HAL Id: hal-02447177
https://hal.archives-ouvertes.fr/hal-02447177
Submitted on 21 Jan 2020
HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
H,K-ATPase type 2 regulates gestational 1 extracellular compartment expansion and blood pressure in mice.
Christine Walter, Chloe Rafael, Samia Lassad, Stephanie Baron, Amel Salhi, Gilles Crambert
To cite this version:
Christine Walter, Chloe Rafael, Samia Lassad, Stephanie Baron, Amel Salhi, et al.. H,K-ATPase type 2 regulates gestational 1 extracellular compartment expansion and blood pressure in mice.. AJP - Regulatory, Integrative and Comparative Physiology, American Physiological Society, In press,
�10.1152/ajpregu.00067.2019�. �hal-02447177�
H,K-ATPase type 2 regulates gestational extracellular compartment expansion and 1
blood pressure in mice.
2 3 4
Running title: H,K-ATPase type 2 and gestational blood pressure 5
6
Christine Walter$1,2, Chloé Rafael$1,2, Samia Lasaad1,2, Stéphanie Baron1,2,3, Amel Salhi1,2 and 7
Gilles Crambert1,2#
8 9
1Centre de Recherche des Cordeliers, INSERM, Sorbonne Université, USPC, Université Paris 10
Descartes, Université Paris Diderot, F-75006 Paris, France 11
2CNRS ERL 8228 - Laboratoire de Physiologie Rénale et Tubulopathies, F-75006, Paris, 12
France 13
3APHP, Hôpital Européen Georges Pompidou, Laboratoire de Physiologie, F-75015, Paris, 14
France 15
$ These authors contribute equally to the work 16
#To whom correspondence should be sent 17
18
Gilles CRAMBERT, Ph.D 19
Centre de Recherche des Cordeliers 20
Laboratoire de Physiologie Rénale et Tubulopathies 21
15 rue de l'Ecole de Médecine 22
75270 Paris cedex 23
Phone: 00 33 1 44 27 50 21 24
Fax : 00 33 1 46 33 41 72 25
e-mail : gilles.crambert@crc.jussieu.fr 26
27 28
Abstract 29
The modifications of the hemodynamic system and hydromineral metabolism are 30
physiological features characterizing a normal gestation. Thus, the ability to expand plasma 31
volume without increasing the level of blood pressure is necessary for the correct perfusion of 32
the placenta. The kidney is essential in this adaptation by reabsorbing avidly sodium and fluid.
33
In this study, we observed that the H,K-ATPase type 2 (HKA2), an ion pump expressed in 34
kidney and colon and already involved in the control of the K+ balance during gestation, is 35
also required for the correct plasma volume expansion and the maintain of a normal blood 36
pressure level. Indeed, compared to WT pregnant mice that exhibit a 1.6-fold increase of their 37
plasma volume, pregnant HKA2-null mice (HKA2KO) only modestly expand their 38
extracellular volume (x1.2). The renal expression of the epithelial Na channel (ENaC) alpha 39
and gamma subunits and that of the pendrin are stimulated in gravid WT mice whereas the 40
Na/Cl-cotransporter (NCC) expression is downregulated. These modifications are all blunted 41
in HKA2KO mice. This impeded renal adaptation to gestation is accompanied with the 42
development of hypotension in the pregnant HKA2KO mice. All together, our results showed 43
that the absence of the HKA2 during gestation leads to an “underfilled” situation and 44
established this transporter as a key player of the renal control of salt and potassium 45
metabolism during gestation.
46
Keywords: Pregnancy – Kidney – Blood pressure – ATP12A - Na+ retention 47
221 words 48
49 50 51
Introduction 52
The gestation is a physiological situation that requires strong adaptation of the cardio-renal 53
systems in order to cope with the demands of the growing fetus. For this purpose, the 54
extracellular volume is increased by 30-50% and is accompanied by a decrease of the plasma 55
osmolality and of the plasma Na+ level (13). Interestingly, under normal (non-gestational) 56
situation, the decrease of these two parameters should trigger the inhibition of the vasopressin 57
(AVP) production and renal water reabsorption in order to secrete fluid. However, during 58
gestation, the sensitivity of osmoreceptors is modified and AVP production is maintained for 59
reduced levels of plasma osmolality (13). In addition to salt and water, K+ is also retained 60
during gestation, in part, through the stimulation of the H,K-ATPase type 2 (HKA2) (30, 41).
61
This electroneutral transporter (4) consists of two subunits, a catalytic α subunit (encoded by 62
the Atp12a gene) that may combined, in heterologeous systems, with different chaperon-like 63
β subunits (10, 16). This transporter exhibits pharmacological and transport features common 64
to two closely related P-type ATPases, the Na,K-ATPase and the H,K-ATPase type 1 (for 65
review see, (9)). For instance, HKA2 may transport Na+ instead of H+ (5, 7, 10) and is 66
sensitive to ouabain (1, 8, 33) like the Na,K-ATPase and contributes to the renal secretion of 67
salt (14, 26). It also transports H+ and is sensitive to Schering 28080 (27) as the H,K-ATPase 68
type 1. The expression of the HKA2 is stimulated by progesterone through a nuclear 69
progesterone receptor-dependent pathways, which induces K+ retention (15, 17), a regulation 70
that may be relevant during gestation.
71
We have previously shown that the absence of the HKA2 impacts the gestation of mice by 72
impeding efficient K+ retention (30). Indeed, during gestation, the HKA2KO mice display a 73
decrease of the fertility rate, smaller litter size and higher mortality rate. This phenotype can 74
be reversed by a dietary supplementation in K+. Surprisingly, although those mice do not 75
retain K+ as efficiently as their WT littermate during gestation, their plasma K+ level remains 76
in the normal range (30). We have, therefore, drawn and tested the hypothesis that this normal 77
plasma K+ level may be the result of an altered extracellular volume expansion during 78
gestation of HKA2KO mice that would compensate for a putative development of 79
hypokalemia. Therefore we will focus on the regulation of the Na transport systems known to 80
be involved in plasma volume expansion during gestation Thus, we will study the 81
electrogenic transport system of Na+ present in the principal cells of the collecting duct 82
83
intercalated cells (mediated by the couple pendrin and the Na+-driven Cl-/HCO3- exchanger, 85
NDCBE) and the transport of water by the aquaporin 2 (AQP2).
86 87
Material and Methods 88
Animals 89
Experiments were performed on C57BL/6J wild-type and knock-out mice for the HKA2 α 90
subunit gene (22). All the animals were kept at CEF (Centre d’Explorations Fonctionnelles of 91
the Cordeliers Research Center, Agreement no. A75-06-12). All experiments were conducted 92
in accordance with the institutional guidelines and the recommendations for the care and use 93
of laboratory animals put forward by the Directive 2010/63/EU revising Directive 94
86/609/EEC on the protection of animals used for scientific purposes (project has been 95
approved by a user establishment’s ethics committee and the Project Authorization : number 96
2289.01). Female WT and HKA2KO were placed for a night with a WT isolated male. The 97
observation of a vaginal plug the next morning confirms the mating. The weight of females is 98
then followed every day to confirm the pregnancy (P). Non-pregnant female mice (not mated 99
with males, NP) served as control for all measured parameters.
100
Physiological measurements 101
To record physiological parameters, NP and pregnant (day 16, P) mice were placed in 102
metabolic cages (Techniplast, France) and were fed a standard laboratory diet (0.3 % Na + and 103
0.6 % K+; Safe France for more information regarding the detailed composition see 104
http://www.safe-diets.com/wp-content/uploads/2018/01/DS-SAFE-A04.pdf). In mice the 105
gestation lasts 18-20 days, we have therefore chosen day 16 as a representative time point of 106
the late phase of the pregnancy. Urinary creatinine concentrations were determined using an 107
automatic analyzer (Konelab 20i; Thermo, Cergy Pontoise, France). Urinary Na+ 108
concentration was determined by flame photometry (IL943, Instruments laboratory, France) 109
and plasma parameters (plasma Na+ and hematocrit) were measured by retro-orbital puncture 110
on the anesthetized animal with an ABL77 pH/blood-gas analyzer (Radiometer, Lyon, 111
France). Thiazide (HCTZ) and amiloride-sensitive natriuresis were measured as previously 112
described (21, 25). Briefly, the diuretics were administered intraperitoneally in conscious 113
animals placed in metabolic cages (HCTZ: 50mg/kg for 6h of urine collection and amiloride:
114
5mg/kg for 4h of urine collection). Plasma volume was determined by Evans blue dye 115
dilution as previously described (3, 6, 24) in anesthetized animals (a mix of xylazine, 116
10mg/kg and ketamine 100mg/kg). Plasma osmolality was measured using an osmometer 117
(Vogel, Bioblock Scientific, Strasbourg, FR). Urine aldosterone concentration was 118
hours pH 1 acid hydrolysis. Blood pressure was measured in conscious restrained mice by a 120
tail-cuffed plethysmography method (BP2000, Visitech system, France) after a week of 121
adaptation to the apparatus between 9:00 and 11:00 AM before mating. We have chosen the 122
tail-cuffed technic instead of the telemetry because it is less invasive and do not require to 123
anesthetize the pregnant mice to implant the probe. After these measurements, non-pregnant 124
and pregnant females were sacrificed for tissue and organ removal.
125
Quantitative PCR 126
RNAs were extracted from whole kidneys using the TRI reagent (Invitrogen, Villebon sur 127
Yvette, France) following the manufacturer’s instructions. One µg of total RNA was then 128
reverse-transcribed using the first strand cDNA synthesis kit for RT-PCR (Roche Diagnostics, 129
France) according to the manufacturer’s instructions. Real-time PCRs were performed on a 130
LightCycler (Roche Diagnostics, France). No signal was detected in samples that did not 131
undergo reverse transcription or in blank runs without cDNA. In each run, a standard curve 132
was obtained using serial dilution of stock cDNA prepared from mouse kidney total RNA.
133
The expression of the Rps15 gene is used to normalize the results. The renal expression of this 134
gene is not modified by pregnancy (data not shown). Specific primers for ENaCα (up 135
CCAAACGAACCGAACAC; down TGTCAGACTTACTCTAGCC),
136
ENaCβGGTCCTTATTGATGAGCG; down AGGCGTGAAGTTCCGA), EnaCγ 137
(up TCGGTCGTCTGTGTCA; down GCAGATCATCGTCCGTAT), pendrine (up 138
CAAAATACCGAGTCAAGGAATGGCT; down CGTTACCGCTGGGCACAAGA), NCC 139
(up TCTCACCCTCCTCATCCCCTATCT; down CAGAGCAGCATCCCGAGAGTAATC), 140
NDBCE (up TTCAACCCATTCAAACTCTTCTATGT; down
141
CCAATGAGCTGAAGCAAGAAA) and rps15 (up TTTCCGAGTAACCGCC; down 142
GCAGTGAGTGTTGCTT) transcripts were chosen using the LC Probe design 2.0 software.
143
Membrane protein extraction and Western Blot Analysis 144
Total kidneys were homogenized in a lysis buffer (250 mM sucrose, 100 mM Tris-Hepes, pH 145
7.4 and protease inhibitor cocktail (Complete, Roche Diagnostics)). After removal of 146
aggregates and nuclear-associated membrane by low-speed centrifugations, the plasma 147
membrane enriched fraction (17000 x g for 30 min) was recovered into the lysis buffer and its 148
protein content was measured with the BCA method (Thermo Scientific Pierce). Forty µg of 149
protein were then denaturated, resolved by SDS-PAGE (10% polyacrylamide) and transferred 150
onto a nitrocellulose membrane. Ponceau red labelling was carried out to check for protein 151
loading accuracy. Western blots were performed according to the standard procedure using a 152
polyclonal rabbit anti-ENaCα, anti-ENaCγ, anti-NCC (kindly provided by Jan Loffing, 153
University of Zurich, Switzerland) and anti-pendrin (kindly provided by Régine Chambrey, 154
Université de la Réunion, France). For quantification, the band intensities were determined 155
(ImageJ software) and normalized by Ponceau S red intensity.
156
Localization of ENaC, NCC and AQP2 on kidney slices 157
In virgin (NP) or at day 16 of pregnancy (P), anesthetized mice (10mg/kg xylazine and 158
100mg/kg ketamine) were perfused with 4% paraformaldehyde in the aorta and the kidneys 159
were removed and frozen in optimal cutting temperature compound (VWR). Five µm thick 160
slices were then processed for immunofluorescence microscopy using either an anti-ENaCγ 161
antibody (1/400, StressMarq Biosciences) or an anti-NCC antibody (1/400, StressMarq 162
Biosciences) or an anti-AQP2 (1/400, Santa Cruz). For each antibody, four samples (WT NP, 163
WT P, HKA2KO NP and HKA2KO P, 3 mice/group) were positioned on the same glass slide 164
and treated simultaneously to permit direct comparison of signal intensity. For all slides, the 165
pictures were taken with the same parameters of exposition and magnification (x20).
166
Organization of the experimental procedures and statistical analysis 167
The groups of animals that have been used for expression analysis of transporters (PCR, 168
Western blot or immunofluorescence) have not been submitted to any pharmacological 169
treatments (thiazide or amiloride) or blood pressure measurement, have not been punctionned 170
for blood collection (plasma parameters) or used for plasma volume measurement (Blue 171
Evans) to avoid any possible side effects of these procedures on the results of protein or gene 172
expression. The groups of animals used for plasma volume measurement (Blue Evans) did not 173
undergo other procedures. BP measurements were carried out on groups of animals that did 174
not undergo other procedures (blood collection, metabolic cages, pharmacological treatment).
175
Results are shown as mean ± s.e.m. Data were tested for significance using two-way ANOVA 176
test followed by a Bonferroni’s multiple comparisons post-test or Student’s test where 177
appropriate (Prism Software). Outliers were tested by ROUT analysis (Prism Software).
178 179 180
Results 181
Gestation-induced extracellular volume expansion is blunted in HKA2KO mice 182
The bodyweight of the non-pregnant NP and pregnant P WT and HKA2KO mice are similar 183
(Table 1) and the number of fetus observed after sacrifice of pregnant females at day 16 post- 184
coïtus is not significantly different between both genotypes (Table1). In WT mice, the late 185
phase of gestation is characterized by a decrease of plasma osmolality (331±14 vs 296±5 186
mOsm/kg, p=0.038 in non-pregnant NP and pregnant P WT mice, respectively Figure 1A, 187
dots), a decrease of plasma Na+ (150.0±0.4 vs 144.6±0.4 mM, p<0.01 in NP and P WT mice, 188
respectively Fig 1B dots) and a decrease of haematocrit (38.9±0.8 vs 36.5±0.4 %, p=0.019 in 189
NP and P WT mice, respectively Figure 1C, dots). To clearly characterize the volume 190
expansion occurring during gestation we measured it directly with the Evans blue dye dilution 191
method and observed that plasma volume is 1.6-fold increased during gestation in WT mice 192
(990±60 µl vs 1592±193 µl, p<0.01 in NP and P WT mice, respectively Figure 1D, dots). All 193
these modifications induced by the gestation are blunted in HKA2KO mice (Figures 1A-C, 194
squares), their plasma osmolality and haematocrit remain stable (compare to NP HKA2KO 195
mice), their plasma Na+ significantly decreases (Figure 1B, 146.5±0.5 mM) but less than in 196
WT (p<0.01) and their plasma volume expansion is limited and is only increased by 20%
197
(1012±71 µl vs 1273±61 µl, p<0.01 in NP and P HKA2KO mice Figure 1D, squares).
198
ENaC expression is differentially regulated in WT and HKA2KO mice during gestation 199
To understand why the HKA2KO mice did not expand their plasma volume during gestation 200
as the WT mice did, we analyzed the expression of different renal ion transporters known to 201
participate in the salt homeostasis by qPCR (normalized by the expression of rps15, Figure 202
2A), by Western blot and immunolabelling. ENaC, mediating the electrogenic Na+ 203
reabsorption in the collecting duct is composed of three subunits (α, β and γ). As shown in 204
Figures 2B, the expression of ENaCα is stimulated (by 40%, p<0.05) during gestation in 205
kidney of pregnant WT mice (circles) but that of the HKA2KO remains similar before and 206
during gestation (squares). Consequently, the expression level of ENaCα is 30% higher in 207
pregnant WT than in pregnant HKA2KO (p<0.05). As for the β subunit of ENaC, its mRNA 208
expression is not modified by pregnancy and is similar in both genotypes (Figure 2C). The 209
ENaCγ subunit expression only tends to increase during pregnancy in WT mice (Figure 2D, 210
circles, not significant) but is significantly (p<0.05) decreased by 50% in pregnant vs non- 211
pregnant HKAKO mice. Thus, the level expression of ENaCγ subunit is also much lower in 212
pregnant HKA2KO than in pregnant WT (p<0.05). As shown in Figure 2E, although urine 213
aldosterone is increased during pregnancy in both genotypes, it is significantly lower in 214
pregnant HKA2KO mice. When we investigated the protein expression of ENaCα subunit 215
during gestation, we confirmed that it is increased in WT pregnant mice compared to WT 216
non-pregnant mice (Figure 3A, both full-length 90kDa and cleaved 30 kDa bands). In 217
HKA2KO mice, the protein expression of the ENaCα subunit is not modified by pregnancy 218
(Figure 3A). As for the ENaCγ, its protein expression is increased in pregnant WT compared 219
to non-pregnant WT mice (Figure 3B-C) but is not modified by pregnancy in HKA2KO mice 220
(Figure 3B-C).
221
NCC, pendrin and NDCBE expression during gestation of WT and HKA2KO mice 222
In addition to ENaC, the distal nephron also expresses two thiazide-sensitive systems of Na+ 223
reabsorption, NCC in the distal convoluted tubule (DCT) and the pendrin/NDCBE couple in 224
the β-intercalated cell of the collecting duct. During gestation of WT mice, mRNA expression 225
of NCC is decreased by 50% (Figure 4A, circles, p<0.05) whereas it remains stable in 226
HKA2KO mice (squares, Figure 4A). The mRNA expression of pendrin is strongly increased 227
in pregnant WT (Figure 4B, circles, p<0.01) whereas it remains unchanged in HKA2KO mice.
228
As for NDCBE, its mRNA expression is not significantly modified during gestation in any 229
genotypes (Figure 4C). At the protein level the results are in good agreement with the 230
observed change at the mRNA level since total NCC expression decreased by 50% during 231
gestation in WT mice but remains unchanged in HKA2KO mice (Figure 4D-E). Protein 232
expression of pendrin is also strongly increased by pregnancy in WT mice and remained 233
unchanged in HKA2KO mice (Figure 4F).
234
AQP2 expression is not differentially regulated in WT and HKA2KO mice during gestation 235
We tested the possibility that the water transport system mediated by AQP2 could also be 236
altered during pregnancy in HKA2KO compared to WT mice. As shown in Figure 5, the 237
expression of AQP2 (A and B) and its localization (C) in the principal cells of the collecting 238
ducts are similar in both genotypes whatever the gestational status.
239
HKA2KO mice exhibit urine salt loss and hypotension during pregnancy 240
As shown before (30) , WT or HKA2KO mice increase their food intake by 15-20% during 241
gestation (Figure 6A, p<0.05). However, in parallel, the renal excretion of Na+ is not 242
increased (Figure 6B) in the same proportion in pregnant WT mice, characterizing the 243
gestation-induced renal Na+ retention. Conversely, the renal excretion of Na+ (Figure 6B) is 244
increased in pregnant HKA2KO mice (p<0.05), matching their food intake and revealing that 245
they do not retain Na+ as the WT did and therefore do not adapt to the context of gestation.
246
The Na+ retention induced by pregnancy in WT mice is correlated with an increased 247
sensitivity of Na+ excretion to amiloride (by 50%, p<0.05, Figure 6C, circles), a result, which 248
is also in a good agreement with the increased expression of ENaC in WT pregnant mice 249
(Figure 2B, 3A-C). This gestation-induced stimulation of ENaC activity is not present in 250
HKA2KO mice (Figures 6C, squares). Interestingly, two transport systems, NCC and the 251
couple pendrin/NDCBE have been described as being sensitive to thiazide (21). As shown in 252
Figure 6D, the thiazide-sensitive Na+ excretion is not modified by pregnancy, neither in WT 253
nor in HKA2KO mice. This suggests that in WT pregnant mice, the downregulation of NCC 254
(Figure 4A-D-E), is compensate by the upregulation of the pendrin (Figure 4 B-F) as recently 255
proposed by West and collaborators (40) during pregnancy in rat.
256
HKA2KO mice exhibit a decreased blood pressure level during pregnancy 257
In non-pregnant WT and HKA2KO mice, the BP is similar (117.6 vs 114.1 mm Hg, Figure 7 258
day 0) but the inability of HKA2KO mice to expand their plasma volume during gestation 259
compared to WT mice (because of their renal loss of Na+) negatively impacts their blood 260
pressure (BP). Thus, in WT (circles) and HKA2KO mice (squares), the BP is significantly 261
modified during gestation. Indeed, as shown in Figure 7, the BP of pregnant WT mice 262
remained similar to that measured before pregnancy (day 0) as already reported (12, 34).
263
However, the BP of HKA2KO mice decreased during the middle phase of gestation and 264
remained 10 mm of Hg lower than that of WT mice.
265 266 267
268 269
DISCUSSION 270
The ability to retain K+ during gestation through the activation of the HKA2 is of crucial 271
importance since the absence of this transporter disturbs the process of fertility (30). During 272
gestation, the HKA2KO mice exhibited a slight renal and strong intestinal loss of K+ resulting 273
in the decrease of litter size, however, without any impact on the plasma [K+] level (30). This 274
was intriguing since in parallel, gestation is a physiological situation characterized by a 275
plasma volume expansion that should lead to a dilution of the plasma components if they are 276
not efficiently retained. We therefore hypothesized that the gestational volume expansion that 277
occurs normally in WT mice could be attenuated in HKA2KO mice.
278 279
Limiting plasma volume expansion to avoid the development of hypokalemia?
280
As shown before (37, 39), the renal adaptation of the WT mice and rats to pregnancy involves 281
the stimulation of Na+ reabsorbing pathways in the collecting duct (ENaC and pendrin) and 282
the downregulation of NCC expression. This situation, somehow, resembles at the 283
mechanisms observed to excrete a load of K+, but in WT pregnant mice or rats, this process is 284
counterbalanced by the stimulation of the HKA2 (30, 41), allowing K+ to be retained even 285
when ENaC is stimulated. Interestingly, in the absence of HKA2, the lack of K+ reabsorption 286
should have resulted to a decrease of plasma [K+], but instead, we observed that it is the Na+ 287
and fluid reabsorption, and in fine, the size of the plasma compartment that is affected. In the 288
absence of the HKA2, the mice are in a paradoxical situation since they need to reduce K loss 289
by decreasing aldosterone production and ENaC activity whereas the increase of the vascular 290
compartment size requires a stimulation of these systems to fill it in. This explains the 291
limitation of the aldosterone production that we observed and is well correlated with the 292
similar gestational phenotype observed in aldosterone synthase KO mice (34) or in pregnant 293
rats treated with benzamil (38) in which the extracellular volume expansion is also blunted.
294
This crosstalk between the processes controlling the plasma [K+] and the volemia has already 295
been observed in order to protect male mice under dietary K+ restriction against the 296
development of hypokalemia (35). Indeed, in the absence of the HKA2 male mice under low- 297
K+ diet for a short period of time display a renal loss of Na+ and fluid that has been partially 298
attributed to a blockade of the vasopressin action. This eventually contributes to a reduction 299
system of the collecting duct, based on AQP2 expression analysis, does not seem disturbed 301
neither in normal pregnancy of WT mice, which is different of what has been observed in rat 302
(28) nor in HKA2KO mice. Here, our results rather suggest that in pregnant mice, the lack of 303
HKA2 contributes to a renal loss of fluid through the inappropriate regulation of ENaC 304
(which is not stimulated in pregnant HKA2KO mice). The mechanisms by which this blunted 305
stimulation of ENaC takes place in HKA2KO mice are not known but they may be related to 306
preservation of the plasma [K+], avoiding an excess of K+ secretion trough the principal cells 307
of the collecting duct. In parallel, this impaired stimulation of ENaC would also result in an 308
inappropriate Na+ retention impeding the normal extracellular volume expansion. Since the 309
HKA2 is strongly expressed in colon, we cannot exclude that the effects observed in the KO 310
mice are linked to a fecal loss of K+. However, whatever the origin of the K+ balance 311
disturbance, it requires a renal adaptation that leads to the observed gestational phenotypes.
312
We propose that these two effects protect the organism against the development of 313
hypokalemia, by limiting the K+ loss in the urine and reducing the plasma volume. Indeed, if 314
the HKA2KO mice expand their plasma volume as their WT littermate do, their plasma [K+] 315
level should decrease by 25%, which would result to a severe hypokalemia.
316 317
Is HKA2 a putative target to deal with blood pressure modification during the pregnancy ? 318
The HKA2 therefore appears to be at the crossroad between the regulation of K+, Na+ and 319
water metabolism. Its absence during pregnancy leads to compensatory mechanisms that tend 320
to preserve plasma [K+] level but that leads to hypotension. Interestingly, chronic hypotension 321
during gestation is observed in 2-3% of the pregnancies and is associated with a higher rate of 322
threatened abortion, higher occurrence of severe nausea or vomiting and anemia (2). It would 323
be interesting to investigate whether a low blood pressure during gestation could be related to 324
polymorphisms in the Atp12a gene encoding the catalytic subunit of the HKA2.
325
Conversely, the identification of the HKA2 as a possible target to reduce blood pressure 326
during pregnancy may also be interesting in the context of gestational hypertension and more 327
particularly during preeclampsia. The volemic status of preeclamptic patient remains 328
controversial, perhaps because this disease is heterogeneous with at least two different 329
components, an early- and a late-onset preeclampsia. At least, the late-onset preeclampsia has 330
been correlated with an increase of total body fluid (18) and of the plasma volume (31, 32). In 331
this context, the inhibition of the HKA2 could be an interesting therapeutic approach to help 332
decreasing BP. The pharmacology of the HKA2 is complicated and has not been fully 333
investigated (for review see (9)). However, some data exist in the literature that suggest that 334
the HKA2 may be inhibited by the “proton-pump inhibitors” (PPI) of the omeprazole family 335
(11, 20, 23, 36). These compounds are well-known to inhibit the H,K-ATPase type 1, which 336
is structurally and functionally closely related to the HKA2. Recently, these compounds have 337
been proposed to reduce the level of blood pressure in a model of preeclamptic mice (29). In 338
this paper, the authors did not formerly identify the target of omeprazole in this pathological 339
context. Interestingly, PPIs were also shown to reduce blood pressure in hypertensive patients 340
(19). In light of our own results, we propose that omeprazole may inhibit the HKA2 in the 341
preeclamptic, leading to a modification of the K+, Na+ and water balances and thus favoring a 342
decrease of plasma volume and of blood pressure. This hypothesis would have to be 343
investigated further.
344 345
Perspectives and Significance 346
The results of this study establish that the correct expansion of the plasma volume during 347
pregnancy requires the presence of an active HKA2. Indeed, the absence of the HKA2 in 348
pregnant mice, which is already known to promote intestinal and renal K+ leaks (30), results 349
in a reduced volemic expansion allowing the concentration of K+ in the extracellular 350
compartment to limit the development of hypokalemia. The consequence of this “underfilled”
351
situation is a lowering of the blood pressure during the late phase of the gestation. The HKA2 352
appears therefore as a key ion transporter in the physiological adaptation to gestation that 353
controls both K+ and Na+ metabolisms.
354 355
AKNOWLEDGMENTS 356
Physiological analysis have been performed with the help of Gaelle Brideau and Nadia 357
Frachon from the “platforme d’exploration fonctionnelle du petit animal” of the team 358
“Physiologie Rénale and Tubulopathies” at the Centre de Recherche des Cordeliers. We are 359
grateful for the technical assistance of the CEF crews in the management of our colony of 360
mice. This study was supported by recurrent grants from the Institut National de la Santé et de 361
la Recherche Médicale (INSERM) and from the Centre National de la Recherche Scientifique 362
(CNRS). It was also supported by the Fondation pour la Recherche Médicale (FRM, project 363
DPC20171138949).
364 365 366
REFERENCES 367
1. Asano S, Hoshina S, Nakaie Y, Watanabe T, Sato M, Suzuki Y, and Takeguchi 368
N. Functional expression of putative H+-K+-ATPase from guinea pig distal colon. Am J 369
Physiol 275: C669-674, 1998.
370 2. Banhidy F, Acs N, Puho EH, and Czeizel AE. Hypotension in pregnant women: a 371
population-based case-control study of pregnancy complications and birth outcomes.
372
Hypertens Res 34: 55-61, 2011.
373
3. Barron WM, Stamoutsos BA, and Lindheimer MD. Role of volume in the 374
regulation of vasopressin secretion during pregnancy in the rat. J Clin Invest 73: 923-932, 375
1984.
376
4. Burnay M, Crambert G, Kharoubi-Hess S, Geering K, and Horisberger JD.
377 Bufo marinus bladder H-K-ATPase carries out electroneutral ion transport. Am J Physiol 378
Renal Physiol 281: F869-874, 2001.
379
5. Codina J, Pressley TA, and DuBose TD, Jr. The colonic H+,K+-ATPase functions 380
as a Na+-dependent K+(NH4+)-ATPase in apical membranes from rat distal colon. J Biol 381
Chem 274: 19693-19698, 1999.
382
6. Cole JM, Khokhlova N, Sutliff RL, Adams JW, Disher KM, Zhao H, Capecchi MR, 383
Corvol P, and Bernstein KE. Mice lacking endothelial ACE: normal blood pressure with 384 elevated angiotensin II. Hypertension 41: 313-321, 2003.
385
7. Cougnon M, Bouyer P, Planelles G, and Jaisser F. Does the colonic H,K-ATPase 386
also act as an Na,K-ATPase? Proc Natl Acad Sci U S A 95: 6516-6520, 1998.
387
8. Cougnon M, Planelles G, Crowson MS, Shull GE, Rossier BC, and Jaisser F. The 388
rat distal colon P-ATPase alpha subunit encodes a ouabain-sensitive H+, K+-ATPase. J 389
Biol Chem 271: 7277-7280, 1996.
390
9. Crambert G. H-K-ATPase type 2: relevance for renal physiology and beyond. Am J 391 Physiol Renal Physiol 306: F693-700, 2014.
392
10. Crambert G, Horisberger JD, Modyanov NN, and Geering K. Human nongastric 393
H+-K+-ATPase: transport properties of ATP1al1 assembled with different beta-subunits.
394
Am J Physiol Cell Physiol 283: C305-314, 2002.
395
11. Delpiano L, Thomas JJ, Yates AR, Rice SJ, Gray MA, and Saint-Criq V.
396
Esomeprazole Increases Airway Surface Liquid pH in Primary Cystic Fibrosis Epithelial 397 Cells. Front Pharmacol 9: 1462, 2018.
398
12. Doridot L, Passet B, Mehats C, Rigourd V, Barbaux S, Ducat A, Mondon F, 399
Vilotte M, Castille J, Breuiller-Fouche M, Daniel N, le Provost F, Bauchet AL, 400
Baudrie V, Hertig A, Buffat C, Simeoni U, Germain G, Vilotte JL, and Vaiman D.
401
Preeclampsia-like symptoms induced in mice by fetoplacental expression of STOX1 are 402
reversed by aspirin treatment. Hypertension 61: 662-668, 2013.
403
13. Durr JA, Stamoutsos B, and Lindheimer MD. Osmoregulation during pregnancy 404 in the rat. Evidence for resetting of the threshold for vasopressin secretion during 405
gestation. J Clin Invest 68: 337-346, 1981.
406
14. Edwards A, and Crambert G. Versatility of NaCl transport mechanisms in the 407
cortical collecting duct. Am J Physiol Renal Physiol 313: F1254-F1263, 2017.
408
15. Elabida B, Edwards A, Salhi A, Azroyan A, Fodstad H, Meneton P, Doucet A, 409
Bloch-Faure M, and Crambert G. Chronic potassium depletion increases adrenal 410
progesterone production that is necessary for efficient renal retention of potassium.
411 Kidney Int 80: 256-262, 2011.
412
16. Geering K, Crambert G, Yu C, Korneenko TV, Pestov NB, and Modyanov NN.
413
Intersubunit interactions in human X,K-ATPases: role of membrane domains M9 and 414
M10 in the assembly process and association efficiency of human, nongastric H,K- 415
ATPase alpha subunits (ATP1al1) with known beta subunits. Biochemistry 39: 12688- 416
12698, 2000.
417
17. Grimont A, Bloch-Faure M, El Abida B, and Crambert G. Mapping of sex 418 hormone receptors and their modulators along the nephron of male and female mice.
419
FEBS Lett 583: 1644-1648, 2009.
420
18. Gyselaers W, Vonck S, Staelens AS, Lanssens D, Tomsin K, Oben J, Dreesen P, 421
and Bruckers L. Body fluid volume homeostasis is abnormal in pregnancies 422
complicated with hypertension and/or poor fetal growth. PLoS One 13: e0206257, 2018.
423
19. Joya-Vazquez P, Bacaicoa MA, Velasco R, Chicon JL, Trejo S, Carrasco MA, 424
Robles NR, and Munoz-Torrero JFS. Proton-pump inhibitors therapy and blood 425 pressure control. Intern J Pharmacol Res 4: 142-147, 2014.
426
20. Lameris AL, Hess MW, van Kruijsbergen I, Hoenderop JG, and Bindels RJ.
427
Omeprazole enhances the colonic expression of the Mg(2+) transporter TRPM6. Pflugers 428
Arch 465: 1613-1620, 2013.
429
21. Leviel F, Hubner CA, Houillier P, Morla L, El Moghrabi S, Brideau G, Hassan H, 430
Parker MD, Kurth I, Kougioumtzes A, Sinning A, Pech V, Riemondy KA, Miller RL, 431
Hummler E, Shull GE, Aronson PS, Doucet A, Wall SM, Chambrey R, and Eladari D.
432 The Na+-dependent chloride-bicarbonate exchanger SLC4A8 mediates an electroneutral 433
Na+ reabsorption process in the renal cortical collecting ducts of mice. J Clin Invest 120:
434
1627-1635, 2010.
435
22. Meneton P, Schultheis PJ, Greeb J, Nieman ML, Liu LH, Clarke LL, Duffy JJ, 436
Doetschman T, Lorenz JN, and Shull GE. Increased sensitivity to K+ deprivation in 437
colonic H,K-ATPase-deficient mice. J Clin Invest 101: 536-542, 1998.
438
23. Min JY, Ocampo CJ, Stevens WW, Price CPE, Thompson CF, Homma T, Huang 439 JH, Norton JE, Suh LA, Pothoven KL, Conley DB, Welch KC, Shintani-Smith S, Peters 440
AT, Grammer LC, 3rd, Harris KE, Hulse KE, Kato A, Modyanov NN, Kern RC, 441
Schleimer RP, and Tan BK. Proton pump inhibitors decrease eotaxin-3/CCL26 442
expression in patients with chronic rhinosinusitis with nasal polyps: Possible role of the 443
nongastric H,K-ATPase. J Allergy Clin Immunol 139: 130-141 e111, 2017.
444
24. Morgan TK, Rohrwasser A, Zhao L, Hillas E, Cheng T, Ward KJ, and Lalouel 445
JM. Hypervolemia of pregnancy is not maintained in mice chronically overexpressing 446 angiotensinogen. Am J Obstet Gynecol 195: 1700-1706, 2006.
447
25. Morla L, Brideau G, Fila M, Crambert G, Cheval L, Houillier P, Ramakrishnan 448
S, Imbert-Teboul M, and Doucet A. Renal proteinase-activated receptor 2, a new actor 449
in the control of blood pressure and plasma potassium level. J Biol Chem 288: 10124- 450
10131, 2013.
451
26. Morla L, Doucet A, Lamouroux C, Crambert G, and Edwards A. The renal 452
cortical collecting duct: a secreting epithelium? J Physiol 2016.
453 27. Nakamura S, Amlal H, Galla JH, and Soleimani M. Colonic H+-K+-ATPase is 454
induced and mediates increased HCO3- reabsorption in inner medullary collecting duct 455
in potassium depletion. Kidney Int 54: 1233-1239, 1998.
456
28. Ohara M, Martin PY, Xu DL, St John J, Pattison TA, Kim JK, and Schrier RW.
457
Upregulation of aquaporin 2 water channel expression in pregnant rats. J Clin Invest 101:
458
1076-1083, 1998.
459
29. Onda K, Tong S, Beard S, Binder N, Muto M, Senadheera SN, Parry L, 460 Dilworth M, Renshall L, Brownfoot F, Hastie R, Tuohey L, Palmer K, Hirano T, 461
Ikawa M, Kaitu'u-Lino T, and Hannan NJ. Proton Pump Inhibitors Decrease Soluble 462
fms-Like Tyrosine Kinase-1 and Soluble Endoglin Secretion, Decrease Hypertension, and 463
30. Salhi A, Lamouroux C, Pestov NB, Modyanov NN, Doucet A, and Crambert G.
465
A link between fertility and K+ homeostasis: role of the renal H,K-ATPase type 2.
466
Pflugers Arch 465: 1149-1158, 2013.
467 31. Schrier RW, and Briner VA. Peripheral arterial vasodilation hypothesis of 468
sodium and water retention in pregnancy: implications for pathogenesis of 469
preeclampsia-eclampsia. Obstet Gynecol 77: 632-639, 1991.
470
32. Stergiotou I, Crispi F, Valenzuela-Alcaraz B, Bijnens B, and Gratacos E.
471
Patterns of maternal vascular remodeling and responsiveness in early- versus late-onset 472
preeclampsia. Am J Obstet Gynecol 209: 558 e551-558 e514, 2013.
473
33. Swarts HG, Koenderink JB, Willems PH, and De Pont JJ. The non-gastric H,K- 474 ATPase is oligomycin-sensitive and can function as an H+,NH4(+)-ATPase. J Biol Chem 475
280: 33115-33122, 2005.
476
34. Todkar A, Di Chiara M, Loffing-Cueni D, Bettoni C, Mohaupt M, Loffing J, and 477
Wagner CA. Aldosterone deficiency adversely affects pregnancy outcome in mice.
478
Pflugers Arch 464: 331-343, 2012.
479
35. Walter C, Ben Tanfous M, Igoudjil K, Salhi A, Escher G, and Crambert G. H,K- 480
ATPase type 2 contributes to salt-sensitive hypertension induced by K+ restriction. Pflug 481 Arch Eur J Phy 468: 1673-1683, 2016.
482
36. Watanabe T, Suzuki T, and Suzuki Y. Ouabain-sensitive K(+)-ATPase in 483
epithelial cells from guinea pig distal colon. Am J Physiol 258: G506-511, 1990.
484
37. West C, Zhang Z, Ecker G, and Masilamani SM. Increased renal alpha-epithelial 485
sodium channel (ENAC) protein and increased ENAC activity in normal pregnancy. Am J 486
Physiol Regul Integr Comp Physiol 299: R1326-1332, 2010.
487
38. West CA, Han W, Li N, and Masilamani SM. Renal epithelial sodium channel is 488 critical for blood pressure maintenance and sodium balance in the normal late pregnant 489
rat. Exp Physiol 99: 816-823, 2014.
490
39. West CA, McDonough AA, Masilamani SM, Verlander JW, and Baylis C. Renal 491
NCC is unchanged in the midpregnant rat and decreased in the late pregnant rat despite 492
avid renal Na+ retention. Am J Physiol Renal Physiol 309: F63-70, 2015.
493
40. West CA, Verlander JW, Wall SM, and Baylis C. The chloride-bicarbonate 494
exchanger pendrin is increased in the kidney of the pregnant rat. Exp Physiol 100: 1177- 495 1186, 2015.
496
41. West CA, Welling PA, West DA, Jr., Coleman RA, Cheng KY, Chen C, DuBose 497
TD, Jr., Verlander JW, Baylis C, and Gumz ML. Renal and colonic potassium 498
transporters in the pregnant rat. Am J Physiol Renal Physiol 314: F251-F259, 2018.
499 500 501
502
FIGURE LEGENDS 503
504
Fig. 1: Characteristics of the plasma volume expansion during gestation in WT and 505
HKA2KO mice 506
Plasma osmolality (A), plasma Na+ level (B), and haematocrit (C) were measured on the 507
same groups of animals following a retro-orbital puncture. (D) The measurement of the 508
plasma volume by the Evans blue dye dilution technic was performed in separated 509
groups of mice to avoid consequences of retro-orbital puncture on the results. The 510
presented groups are non-pregnant (NP) and pregnant (P) WT (circles) and NP and P 511
HKA2KO mice (squares). Results are shown as the mean ± s.e.m. Numbers in italic = n of 512
mice. Two-way ANOVA test followed by a Bonferroni’s multiple comparisons test, (**
513
p<0.01; * p<0.05). Plasma osmolality (A) is significantly impacted by the state of the 514
mice (NP or P, p=0.0292), by the genotype (WT or HKA2KO, p=0.009) but not by the 515
interaction of both (p=0.116). Plasma Na+ (B) is significantly impacted by the state of the 516
mice (NP or P, p<0.0001), by the genotype (WT or HKA2KO, p=0.004) but not by the 517
interaction of both (p=0.067). Hematocrit (C) is significantly impacted by the state of the 518
mice (NP or P, p=0.007), not by the genotype (WT or HKA2KO, p=0.694) and by the 519
interaction of both (p=0.007). Plasma volume (C) is significantly impacted by the state of 520
the mice (NP or P, p<0.0001), by the genotype (WT or HKA2KO, p=0.048) and by the 521
interaction of both (p=0.027).
522 523
Fig. 2: Regulation of ENaC mRNA and urine aldosterone level in WT and HKA2KO mice 524
during gestation 525
Expression of Rps15 (A), ENaC α subunit (B), ENaC β subunit (C), ENaC γ subunit (D) 526
mRNAs and urine aldosterone level (E) in WT (circles) and HKA2KO mice (HKA2 KO, 527
squares) under normal condition (non-pregnant, NP) or at day 16 post-coïtus (pregnant, 528
P). Results are shown as the mean ± s.e.m. Numbers in italic = n of mice. Two-way 529
ANOVA test followed by a Bonferroni’s multiple comparisons test, (** p<0.01; * p<0.05).
530
ENaC α subunit expression (B) is not impacted by the state of the mice (NP or P, 531
p=0.2232), neither by the genotype (WT or HKA2KO, p=0.757) but by the interaction of 532
(NP or P, p=0.357), neither by the genotype (WT or HKA2KO, p=0.912) nor by the 534
interaction of both (p=0.368). ENaC γ subunit expression (D) is not impacted by the state 535
of the mice (NP or P, p=0.495), neither by the genotype (WT or HKA2KO, p=0.453) but 536
by the interaction of both (p=0.0005). Aldosterone level (E) is impacted by the state of 537
the mice (NP or P, p<0.01), the genotype (WT or HKA2KO, p=0.014) and by the the 538
interaction of both (p=0.026).
539
Fig. 3: Protein expression of ENaC in WT and HKA2KO mice during gestation 540
Protein expression of the ENaCα (A) and ENaCγ (Β) subunits of in NP and P WT and 541
HKA2KO mice (HKA2KO). (C) Immunolabelling of ENaCγ subunit on NP and P WT and 542
HKA2KO mice (HKA2KO). For each antibody, four samples (WT NP, WT P, HKA2KO NP 543
and HKA2KO P) were positioned on the same glass slide and treated simultaneously to 544
permit direct comparison of signal intensity. For all slides, the pictures were taken with 545
the same parameters of exposition and magnification (x40). Scale bars: 20 µm 546
Fig. 4: Regulation of NCC, pendrin and NDCBE in WT and HKA2KO mice during gestation 547
Expression of NCC (A), pendrin (B) and NDCBE (C) mRNAs in WT (circles) and HKA2KO 548
mice (HKA2 KO, squares) under normal condition (non-pregnant, NP) or at day 16 post- 549
coïtus (pregnant, P). Results are shown as the mean ± s.e.m. Numbers in italic = n of mice.
550
Two-way ANOVA test followed by a Bonferroni’s multiple comparisons test, (** p<0.01;
551
* p<0.05). NCC expression (A) is impacted by the state of the mice (NP or P, p=0.013), 552
neither by the genotype (WT or HKA2KO, p=0.186) nor by the interaction of both 553
(p=0.313). Pendrin expression (B) is impacted by the state of the mice (NP or P, p<0.01), 554
by the genotype (WT or HKA2KO, p=0<0.01) and by the interaction of both (p<0.01).
555
NDCBE expression (C) is not impacted by the state of the mice, neither by the genotype 556
nor by the interaction of both. (D) Protein expression of NCC in NP and P WT and 557
HKA2KO mice (HKA2KO). (E) Immunolabelling of NCC on NP and P WT and HKA2KO 558
mice (HKA2KO). For each antibody, four samples (WT NP, WT P, HKA2KO NP and 559
HKA2KO P) were positioned on the same glass slide and treated simultaneously to 560
permit direct comparison of signal intensity. For all slides, the pictures were taken with 561
the same parameters of exposition and magnification (x40). Scale bars: 20 µm. (F) 562
Protein expression of pendrin in NP and P WT and HKA2KO mice (HKA2KO).
563 564
