fig. 7a, b, and Supplementary
Fig. 8a). As shown in Fig.
2e, blockage of TLR2, CD14 (P <
0.0001, one-way ANOVA, Dunnett post hoc test) and to a lesser
extent that of TLR6 (P < 0.05, one-way ANOVA, Dunnett post
hoc test), reduced the number of DENV-Ag-positive HEK-Blue™
hTLR2 cells. Consistent with these results, in PBMCs, specific
blocking of TLR2 (P < 0.0001, one-way ANOVA, Dunnett post
hoc test) and CD14 (P < 0.0001, one-way ANOVA, Dunnett post
hoc test) but not that of TLR1/6 significantly decreased the
frequency of DENV Ag-positive monocytes (Fig.
2f, and
Supplementary Fig. 8b for isotype controls). These data might
explain why among the three monocyte subsets, the
TLR2-positive CD14
++monocytes (Fig.
1d) expressed the highest level
of DENV NS3 during acute DENV infection and why CD14
expression correlates with DENV replication in vivo (Fig.
2g).
Counterintuitively, however, despite the significant decrease in
the frequency of DENV-Ag-positive cells, TLR2 and CD14
blockage had little to no effect on viral production in both cell
models (Supplementary Fig. 9). There was also no clear
correlation between the expression of TLR2 (percentage of
positive cells and MFIs) and the viral load in our patient’s cohort
(Supplementary Fig. 10a, b), suggesting that
TLR2/CD14-dependent CME does not significantly contribute to progeny
virus release and/or other cells such as DCs
39are the main source
of the virus. Altogether, these data indicate that host cells utilize
TLR2/6/CD14 mediated NF-κB activation as a quick innate
mechanism to sense DENV infection.
TLR2-mediated sensing of DENV is virus strain rather than
the serotype-specific. We proceeded to investigate whether
TLR2-engagement is a PAN-dengue phenomenon. All four
DENV serotypes had the ability to activate NF-κB in a
TLR2-dependent manner (Table
2) yet, not all strains and/or genotypes
of the same serotype had that property. Other mosquito-borne
viruses including West Nile Virus (WNV), Zika virus (ZIKV),
and chikungunya virus (CHIKV), did not activate NF-κB in this
system (Table
2). Interestingly, despite the varying ability of
several DENV2 16681 preparations used in this study to activate
NF-κB, all of them infected the HEK-Blue™ hTLR2 cells and
PBMCs in TLR2/CD14-dependent manner (Fig.
2e, f). Thus,
TLR2-mediated NF-κB activation but not TLR2 axis-mediated
infection appears to be DENV strain/genotype specific.
In vitro DENV infection upregulates TLR2 and CD16 on
monocytes. To further substantiate the role of TLR2 as a
reg-ulator of inflammatory responses, we isolated PBMCs from
healthy, DENV-seronegative, donors and infected them under
TLR2 axis blocking and non-blocking conditions with DENV2
16681 strain at multiplicities of infection (MOI) of 10, as
described previously
40. To gain further insights into the possible
repercussions of TLR2-engagement on PBMCs, we used virus
preparations that had a differential capacity to activate
HEK-Blue™ hTLR2 reporter cells (Table
2). To discriminate between
pathways triggered due to sensing and/or by replication, an equal
dose of UV-inactivated virus was used as a control in all
experiments. Regardless of virus preparation, in vitro DENV
infection of monocytes (within PBMCs) increased the mean
fluorescent intensity (MFI) of TLR2 (Fig.
3a and Supplementary
Fig. 11) and the percentage of TLR2-positive cells (Fig.
3b). In
contrast, UV-DENV (Fig.
3a, b) and PAM3CSK4 (Supplementary
Fig. 12a, b) did not upregulate TLR2 expression when compared
to mock-infected cells. In addition, neither DENV infection nor
TLR2 agonists had an effect on the expression of TLR2 on
lym-phocytes (Supplementary Fig. 12c, d). Notably, the increase in
TLR2 expression following in vitro-infection was in contrast to
the data collected from our ex vivo samples (Fig.
1b) but in line
with previous
findings
21. Importantly, PBMCs isolated from adult
healthy and DENV-seronegative donors in the Netherlands
expressed similar levels of TLR2 as our pediatric HD in
Cam-bodia. This might suggest that monocyte responses and thereby
the regulation of TLR2 expression on the surface of these cells
depends on the age, genetic background and/or past DENV
infection. Thus, in vitro DENV infection but not ex vivo infection
leads to the selective upregulation of TLR2 on monocyte
fractions.
Fig. 2 DENV engages TLR2/6 and CD14 to activate NF-κB and to establish infection. a NF-κB activation in HEK-Blue™ hTLR2 cells (mock-) treated with PAM3CSK4 (PAM3, 25 ng/mL), DENV2 (MOG1000), UV-I DENV2 (MOG1000) or purified DENV2 (pDENV2) (MOG1000) for 24 h (n = 3 one-way ANOVA, Dunnett post hoc test, ***P < 0.001). OD630 values represent induction of NF-κB. b, c NF-κB activation in HEK-Blue™ hTLR2 cells pretreated for 2 h withbαTLR2 (n = 3, one-tailed paired t test, ***P < 0.001; ****P < 0.0001) or c αTLR1, αTLR6 and αCD14 (15 µg/mL) before exposure to PAM3 (25 ng/mL), PAM2CSK4 (PAM2, 1 ng/mL) or DENV2 (MOG1000) for 24 h (n = 3, one-way ANOVA, Dunnett post hoc test, *P < 0.05; **P < 0.01; ***P < 0.001).d NF-κB activation in HEK-Blue™ hTLR2 pretreated for 1 h with endocytosis inhibitors pitstop (PS, 60 µM), ammonium chloride (NH4Cl, 50 mM) and wortmannin (W, 2µM) prior to exposure to PAM3 (25 ng/mL), PAM2 (1 ng/mL) or DENV2 (MOG1000) for 24 h (n = 3, one-way ANOVA, Dunnett post hoc test, *P < 0.05). Percentages of DENV (E)—positive cells were determined by flow cytometry in e HEK-Blue™ hTLR2 cells (n = 5, one-way ANOVA, Dunnett post hoc test, *P < 0.05; ****P < 0.0001) or f monocytes in the context of PBMCs, in the presence or absence of TLR2 axis blockade after 24 and 48 h, respectively (n = 3, three donors and three different DENV2 preparations, one-way ANOVA, Dunnett post hoc test, ****P < 0.0001). Bars represent the mean ± SEM. CC (cellular control), PAM2, PAM3, and DENV2 as controls of their respective blocking/treatment conditions. N refers to the number of independent biological experiments unless otherwise specified. g Correlation of mean fluorescence intensity (MFI) of CD14 expression on different monocyte subsets and DENV infection (NS3) in our patient’s cohort. Statistical differences were determined by Spearman correlation analysis. Source data are provided as a Source datafile.
Table 2 TLR2 engagement by DENV is strain speci
fic.
Virus Strain TLR2/NF-κB activation
DENV1 16007 +++ Hawaii − DENV2 16681 +++/++a NGC +++ TSV01 + DENV3 16562 +++ H87 − DENV4 1036 + H241 − ZIKV SL0216 − WNV NY99 − CHIKV LR OPY1 −
Source data are provided as a source datafile.
++ NF-kB activation is half the triggered by PAM3CSK4, + 10–20% activation of NF-kB in comparison to PAM3CSK4,− Does not trigger NF-kB activation.
Immunophenotyping of in vitro-infected cells showed that
both DENV and UV-DENV significantly increased the
frequen-cies of CM (P < 0.0102 and P < 0.0022, respectively, unpaired
one-tailed t test) and NM (P < 0.0088 and P < 0.0123, respectively,
unpaired one-tailed t test) while the IM population was decreased
(P < 0.0001 and P < 0.0012, respectively, unpaired one-tailed t
test) when compared to mock-treated PBMCs (Supplementary
Fig. 12e). This indicates that sensing of virions is enough to
trigger a shift in the monocyte subpopulations. This effect was,
however, independent of TLR2, since TLR2 block did not prevent
the increase in CM numbers (Supplementary Fig. 12e). Similar
results were obtained for PAM3 (Supplementary Fig. 12f),
suggesting that other receptors are involved in this process.
Notably, we found that active DENV infection but not
UV-DENV, significantly increased the expression of CD16 in
intermediate and non-classical monocytes (p < 0.0136 and p <
0.0099, respectively, paired one-tailed t test) (Fig.
3c, d).
Moreover, this upregulation was in control of TLR2 and TLR6
but not that of TLR1, as blockade of TLR2 and TLR6 significantly
reduced (P < 0.0211 and P < 0.0383, respectively, paired
one-tailed t test) the upregulation of CD16 induced by DENV
infection (Fig.
3d). Remarkably, in patients, expression of CD16
was negatively associated with the percentage of DENV-infected
cells (Supplementary Fig. 13) suggesting that TLR2/6-mediated
CD16 upregulation might serve as an antiviral mechanism. This
would explain, at least in part, why sustained levels of TLR2
expression on NM correlated with mild disease (Fig.
1c). There
was no difference in the expression of CD14 after DENV
infection with or without blocking conditions (Fig.
3c).
TLR2
controls
DENV
infection-induced
inflammatory
responses of PBMC. Activation of blood cells as a consequence of
DENV infection leads to the production of inflammatory
cyto-kines, which in turn activates human endothelial cells and can
lead to the loss of their barrier function
3,41–43. To test whether
TLR2 engagement during DENV infection of PBMCs contributed
to the vascular responses, we incubated human umbilical vein
endothelial cells (HUVEC) with supernatants of infected PBMCs,
as described in Fig.
4a. Endothelial cell activation was assessed by
quantification of surface and/or mRNA expression of E-selectin,
vascular cell adhesion protein 1 (VCAM-1), intercellular adhesion
molecule 1 (ICAM-1) and inflammatory mediators including
IL-6, IL-8, MCP-1, and CXCL6. To ensure that the activation of
endothelial cells was due to soluble inflammatory mediators
excreted by infected PBMCs rather than the presence of the virus
itself, HUVEC were incubated with an equal number of GEc as
those present in the supernatants of infected PBMCs. Incubation
for six hours did not lead to the upregulation of adhesion
molecules when compared to LPS (positive control)
(Supple-mentary Fig. 14a, b). Thus, endothelial cell activation observed
a
b
c
No ab – + + + – + + + – + + + – + + + No abd
αTLR1 αTLR6 αTLR2 αTLR1 αTLR6 αTLR2 4 3 2 1 0 3 2 1 0TLR2 MFI fold change to mock
MFI fold change
(to relativve mock)
3
2
1
0
MFI fold change
(to relativve mock)
CM IM NM CM IM IM NM Mock DENV2 UV-DENV2 DENV2 UV-DENV2 CD16 CD16 CD14 NM % TLR2 positive cells 0 20 40 60 80 100
Fig. 3 Active DENV infection upregulates TLR2 and increases CD16 expression in a TLR2/TLR6 dependent manner. PBMCs from healthy donors were (mock-) treated withαTLR2, αTLR1 and αTLR6 (5 µg/mL) for 2 h prior to infection with DENV2 at MOI of 10 or its UV-inactivated equivalent (UV-DENV2) for 48 h.a MFI of TLR2 expression (n = 5, five different donors and up to 4 different DENV2 preparations, paired one-tailed t test, *P < 0.05; **P < 0.01, ***P < 0.001) and b Percenatge of TLR2-positive cells within each of monocytes subset (n = 5, five different donors and up to four different DENV2 preparations, paired one-tailedt test, *P < 0.05; **P < 0.01, ***P < 0.001, ****P < 0.0001). c CD14 and CD16 expression were detected for total monocytes in blocking and non-blocking condition (n = 2, two different donors and three different viral preparations, paired one-tailed t test, *P < 0.05; **P < 0.01) and d per monocyte subset (n = 2, two different donors and three different viral preparations, paired one-tailed t test, *P < 0.05; **P < 0.01). CM classical monocytes, IM intermediate monocytes and NM: non-classical monocytes. Data represented as fold-changes in MFI relative to the respective mock or as a percentage of positive cells of the respective marker. Bars represent mean ± SEM. Source data are provided as a Source datafile.
with the supernatants of infected PBMCs was due to soluble
mediators excreted upon infection in PBMCs (Fig.
4b, c) and not
due to the carryover of the virus. Surprisingly, blocking TLR2 on
PBMCs prior to exposure to DENV infection abolished
inflam-matory responses and significantly attenuated endothelial
acti-vation as evidenced by decreased expression of adhesion
molecules (Fig.
4b), mRNA levels of their respective genes
(Fig.
4c) as well as reduced transcription of inflammatory
cyto-kines and chemocyto-kines such as IL-6, IL-8, MCP-1, and CXL6
(Fig.
4d). Supernatants from UV-DENV treated PBMCs led to a
relatively mild activation of HUVEC when compared to
infec-tious DENV (Fig.
4c, d; Supplementary Fig. 15a, b), despite potent
activation of NF-κB in HEK-Blue™ hTLR2 by UV-DENV
(Fig.
2a). Additionally, isotype control antibody block did not
have an effect on the vascular responses of PBMCs infected with
DENV2 (Supplementary Fig. 15c). Moreover, the TLR2 block had
no effect on the soluble inflammatory responses of PBMCs
treated with the TLR4/CD14 agonist LPS, indicating that the
effect observed for DENV infection is indeed TLR2-specific
(Supplementary Fig. 15d).
Increased levels of IL-1β and TNF-alpha have been reported to
be present in the plasma of DENV patients and may contribute to
increased endothelial permeability
3. To determine whether
endothelial activation during DENV infection was due to the
presence of these cytokines, we measured the intracellular
accumulation of IL-1β and TNF-alpha in DENV-infected PBMCs
(Supplementary
Fig.
16).
As
expected,
positive
control
PAM3CSK4 induced the intracellular accumulation of IL-1β
and TNF-α in the concentration and TLR2-dependent manner
(Supplementary Fig. 17a, b). Interestingly, at the concentration
tested only the intracellular accumulation of IL-1β was
sig-nificantly reduced by prior TLR2 blockade (Supplementary
Fig. 17a), suggesting that differential pathways down-stream of
TLR2- trigger the production of these cytokines
44. Indeed,
TLR2 signaling may also lead to the activation of the
inflammasome pathway that contributes to the production of
IL-1β
45,46. Alternatively, signal integration of different PRR can
lead to different and non-additive immune responses
47,48.
Importantly, at 12 hpi we did not detect TNF-α accumulation
following exposure to DENV2 (Supplementary Fig. 17c) while
IL-1β accumulation was evident in the monocyte fraction of three
out of four tested donors and depending on the donor was
induced by exposure to either infectious (DENV) or
non-infectious virus UV-DENV (Supplementary Fig. 17d). None of
the treatments induced intracellular accumulation of both
cytokines in the lymphocytic fraction of the PBMCs
(Supple-mentary Fig. 17e, f). Therefore, we analyzed inflammatory
mediators released from the cells throughout 48 h of infection.
Interestingly, the concentrations of IP-10 (P < 0.01, one-way
ANOVA, Dunnett post hoc test), IFN-α2 (P < 0.05, one-way
b
d
DENV2
UV-DENV2 UV-DENV2DENV2
c
DENV2
UV-DENV2 UV-DENV2DENV2 UV-DENV2DENV2 UV-DENV2 DENV2
a
DENV2 UV-DENV2 0 2 4 6 8 20 80 25 20 15 10 5 0 60 40 20 0 15 10 5 0 IL-6 IL-8E-Selectin VCAM-1 ICAM-1
E-Selectin VCAM-1 ICAM-1
0 2 4 6 8 No-ab MOI: 10 Infection treatment PBMCs and supernatant collection Activation markers: protein and gene expression
analysis α-TLR2 αTLR2 No-ab αTLR2 No-ab αTLR2 –2 h 0 hpi 0 hpi HUVEC 6 hpi 48 hpi PBMCs
MFI fold change to to control
mRNA fold change to
GAPDH
mRNA fold change to
GAPDH
mRNA fold change to
GAPDH 80 400 300 200 100 0 60 40 20 0
mRNA fold change to
GAPDH
mRNA fold change to
GAPDH 80 60 40 20 0
mRNA fold change to
GAPDH
mRNA fold change to
GAPDH
MCP-1 CXCL6
Fig. 4 Active DENV infection induces inflammatory mediators in a TLR2-dependent manner. a HUVEC were incubated for 6 h with cell-free supernatants from PBMCs infected in the presence or absence of TLR2 blockade.b Boxplots show the fold-changes in surface expression of E-selectin, VCAM-1 and ICAM-1 compared to the respective mock (n = 4, paired one-tailed t test, *P < 0.05; **P < 0.01). The horizontal line represents the median and the whiskers the minimum and maximum values.c Fold-changes in gene expression levels ofE-selectin, VCAM-1, and ICAM-1 relative to the respective mock (n = 2). d Fold-changes in gene expression levels of IL-6, IL-8, MCP-1, and CXCL6 relative to the respective mock (n = 2). N refers to the number of independent biological experiments in HUVEC. Source data are provided as a Source datafile.
ANOVA, Dunnett post hoc test), IFN-β (P < 0.05, one-way
ANOVA, Dunnett post hoc test) and IFN-λ1 (P < 0.01, one-way
ANOVA, Dunnett post hoc test) were significantly higher in the
supernatants from DENV2-infected PBMCs in comparison from
those of UV-DENV2-stimulated PBMCs (Supplementary Fig. 18),
while only a slight increase was observed for TNF-α, IL-6, IL-10
and IFN-γ (Supplementary Fig. 18). Additionally, UV-DENV2
also induced production of TNF-α, IL-1β, IL-6 and IFN-λ2/3
(Supplementary Fig. 18), however not as potently as the
replicative virus. Remarkably, blocking TLR2 and CD14 but not
TLR1/6 or the use of control antibody (Fig.
5
and Supplementary
Fig. 19), significantly decreased the production of IFN-β (P < 0.01,
one-way ANOVA, Dunnett post hoc test) and IFN-λ1 (P < 0.01)
induced by active DENV infection, while the production of
TNF-α was marginally reduced in these conditions (Fig.
5). The levels
of IFN-α2 were moderately reduced when blocking CD14 but not
when blocking other TLR2 (co-) receptors, while only the block of
TLR2 was able to reduce the levels of IP-10 (Fig.
5). The TLR2
axis block did not impair the levels of IL-1β, IL-6, IL-10, and
IFN-γ induced by DENV infection (Supplementary Fig. 20).
Alto-gether, these results support the DENV replication- dependent
and TLR2-mediated production of inflammatory mediators
capable to activate endothelial cells in vitro (Fig.
4) and highlight
that variety of pathways cross-talking following TLR2
axis-dependent and inaxis-dependent sensing of DENV infection. In
addition, it is important to note that the observed variations in
cytokine production following (UV-) DENV infections were
donor-
rather
than
virus
preparation-dependent,
further
αTLR1 αTLR6 αCD14 αTLR2 2500 400 300 200 100 0 Mock TNF-α IFN-β IP-10 IFN-α2 IFN-λ1 DENV2 2000 1500 1000 pg/mL pg/mL pg/mL pg/mL pg/mL 500 300 600 500 400 300 200 100 0 250 200 150 100 50 8000 6000 4000 2000 0 0 0 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + + αTLR1 αTLR6 αCD14 αTLR2 + + + + + + + +Fig. 5 TLR2/CD14-dependent cytokines induced by DENV2 infection. PBMCs from healthy donors were (mock)—treated with αTLR2, αTLR1, αTLR6 (5µg/mL) and αCD14 (3 µg/mL) for 2 h prior to infection with DENV2 at MOI of 20 for 48 h (n = 2, two different donors and 3 different DENV2 preparations, one-way ANOVA, Dunnett post hoc test, **P < 0.01). Cytokine production was measured by flow cytometry using LegendPlex. Each boxplot in the graphs shows the production in picograms per milliliter (pg/mL) of the respective cytokine. The horizontal line represents the mean and the bottom and top of the box show the minimum and the maximum values. Source data are provided as a Source datafile.
highlighting the inherent differences in TLR2-mediated sensing
of DENV infection between the overexpression system
HEK-Blue™ hTLR2 and primary monocytes, which are equipped with
multiple PRRs. Altogether, our data show that TLR2 sensing of
dengue virus infection induces production of inflammatory
mediators, which in turn can activate endothelial cells.
Discussion
By analyzing TLR2 expression and the frequencies of the different
monocyte subsets in a DENV-infected pediatric cohort, we
identified a prognostic value of TLR2 expression in disease
pathogenesis. We show that in children, DENV infection lead to
the overall decrease in the TLR2 expression on the surface of all
monocyte subsets when compared to age-matched HD. Notably,
the sustained relatively high expression of TLR2 in acute infection
on CM was associated with severe disease development while
profound reduction in TLR2 expression correlated with mild
disease. The functional analyses uncovered the ability of TLR2/6/
CD14 to sense DENV infection and to drive infection-mediated
inflammatory responses leading to activation of human vascular
endothelium. On the other hand, however, TLR2 and CD14
co-receptors increased the infected cell mass thereby revealing a
pro-viral role for TLR2. Altogether, our data provided evidence for the
critical and dual role of TLR2 in DENV infection and
infection-mediated immune responses.
Our data have identified TLR2 as a potent regulator of immune
responses following DENV infection. TLR2 together with TLR4
have been shown to play an important role in the induction of
inflammation during many infectious diseases
49. For instance,
single-nucleotide polymorphisms occurring in the TLR2/1/6 axis
have been reported to influence the course of chlamydiosis,
leprosy and hepatitis B and C virus infections
50. Notably, during
the course of DENV infection, TLR2 appears to have a both
protective and unfavorable role for the host. Although high
fre-quencies of TLR2-expressing CM correlated with severe disease,
the opposite trend, albeit less strong, was noted for non-classical
monocytes. The seemingly contrasting roles of TLR2 on CM and
NM are likely to be linked to their distinct functions. CM are
equipped with various PRRs and scavenger receptors that
recognize PAMPS, remove microorganisms, lipids, and dying cells
via phagocytosis and are thus, involved in sensing and inducing
inflammatory responses to stress-inducing factors. In contrast, NM
or patrolling monocytes have a unique role in protecting
endo-thelial integrity by removing damaged cells and debris. Moreover,
once activated, NM differentiate into anti-inflammatory
macro-phages to repair damaged tissues, thereby promoting wound
healing and the resolution of inflammation
51–54. The functions of
TLR2 on these monocyte subsets may also be dictated by the
differential expression of CD14, CD16, TLR10, CD36
20,55–58and/
or other receptors capable of modulating DENV infection and
DENV-infection-mediated responses
59,60.
Changes in monocytes and monocyte subset distributions have
been associated with many inflammatory diseases, though their
relevance for disease pathogenesis is poorly understood
21,32,33.
DENV infection has been shown to lead to an increase in
fre-quencies of IM (from ~5 in healthy to ~10 % in DENV patients)
accompanied by a modest decrease (~77% in healthy to ~63% in
frequencies of CM
21,33. Based on their inflammatory makeup,
prevalence of CM and IM in the blood of DENV patients could be
linked to exacerbated inflammation and severe disease.
Interest-ingly, even though DENV infection increased the frequencies of
IM and NM compared to HD, this increase did not differentiate
between the severity groups. In fact, in our patient cohort, only
the increased frequency of CM correlated with severe disease
development. Notably however, in vitro, we observed a similar
shift in monocyte subsets distribution with UV-inactivated
DENV as with the infectious virus while only the latter led to
TLR2-mediated CD16 upregulation and release of inflammatory
mediators. Altogether, this suggests that changes in monocyte
distribution cannot be considered as a direct and a sole marker of
inflammatory responses.
Differential surface expression of TLR2 on CM of patients with
relatively mild disease symptoms (DF) and those who progressed
to severe disease (DHF/DSS) suggests a distinct regulation of
TLR2 expression in these patients. Based on our data and that of
others’
34TLR2-axis-mediated NF-κB activation is partially
dependent on CME. Thus, the reduction of TLR2 expression on
the surface of CM during viremia observed in patients with DF
might indicate that activation of the DENV infection-mediated
TLR2 axis led to TLR2/ligand internalization, and ultimately
desensitization of the monocytes to TLR2-engaging PAMPs and
DAMPS
61. In addition, TLR2 complex internalization might also
result in more balanced inflammatory and antiviral immune
responses, since internalization is required to induce IFN type I
producing signaling cascades
18. At the same time, and
con-sidering the ability of TLR2 blockade to limit the number of
DENV-Ag-positive monocytes, it is internalization would also
impede the ability of the virus to infect these cells. Conversely, a
sustained relatively high TLR2 surface expression following
DENV infection, as seen on CM of patients that developed severe
disease, could be suggestive of a reduced internalization of the
TLR2 complex. In this scenario, prolonged sensing of TLR2—
engaging PAMPs and DAMPS would lead to mainly
pro-inflammatory responses and a relatively higher number of
infected monocytes. The exact mechanisms governing TLR2
expression following DENV sensing and/or infection remain to
be elucidated and will be the focus of our future studies.
Importantly, reduced TLR2 surface expression following infection
may also mirror the release of soluble TLR2, the levels of which
were shown to be elevated in some infection and inflammatory
conditions
62–64. Moreover, plasma levels of soluble TLR2 were
found to be associated with a resolution of inflammation
64.
The engagement of TLR2 was independent of the ability of
DENV to replicate and relied on the sensing of the viral particle
suggesting the involvement of structural proteins expressed on the
virus surface [E, (pr)M] in the engagement of this PRR rather than
any of the
five non-structural proteins (NS1- NS5). This is in stark
contrast to Chen et al., who attributed TLR2-mediated responses
following DENV infection to the NS1 protein
24. Importantly,
subsequent studies have provided evidence that NS1 protein
engages with TLR4 instead of TLR2
25–27. Interestingly, regardless
of Chen et al. results obtained with NS1 protein, their data from
DENV–infected TLR6 KO mice are in fact, in consonance with
our present
findings and corroborate the potentially unfavorable
for the host role of the TLR2 axis in DENV infection in vivo.
DENV produced in mosquito cells triggered stronger
TLR2-dependent NF-κB activation than the DC- and Mθ-derived virus.
This suggests that the virus transmitted during the blood meal is
likely to initiate and more significantly contribute to
TLR2-mediated inflammation. The reason for the differences in the
capacity to activate TLR2 axis depending on the virus origin is yet
unclear however is likely attributable to the host- and/or cell-type
specific modifications on the surface of the virus particle. For
instance, differential glycosylation patterns of two potential
N-linked glycosylation sites on the DENV E protein produced in
mosquito and primary human DCs influence their capacity to
interact with DENV receptors, DC-SIGN and L-SIGN, and thus
may dictate DENV tropism in vivo
65. Interestingly, E protein is
not the only protein on the surface of the virion that can be
glycosylated. DENV prM protein contains a single glycosylation
site, and although prM is cleaved by furin during viral
maturation, a substantial fraction of uncleaved prM is present on
some DENV particles. In fact, DENV exists as a number of
dif-ferent viral forms depending on the degree of maturation. PrM
-containing fully immature and partially mature DENV virions
are particularly abundant in mosquito and mammalian tumor cell
lines-produced viral preparations
66,67. On the other hand, DENV
produced in primary cells
68and human circulating DENV1
vir-ions
69seem to show a higher degree of maturity than those
produced in cell lines. Considering the reduced ability of human
primary cell derived DENV2 to engage TLR2 described in our
study, it will thus be important to address how both glycosylation
and maturation levels of the virions influence TLR2-mediated
responses during infection. Unfortunately, due to the limited
amount of sample obtained from our pediatric cohort, we could
not assess the effect of the human circulating virus in our in vitro
systems. However, we are currently assessing the role of
imma-ture dengue particles in our in vitro models.
The results obtained in PBMCs did not entirely mirror the
results obtained in HEK-Blue™ TLR2 cells since the UV-irradiated
virus preparation did not activate NF-κB to the same extent as the
replicative virus. The level of NF-κB/AP1 activation measured in
the reporter cell lines is unlikely to reflect the variety of different
immunomodulators that can be released down-stream of TLR2 in
primary immune cells. The differences in cytokine levels
pro-duced between active DENV infection and UV-DENV in PBMCs
may reflect the differential expression, as well as the crosstalk of
different PRR’s in sensing replicative and non-replicative virions,
which do not occur, or are not detectable in the NF-kB/AP-1
reported system
48,70. Indeed, by UV-irradiating the virus, we
likely impeded the endosomal sensing of viral ssRNA by TLR7/8,
which ultimately might have affected the potentiating effect of
TLR2/7/8 cross talk
71. Moreover, the TLR2/CD14-dependent
production of IFN-λ1, which has been described to be released by
dendritic cells in a TLR3 dependent manner
72, may suggest the
possibility of TLR2/TLR3 cross talk
73. Indeed, in human DC’s the
stimulation of TLR2 blocked the induction of cytokines that are
controlled by TLR3
47. Further studies are required to elucidate
the cross talk of different PRR’s in the course of DENV infection.
Our study provides fundamental insights into the function of
TLR2 in the course of DENV infection, however some limitations
should also be considered. Nearly 74% of our cohort included
patients undergoing secondary infections implying that they had
pre-existing cross-reactive antibodies circulating in the blood at the
time of sampling. Our in vitro infection model, however, did not
address the infection enhancing or neutralizing effects of
dengue-specific antibodies on TLR2-mediated immune responses
60. For
instance, the phenomenon of antibody-dependent enhancement
(ADE) of infection, postulating that sub neutralizing
concentra-tions of DENV-specific antibodies, can facilitate an additional
mode of entry, thereby enhancing DENV infection and the
aber-rant inflammatory responses seen in DHF/DSS patients.
Addi-tionally, the presence of DENV-Ab immunocomplexes is likely to
influence TLR2/CD14-mediated responses
60. Lastly, considering
the role of TLR2 and TLR4 in detecting bacterial PAMPS, it will be
important to address the effect of common co-morbidities
including bacterial and parasitic co-infections or microbial
translocation
6,7,74,75, on DENV pathogenesis and prognosis.
In conclusion, our data identified a fundamental role of cell
surface-expressed TLR2 as a regulator of inflammatory responses in
the course of DENV infection. DENV infection modulates TLR2
expression on monocytes, which depending on their co-stimulatory
markers contribute to infection-mediated inflammatory responses
that may underlie severe disease development. Consequently, our
study disclosed the TLR2 axis as a potential pharmacological target
which may mitigate the pathogenesis of severe disease. Finally,
sustained high expression of TLR2 in DENV patients that progress
to severe disease indicate a potential prognostic value of TLR2 on
blood monocytes.
Methods
Ethics statement. Ethical approval was obtained from the National Ethics Com-mittee of Health Research of Cambodia. Written informed consent was obtained from all participants or the guardians of participants under 16 years of age before inclusion in the study.
DENV patient recruitment. Blood samples were obtained from hospitalized children (≥2 years) who presented with dengue-like symptoms at the Kanta Bopha Hospital in Phnom Penh, Cambodia. The time-point for collection of blood samples was within 96 h of appearance of fever in the patient. A second blood sample was collected upon discharge from the hospital. Patients were classified according to the WHO 1997 criteria upon hospital discharge2. Plasma leakage was
confirmed by at least one of the following manifestations: 1/ a rise in the hematocrit equal to or >20% above average for age, sex and population in the admission sample (reference percentages: http://www.hematocell.fr/index.php/les-cellules-du-
sang/15-les-cellules-du-sang-et-de-la-moelle-osseuse/valeurs-normales-de-lhemogramme-selon-lage/129-hemogramme-selon-lage) or 2/A drop in the
hematocrit following volume-replacement treatment equal to or >20% of baseline and follow up visit or discharge (between 1 and 3 days after initial sample) or 3/Signs of plasma leakage such as pleural effusion and ascites by ultrasound.
Laboratory diagnosis. Serum specimens were tested for presence of DENV using nested qRT-PCR at the Institut Pasteur in Cambodia, the National Reference Center for arboviral diseases in Cambodia76. NS1 positivity was determined using rapid
diagnostic tests (combo test for NS1 and IgM/IgG detection, SD Bioline Dengue Duo kits from Standard Diagnostics—Kyonggi-do, Korea). Anti-DENV IgM was measured with an in-house IgM-capture ELISA (MAC-ELISA), as previously described77. Patients were diagnosed as acute DENV-infected as following: a
posi-tive qRT-PCR or NS1 at hospital admission, or seroconversion from anti-DENV IgM negative to anti-DENV IgM positive during the hospital stay. Samples from patients positive for DENV were further tested with hemagglutination inhibition (HI) test to determine primary/secondary DENV infection as per WHO criteria2.
Patient PBMC phenotyping. Human peripheral blood mononuclear cells (PBMCs) were isolated from blood samples of DENV-positive patients and age-matched healthy controls using Ficoll-Paque density gradient centrifugation and frozen in 10% DMSO until analysis. PBMCs were thawed in RPMI supplemented with fetal bovine serum (FBS), washed and counted in phosphate-buffered saline/ bovine serum albumin. PBMCs were stained for surface markers using the fol-lowing antibodies: TLR2 PE (1:25, clone TL2-1, #309707), CD14 APC (1:50, clone 63D3, #467117), CD16 PE-Cy7 (1:250, clone 3G8, #302016), CD19 AF488 (1:50, clone HIB19, #302219), CD3 BV510 (1:50, clone OKT3, #317332), CD4 PerCP/ Cy5.5 (1:50, clone OKT4, #317428), CD45RO APC-Cy7 (1:25, clone UCHLI, #304228) and CD56 BV421 (1:25, clone 5.1H11, #362552), all purchased from BioLegend, and analysed on a FACSCanto II (BD). Isotype-matched antibody labelled with PE (1:25, clone MOPC-173, #400211, BioLegend) was used as negative control for comparing TLR2 expression. Due to the inability of the DENV envelope-directed 4G2 antibody (Millipore) to detect virus infection in our patients’ PBMCs, we used the recently characterized rabbit polyclonal anti-DENV NS3 antibody. The anti-NS3 staining panel was only performed on a subset of patients as more PBMC are required for a good quality intracellular staining. Sufficient cell yield after PBMC thawing was used as selection criteria to perform the staining. Briefly, PBMCs were fixed and permeabilized using True nuclear transcription factor buffer set (BioLegend) and stained intracellularly using a rabbit anti-DENV NS3 antibody (10 µg/mL, #GTX124252, GeneTex) or rabbit IgG Iso-type control (10 µg/mL, #910801, BioLegend) followed by goat anti-rabbit IgG conjugated with AF488 (1:500, #ab150077, Abcam). Data were analyzed using the FlowJo software (BD Biosciences).
Cells. PBMCs were isolated by standard density gradient centrifugation procedures with Ficoll-Paque™ Plus (GE Healthcare) from buffy coats obtained with written informed consent from healthy, anonymous volunteers, in line with the declaration on Helsinki (Sanquin Bloodbank, Groningen, the Netherlands). The PBMCs were cryopreserved at−196 °C. Aedes albopictus C6/36 cells were maintained in MEM supplemented with 10% FBS, 25 mM HEPES, 7.5% sodium bicarbonate, penicillin (100 U/mL), streptomycin (100μg/mL), 200 mM glutamine and 100 µM non-essential amino acids at 30 °C. HEK-Blue™ hTLR2, Blue™ hTLR4 and HEK-Blue™ Null2 cell lines (InvivoGen) were cultured in DMEM supplemented with FBS, penicillin (100 U/mL), streptomycin (100μg/mL) and maintained according to the manufacturer’s instructions. VERO-E6 and VERO-WHO were cultured as the HEK cells with the addition of 10 mM HEPES and 200 mM glutamine. BHK-15 were cultured as the VERO cells with the addition of 100μM of non-essential amino acids. Primary human umbilical vein endothelial cells (HUVEC) (Lonza, the Netherlands) were cultured in EBM-2 supplemented with EGM-2 endothelial growth SingleQuot kit supplement & growth factors (Lonza, the Netherlands). All
of the cell lines used in our experiments were tested negative for the presence of Mycoplasma spp. using a commercial functional method (Lonza, the Netherlands) and/or in-house qPCR assay adapted from Baronti et al.78.
Viruses. DENV1 (strains 16007, Hawaii), DENV2 (strains 16681, NGC, TSVO1), DENV3 (strains H87, 16562) and DENV4 (strains 1036, H241), were produced in the Aedes albopictus C6/36 cell line as described before79. Briefly, and 80%
con-fluent monolayer of cells was infected at multiplicity of infection (MOI) of 0.1. Depending on the serotype, virus progeny was harvested at 72 or 168 h post infection (hpi). Purification was performed as described by Ayala-Nuñez et al.35.
WNV strain NY99 was propagated in Vero cells as described before80. CHIKV (La
Reunion OPY1) was a gift from A. Merits (University of Tartu, Estonia), and was produced from infectious cDNA clones and passaged twice in Vero E6 cells81.
ZIKV (SL0216) was a gift from M.J. van Hemert (LUMC, the Netherlands); virus was produced in Vero E6 cells and harvested at 72hpi. Viral preparations were analyzed with respect to the infectious titer and the number of genome equivalents copies. The infectivity of DENV and WNV were determined by measuring the number of plaque-forming units (PFU) by plaque assay on BHK-15 cells and the number of genome-equivalent copies (GEc) by quantitative RT-PCR (RT-qPCR), as described previously82,83. For CHIKV and ZIKV, the infectious virus titer was
determined by standard plaque assay on Vero-WHO and Vero E6 cells, respec-tively and for CHIKV, reverse transcriptase quantitative PCR (RT-qPCR) was used to determine the number of genome equivalents copies (GEc)84. Virus inactivation
was performed by 1.5 h incubation of virus aliquots under UVS-28.8 watt Lamp. Inactivation to below level of detection 35 PFU/mL was confirmed using standard plaque assay on BHK-15 cells as described previously84. Briefly, for plaque assays,
cells were seeded in a 12-well plate. In all, 24 h later, cells were infected with 10-fold serial dilutions of the viral samples. At 2hpi cells were overlaid with 1% seaplaque agarose (Lonza, Swiss) prepared in 2x MEM. Plaques were counted at 44hpi for CHIKV, 72hpi for ZIKV and WNV, and 120hpi for DENVs. GEc were determined via RT-qPCR using a StepOne Real-Time PCR instrument (Applied Biosystems, Foster City, CA, USA). RNA extraction was performed using a QIAmp viral RNA mini kit (QIAGEN, Venlo, The Netherlands). cDNA synthesis from viral RNA was performed using Omniscript (QIAGEN) and the primers 5′-ACAGGCTATGGCA CTGTTACGAT-3′ (forward), 5′-TGCAGCAACACCATCTCATTG-3′ (reverse) for DENV, 5′AGCTCCGCGTCCTTTACCA-3′ (forward), 5′-GCCAAATTGT CCTGGTCTTCCT-3′ (reverse) for CHIKV, and (5′-GTTGGCGGCTGTTTTCT TTC-3′ (forward), 5′-GGGATCTCCCAGAGCAGAATT-3′ (reverse) for WNV. For qPCR the TaqMan probes 5′-FAM-AGTGCTCTCCAAGAACGGGCCTCG-T AMRA-3′, 5′-FAMCACTGTAACTGCCTATGCAAACGGCGAC-TAMRA-3′ and 5′-FAM–AATGGCTTATCACGATGCCCGCC–TAMRA-3′ (Eurogentec, Maas-tricht, The Netherlands) were used for DENVs, CHIKV and WNV, respectively. DNA amplification was performed for 40 cycles of 15 s at 95 °C and 60 s at 60 °C. The number of GEC was determined using a standard curve (correlation coeffi-cient > 0.995) of a quantified cDNA plasmid containing either the DENV prM and E sequence, the CHIKV E1 sequence or the non-structural genes of WNV NY99. All virus preparations used in this study were tested negative for Mycoplasma spp. using a commercial functional method (Lonza, the Netherlands) and/or in-house qPCR assay adapted from Baronti et al.78.
In vitro infections. PBMCs (1 × 106cell/mL) or HEK (5 × 104cells/mL) cells were
treated with 5μg/mL or 15 μg/mL, respectively of anti-hTLR2-IgA (clone B4H2, #maba2-htlr2), pab-hTLR6-IgG (polyclonal, #pab-hstlr6), pab-hTLR1-IgG (poly-clonal, #pab-hstlr1), anti-hCD14-IgA (clone D3B8, #maba-hcd14), human IgA2 isotype control (clone T9C6, #maba2-ctrl) or normal rat PAb IgG control blocking antibodies (InvivoGen, #pab-sctr) for 2 h followed by treatment with PAM3CSK4 (600 ng/mL, InvivoGen), LPS (1μg/mL, InvivoGen), DENV2 (MOI of 10 or its equivalent number of GEc (MOG of 1000) and UV-I DENV2 (MOG 1000 or MOG 3500) for 4, 6, 18, 24, 48, and 72 h). Since the production anti-hCD14IgA (clone B4H2) was discontinued, in experiments assessing the role of CD14 in DENV-infection, anti-hCD14-IgG (clone D3B8, #mabg-hcd14) and its Human IgG1 iso-type control were used (#bgal-mab1, both from InvivoGen). For viral production analysis, cells were washed after infection and media replenished (600 µL), 24 h later supernatants were collected and preserved at−80 °C. For endothelial cells activation analysis, cell-free supernatants were collected at 4, 24, 48, and 72 h post infection/treatment and preserved at−80 °C.
Monocyte subsets, TLR2 expression, and intracellular cytokines measure-ments. Surface expression of TLR2, CD14 and CD16 was measured on PBMCs directly after thawing of the cells, after treatments with the blocking antibodies but prior to infection and 24 and 48 h post infection/treatment with the agonists. Briefly, PBMCs were stained with Fixable Viability Dye eFluor 780 (1:500, #65-0865), CD282 (TLR2) PE (1:10, clone TL2.1, #12-9922-41), CD14 eFluor 450 (1:20, clone 613D, #48-0149-41) and CD16 APC (1:20, clone CB16, #17-0168-41). All purchased from eBioscience. Cells werefixed and washed with FACs buffer (PBS 1x, 2% FBS). Intracellular accumulation of TNF-α and IL-1β was measured at 6 h and 18 h post infection/treatment, respectively. Briefly, Brefeldin A (10 μg/mL, BioLegend) was added 6 h prior cytokine detection. PBMCs where then incubated withfixable viability dye eFluor 780. Cells were fixed, permeabilized and
intracellularly stained with TNF-α eFluor 450 (1:10, clone MAb11, #48-7349-41) or IL-1β FITC (1:5, clone B-A15, #BMS127FI), both from eBioscience. Samples were measured on a FACSverseflow cytometer (BD Biosciences). Isotype-matched antibodies labelled with PE (1:10, clone eBM2a), eFluor 450 (1:20, clone P3.6.2.8.1), APC (1:20, clone P3.6.2.8.1) and FITC (1:5, clone P3.6.2.8.1) (eBioscience) were used as controls to compare the expression of each marker. Data were analyzed using the Flowjo software (BD Biosciences).
NF-κB reporter assay. Human embryonic kidney reporter cell lines (HEK-Blue™ hTLR2 and HEK-Blue™ Null2 cells; 5 × 104cells/well) were infected or treated as
described in previous sections in a 96-wellflat bottom plate for 24 h at 37 °C, 5% CO2 atmosphere. To test if endocytosis is required for NF-κB stimulation, wort-mannin (Sigma Aldrich), pitstop 2 (Sigma Aldrich), dynasore (Sigma Aldrich), chloroquine (Sigma Aldrich), chlorpromazine (Sigma Aldrich) or ammonium chloride (NH4Cl, Merck) were added 1 h before infection or treatment with the agonist. After 24 h post infection or treatment, analysis of NF-κB stimulation was assessed by mixing the supernatants with QUANTI-Blue™ (InvivoGen). Absor-bance was measured at 630 nm using Synergy™ HT multi-mode microplate reader (BIOTEK). PAM3CSK4 (25 ng/mL) and PAM2CSK4 (1 ng/mL) were used as positive controls for hTLR2 cells, TNF-α (50 ng/mL, InvivoGen) for positive control in Null2 cells, and LPS (10 ng/mL) as a positive control for hTLR4 cells.
In vitro infection frequency and titration analyses. DENV infection was mea-sured by intracellular detection of the envelope E virus protein. Briefly, cells were stained intracellularly using a mouse anti-DENV E antibody (1:800, clone D1-4G2-4-15, Millipore, #MAB10216) followed by rabbit anti-mouse IgG-coupled to AF647 (1:2000, ThermoFisher, #A-21446). Unstained cells, mock-infected cells plus ondary antibody, mock-infected plus detection pair and infected cells plus sec-ondary antibody were included as controls in every experiment. UV-DENV was used as a control in PBMCs. Samples were measured on a FACSverse cytometer (BD Biosciences) and data were analyzed with Flowjo (BD Biosciences). For viral production, supernatants from infected HEK-Blue™ hTLR2 and human PBMC’s were analyzed by plaque assay and RT-qPCR as previously described82,83.
Endothelial cell activation assay. HUVEC were incubated with cell-free super-natants from infected and/or pre-treated PBMCs. In addition, direct DENV2 infection, exposure to UV-DENV2, RPMI media and TLR2/4 agonists PAM3CSK4 and LPS, served as controls. After 6 h of stimulation, cells were either lysed and stored at−20 °C for gene expression analysis or used directly for the expression analysis of activation markers using FACS. For FACS, cells were stained with the following antibodies CD62E E-selectin PE (1:100, clone HCD62E, #322606), CD106 VCAM-1 APC (1:100, clone STA, #305810) and CD54 ICAM-1 FITC (1:100, clone HCD54, #322720). Isotype-matched controls labelled with PE (1:100, clone RMG2a-62, #407107), APC (1:100, clone RMG1-1, #406609) and FITC (1:100, clone RMG1-1, #406605) were used as negative controls for comparing E-selectin, VCAM-1 and ICAM-1 expression, respectively. All surface staining antibodies were from BioLegend. Data were collected using a MACSQuant cyt-ometer (Miltenyi Biotec) and analyzed using the Flowjo software (BD Biosciences). For gene expression analysis, total RNA was isolated from HUVEC using a RNeasy Plus Mini Kit (Qiagen, Leusden, The Netherlands), according to the manufacturer’s instructions. RNA integrity was checked, cDNA synthesized and RT-qPCR per-formed using the ViiA 7 system (Applied Biosystems/ThermoFisher Scientific) as previously described85. Assay on demand primers were from Applied Biosystems
(Nieuwerkerk aan de IJssel, The Netherlands) included GADPH (Glyceraldehyde-3-phosphate dehydrogenase, Hs99999905_m1), E-selectin (Hs00174057_m1), VCAM-1 (vascular cell adhesion molecule-VCAM-1, Hs00365486_mVCAM-1), ICAM-VCAM-1 (intracellular adhesion molecule-1, Hs00164932_m1), IL-6 (Interleukin-6, Hs00174131_m1), IL-8 (Interleukin-8, Hs00174103_m1), MCP-1 (Monocyte chemotactic protein-1, Hs00234140_m1), CXCL6 (C-X-C Motif Chemokine Ligand 6, Hs00605742_g1). Duplicate real-time PCR analyses were performed for each sample, and the obtained threshold cycle (CT) values were averaged. Gene expression was nor-malized to the expression of housekeeping gene (GAPDH) resulting in theΔCT value. The relative mRNA level was calculated by 2−ΔCT.
Cytokine and chemokine determination. Protein levels of IL-1β, TNF-α, IL-6, IL-8, IL-10, IL-12p70, IP-10, GM-CSF, IFN-α2, IFN-β, IFN-γ, IFN-λ1, and IFN-λ2/3 were determined in cell-free supernatants using the human anti-virus response panel (13-plex, LEGENDplex™, BioLegend, #740390). Data were collected using a FACSverse flow cytometer (BD Biosciences) and analyzed using LEGENDplex™ v8.0 (BioLegend). Statistical analysis. Data analysis was performed using Prism 6.01 (Graphpad, USA). For patients’ data analysis two-tailed Mann–Whitney test was used to compare the data between groups where a p < 0.05 was considered significant. Unless indicated otherwise, data are shown as media ± SD or SEM. One-way Anova followed by Dunnet’s post hoc test was used for comparisons vs experimental controls. Paired one-tailed Student’s t-test, unpaired one-tailed Student’s t-test or two-tailed Mann–Whitney test were used to determine statistical significance of single experimental results. Correlations were determined by Pearson or Spearman