Characterisation of the sub-class B2 metallo-β-lactamase of Yersinia mollaretii Wauters

(1)

Characterisation of the sub-class B2 metallo-β-lactamase

of Yersinia mollaretii Wauters

Mercuri P.S.

1

_{, Blétard S.}

1

_{, Kerff F.}

2

_{and Galleni M.}

1

_{Macromolécules Biologiques}

1

_{and Cristallographie des}

Macromolécules Biologiques

2

_{, Centre d’Ingénierie des Protéines, Université de Liège, Liège, Belgium}

INTRODUCTION

Yersinia mollaretii (Y. mollaretii) strains were isolated from a terrestrial

ecosystem. There is no evidence that these organisms are pathogenic for humans.

Y. mollaretii bacteria are find in food, soil, water, and environment samples, but

several others were isolated from human, mainly from stools of patients with diarrhea (1). In this work we studied the metallo-β-lactamase (MBL) produced by

Y. mollaretii Wauters DMS 18520 and known as Y. mollaretii ATCC 43969 in

other collection. The search for newsubclass B2 MBLs was done using the CphA sequence as the template (Fig 1). We identified five potential new enzymes (2). All of the structural features that characterized a subclass B2 MBLs are highly conserved in all of the proteins.

Figure 1. ClustalW aligment of subclass B2 MBL. CLUSTAL 2.1 multiple sequence alignment.C.violaceum:

Chromobacterium violaceum ATCC12472; P.ferrooxidans: Pseudogulbenkiania ferrooxidans; C.piscinae: Chromobacterium piscinae; A.hydrophila CphA: Aeromonas hydrophila CphA; P. chlororaphis: Pseudomonas chlororaphis; S.Fonticola Sfh-I: Serratia Fonticola Sfh-I; Y.mollaretii: Yersinia mollaretii ATCC 43969,

I. Cloning of the gene coding for Y. mollaretii sub-class B2 MBL. The extraction of genomic

DNA was realised by the help of Wizard Genomic DNA purification kit. Two oligos YblaUP NedI and YblaRP BamHI, (respectively GCCATATGTTAAAAACAATATTACAA and CCGGATCCTTATTACTTATTAGCGGCTTC) were synthetised on the basis of the sequence NCBI Reference: NZ_AALD02000006.1 Figure 2 shows the PCR amplification. The gene Y.

mollaretii sub-class B2 MBL (742 bp) was

cloned into pJET 1.2 vector and subcloned for the production into pET 26b.

1000bp 750bp

Std PCR

Y. mollaretii MBL gene

Figure 2. PCR amplification of the gene

coding for Y. mollaretii sub-class B2 MBL.

II. Overexpression and purification of the MBL from Y. mollaretii. The enzyme was produced in E. coli

Rosetta (DE3) pLysS with the help of overexpression vector as pET26b. The metallo-β-lactamase was produced in TB medium at 18°C in presence of 100 µM IPTG and was purified in three steps, an ion exchange chromatography (Sepharose SP-HP column), a Pentadentate Chelator (PDC) Zn column, followed by a molecular sieve column Superdex 75 (Fig. 3a and b.) The theorical mass of the enzyme is 25547 Da.

Figure 3b. SDS-PAGE after passage through a Superdex

HR75 molecular sieve column. Lane A= load sample, lanes from B to E elutions purified fractions (from 6 to 9).

MW A B C D E

Figure 3a. Elution of Y. mollaretii sub-class B2 MBL on a Superdex HR75

molecular sieve column.

25 kDa

III. Kinetic parameters of the Y. mollaretii sub-class B2 MBL. The enzymatic

profile was studied on a representative numbers of carbapenems and compared to the steady state kinetic parameters of CphA enzyme (Table 1). Hydrolysis of antibiotics was followed by monitoring the variation of absorbance of carbapenems antibiotic in 50mM MES pH6.0.

Table 1. Comparison of the catalytic properties of Y. mollaretii and CphA sub-class B2 metallo-β-lactamases.

IV. Influence on the Y. mollaretii sub-class B2 MBL activity (Fig. 4). Enzyme activity was

measured by monitoring the initial rates of hydrolysis of 100µM of Imipenem in 50mM MES pH 6 in presence of increasing zinc concentration.

Figure 4. Zn effect on the Y. mollaretii sub-class B2 MBL and CphA

V. Inactivation by Zn-chelating agents. The loss of the metallo-β-lactamase was

monitored in the presence of different concentrations of EDTA (Fig.5) and dipinolic acid (Fig.6). The progressive inactivation was monitored by analysing the hydrolysis of 100µM Imipenem in 50 mM MES pH6.0

CONCLUSIONS

In this work, we studied the Y. mollaretii sub-class B2 MBL. It is a strict carbapenemase. Compared to CphA, the enzyme hydrolyses efficiently only imipenem and is less influenced by the presence of zinc ions, suggested that the affinity for the second zinc is lower. In addition, the enzyme was less affected by the presence of metal chelator as EDTA and dipinolinic acid. The comparison of the model strcuture of the Yersinia enzyme and CphA indicate three mutations that can affect the activity toward carbapenem, namely the presence of Y63, T158 and S236.

Figure 5. Inactivation of Y. mollaretii sub-class B2 MBL and CphA

by EDTA.

Figure 6. Inactivation of Y. mollaretii sub-class B2 MBL and CphA by

dipicolinic acid.

REFERENCES

1. Wauters G, l Janssens M.,. Steigerwalt A. G. and Brenner don J.1988.Yersinia mollaretii sp. nov. and Yersinia bercovieri sp. nov., Formerly Called Yersinia enterocolitica Biogroups 3A and 3B Int. J. Syst. Bacteriol. 424-429.

2. Bottoni C, Perilli M, Marcoccia F, Piccirilli A, Pellegrini C, Colapietro M, Sabatini A, Celenza G, Kerff F, Amicosante G, Galleni M, Mercuri PS. 2016. Kinetic Studies on CphA Mutants Reveal the Role of the P158-P172 Loop in Activity versus Carbapenems. Antimicrob. Agents Chemother. 60:3123-3126.