• Aucun résultat trouvé

H,K-ATPase type 2 regulates gestational 1 extracellular compartment expansion and blood pressure in mice.

N/A
N/A
Protected

Academic year: 2021

Partager "H,K-ATPase type 2 regulates gestational 1 extracellular compartment expansion and blood pressure in mice."

Copied!
28
0
0

Texte intégral

(1)

HAL Id: hal-02447177

https://hal.archives-ouvertes.fr/hal-02447177

Submitted on 21 Jan 2020

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

H,K-ATPase type 2 regulates gestational 1 extracellular compartment expansion and blood pressure in mice.

Christine Walter, Chloe Rafael, Samia Lassad, Stephanie Baron, Amel Salhi, Gilles Crambert

To cite this version:

Christine Walter, Chloe Rafael, Samia Lassad, Stephanie Baron, Amel Salhi, et al.. H,K-ATPase type 2 regulates gestational 1 extracellular compartment expansion and blood pressure in mice.. AJP - Regulatory, Integrative and Comparative Physiology, American Physiological Society, In press,

�10.1152/ajpregu.00067.2019�. �hal-02447177�

(2)

H,K-ATPase type 2 regulates gestational extracellular compartment expansion and 1

blood pressure in mice.

2 3 4

Running title: H,K-ATPase type 2 and gestational blood pressure 5

6

Christine Walter$1,2, Chloé Rafael$1,2, Samia Lasaad1,2, Stéphanie Baron1,2,3, Amel Salhi1,2 and 7

Gilles Crambert1,2#

8 9

1Centre de Recherche des Cordeliers, INSERM, Sorbonne Université, USPC, Université Paris 10

Descartes, Université Paris Diderot, F-75006 Paris, France 11

2CNRS ERL 8228 - Laboratoire de Physiologie Rénale et Tubulopathies, F-75006, Paris, 12

France 13

3APHP, Hôpital Européen Georges Pompidou, Laboratoire de Physiologie, F-75015, Paris, 14

France 15

$ These authors contribute equally to the work 16

#To whom correspondence should be sent 17

18

Gilles CRAMBERT, Ph.D 19

Centre de Recherche des Cordeliers 20

Laboratoire de Physiologie Rénale et Tubulopathies 21

15 rue de l'Ecole de Médecine 22

75270 Paris cedex 23

Phone: 00 33 1 44 27 50 21 24

Fax : 00 33 1 46 33 41 72 25

e-mail : [email protected] 26

27 28

(3)

Abstract 29

The modifications of the hemodynamic system and hydromineral metabolism are 30

physiological features characterizing a normal gestation. Thus, the ability to expand plasma 31

volume without increasing the level of blood pressure is necessary for the correct perfusion of 32

the placenta. The kidney is essential in this adaptation by reabsorbing avidly sodium and fluid.

33

In this study, we observed that the H,K-ATPase type 2 (HKA2), an ion pump expressed in 34

kidney and colon and already involved in the control of the K+ balance during gestation, is 35

also required for the correct plasma volume expansion and the maintain of a normal blood 36

pressure level. Indeed, compared to WT pregnant mice that exhibit a 1.6-fold increase of their 37

plasma volume, pregnant HKA2-null mice (HKA2KO) only modestly expand their 38

extracellular volume (x1.2). The renal expression of the epithelial Na channel (ENaC) alpha 39

and gamma subunits and that of the pendrin are stimulated in gravid WT mice whereas the 40

Na/Cl-cotransporter (NCC) expression is downregulated. These modifications are all blunted 41

in HKA2KO mice. This impeded renal adaptation to gestation is accompanied with the 42

development of hypotension in the pregnant HKA2KO mice. All together, our results showed 43

that the absence of the HKA2 during gestation leads to an “underfilled” situation and 44

established this transporter as a key player of the renal control of salt and potassium 45

metabolism during gestation.

46

Keywords: Pregnancy – Kidney – Blood pressure – ATP12A - Na+ retention 47

221 words 48

49 50 51

(4)

Introduction 52

The gestation is a physiological situation that requires strong adaptation of the cardio-renal 53

systems in order to cope with the demands of the growing fetus. For this purpose, the 54

extracellular volume is increased by 30-50% and is accompanied by a decrease of the plasma 55

osmolality and of the plasma Na+ level (13). Interestingly, under normal (non-gestational) 56

situation, the decrease of these two parameters should trigger the inhibition of the vasopressin 57

(AVP) production and renal water reabsorption in order to secrete fluid. However, during 58

gestation, the sensitivity of osmoreceptors is modified and AVP production is maintained for 59

reduced levels of plasma osmolality (13). In addition to salt and water, K+ is also retained 60

during gestation, in part, through the stimulation of the H,K-ATPase type 2 (HKA2) (30, 41).

61

This electroneutral transporter (4) consists of two subunits, a catalytic α subunit (encoded by 62

the Atp12a gene) that may combined, in heterologeous systems, with different chaperon-like 63

β subunits (10, 16). This transporter exhibits pharmacological and transport features common 64

to two closely related P-type ATPases, the Na,K-ATPase and the H,K-ATPase type 1 (for 65

review see, (9)). For instance, HKA2 may transport Na+ instead of H+ (5, 7, 10) and is 66

sensitive to ouabain (1, 8, 33) like the Na,K-ATPase and contributes to the renal secretion of 67

salt (14, 26). It also transports H+ and is sensitive to Schering 28080 (27) as the H,K-ATPase 68

type 1. The expression of the HKA2 is stimulated by progesterone through a nuclear 69

progesterone receptor-dependent pathways, which induces K+ retention (15, 17), a regulation 70

that may be relevant during gestation.

71

We have previously shown that the absence of the HKA2 impacts the gestation of mice by 72

impeding efficient K+ retention (30). Indeed, during gestation, the HKA2KO mice display a 73

decrease of the fertility rate, smaller litter size and higher mortality rate. This phenotype can 74

be reversed by a dietary supplementation in K+. Surprisingly, although those mice do not 75

retain K+ as efficiently as their WT littermate during gestation, their plasma K+ level remains 76

in the normal range (30). We have, therefore, drawn and tested the hypothesis that this normal 77

plasma K+ level may be the result of an altered extracellular volume expansion during 78

gestation of HKA2KO mice that would compensate for a putative development of 79

hypokalemia. Therefore we will focus on the regulation of the Na transport systems known to 80

be involved in plasma volume expansion during gestation Thus, we will study the 81

electrogenic transport system of Na+ present in the principal cells of the collecting duct 82

83

(5)

intercalated cells (mediated by the couple pendrin and the Na+-driven Cl-/HCO3- exchanger, 85

NDCBE) and the transport of water by the aquaporin 2 (AQP2).

86 87

(6)

Material and Methods 88

Animals 89

Experiments were performed on C57BL/6J wild-type and knock-out mice for the HKA2 α 90

subunit gene (22). All the animals were kept at CEF (Centre d’Explorations Fonctionnelles of 91

the Cordeliers Research Center, Agreement no. A75-06-12). All experiments were conducted 92

in accordance with the institutional guidelines and the recommendations for the care and use 93

of laboratory animals put forward by the Directive 2010/63/EU revising Directive 94

86/609/EEC on the protection of animals used for scientific purposes (project has been 95

approved by a user establishment’s ethics committee and the Project Authorization : number 96

2289.01). Female WT and HKA2KO were placed for a night with a WT isolated male. The 97

observation of a vaginal plug the next morning confirms the mating. The weight of females is 98

then followed every day to confirm the pregnancy (P). Non-pregnant female mice (not mated 99

with males, NP) served as control for all measured parameters.

100

Physiological measurements 101

To record physiological parameters, NP and pregnant (day 16, P) mice were placed in 102

metabolic cages (Techniplast, France) and were fed a standard laboratory diet (0.3 % Na + and 103

0.6 % K+; Safe France for more information regarding the detailed composition see 104

http://www.safe-diets.com/wp-content/uploads/2018/01/DS-SAFE-A04.pdf). In mice the 105

gestation lasts 18-20 days, we have therefore chosen day 16 as a representative time point of 106

the late phase of the pregnancy. Urinary creatinine concentrations were determined using an 107

automatic analyzer (Konelab 20i; Thermo, Cergy Pontoise, France). Urinary Na+ 108

concentration was determined by flame photometry (IL943, Instruments laboratory, France) 109

and plasma parameters (plasma Na+ and hematocrit) were measured by retro-orbital puncture 110

on the anesthetized animal with an ABL77 pH/blood-gas analyzer (Radiometer, Lyon, 111

France). Thiazide (HCTZ) and amiloride-sensitive natriuresis were measured as previously 112

described (21, 25). Briefly, the diuretics were administered intraperitoneally in conscious 113

animals placed in metabolic cages (HCTZ: 50mg/kg for 6h of urine collection and amiloride:

114

5mg/kg for 4h of urine collection). Plasma volume was determined by Evans blue dye 115

dilution as previously described (3, 6, 24) in anesthetized animals (a mix of xylazine, 116

10mg/kg and ketamine 100mg/kg). Plasma osmolality was measured using an osmometer 117

(Vogel, Bioblock Scientific, Strasbourg, FR). Urine aldosterone concentration was 118

(7)

hours pH 1 acid hydrolysis. Blood pressure was measured in conscious restrained mice by a 120

tail-cuffed plethysmography method (BP2000, Visitech system, France) after a week of 121

adaptation to the apparatus between 9:00 and 11:00 AM before mating. We have chosen the 122

tail-cuffed technic instead of the telemetry because it is less invasive and do not require to 123

anesthetize the pregnant mice to implant the probe. After these measurements, non-pregnant 124

and pregnant females were sacrificed for tissue and organ removal.

125

Quantitative PCR 126

RNAs were extracted from whole kidneys using the TRI reagent (Invitrogen, Villebon sur 127

Yvette, France) following the manufacturer’s instructions. One µg of total RNA was then 128

reverse-transcribed using the first strand cDNA synthesis kit for RT-PCR (Roche Diagnostics, 129

France) according to the manufacturer’s instructions. Real-time PCRs were performed on a 130

LightCycler (Roche Diagnostics, France). No signal was detected in samples that did not 131

undergo reverse transcription or in blank runs without cDNA. In each run, a standard curve 132

was obtained using serial dilution of stock cDNA prepared from mouse kidney total RNA.

133

The expression of the Rps15 gene is used to normalize the results. The renal expression of this 134

gene is not modified by pregnancy (data not shown). Specific primers for ENaCα (up 135

CCAAACGAACCGAACAC; down TGTCAGACTTACTCTAGCC),

136

ENaCβGGTCCTTATTGATGAGCG; down AGGCGTGAAGTTCCGA), EnaCγ 137

(up TCGGTCGTCTGTGTCA; down GCAGATCATCGTCCGTAT), pendrine (up 138

CAAAATACCGAGTCAAGGAATGGCT; down CGTTACCGCTGGGCACAAGA), NCC 139

(up TCTCACCCTCCTCATCCCCTATCT; down CAGAGCAGCATCCCGAGAGTAATC), 140

NDBCE (up TTCAACCCATTCAAACTCTTCTATGT; down

141

CCAATGAGCTGAAGCAAGAAA) and rps15 (up TTTCCGAGTAACCGCC; down 142

GCAGTGAGTGTTGCTT) transcripts were chosen using the LC Probe design 2.0 software.

143

Membrane protein extraction and Western Blot Analysis 144

Total kidneys were homogenized in a lysis buffer (250 mM sucrose, 100 mM Tris-Hepes, pH 145

7.4 and protease inhibitor cocktail (Complete, Roche Diagnostics)). After removal of 146

aggregates and nuclear-associated membrane by low-speed centrifugations, the plasma 147

membrane enriched fraction (17000 x g for 30 min) was recovered into the lysis buffer and its 148

protein content was measured with the BCA method (Thermo Scientific Pierce). Forty µg of 149

protein were then denaturated, resolved by SDS-PAGE (10% polyacrylamide) and transferred 150

onto a nitrocellulose membrane. Ponceau red labelling was carried out to check for protein 151

(8)

loading accuracy. Western blots were performed according to the standard procedure using a 152

polyclonal rabbit anti-ENaCα, anti-ENaCγ, anti-NCC (kindly provided by Jan Loffing, 153

University of Zurich, Switzerland) and anti-pendrin (kindly provided by Régine Chambrey, 154

Université de la Réunion, France). For quantification, the band intensities were determined 155

(ImageJ software) and normalized by Ponceau S red intensity.

156

Localization of ENaC, NCC and AQP2 on kidney slices 157

In virgin (NP) or at day 16 of pregnancy (P), anesthetized mice (10mg/kg xylazine and 158

100mg/kg ketamine) were perfused with 4% paraformaldehyde in the aorta and the kidneys 159

were removed and frozen in optimal cutting temperature compound (VWR). Five µm thick 160

slices were then processed for immunofluorescence microscopy using either an anti-ENaCγ 161

antibody (1/400, StressMarq Biosciences) or an anti-NCC antibody (1/400, StressMarq 162

Biosciences) or an anti-AQP2 (1/400, Santa Cruz). For each antibody, four samples (WT NP, 163

WT P, HKA2KO NP and HKA2KO P, 3 mice/group) were positioned on the same glass slide 164

and treated simultaneously to permit direct comparison of signal intensity. For all slides, the 165

pictures were taken with the same parameters of exposition and magnification (x20).

166

Organization of the experimental procedures and statistical analysis 167

The groups of animals that have been used for expression analysis of transporters (PCR, 168

Western blot or immunofluorescence) have not been submitted to any pharmacological 169

treatments (thiazide or amiloride) or blood pressure measurement, have not been punctionned 170

for blood collection (plasma parameters) or used for plasma volume measurement (Blue 171

Evans) to avoid any possible side effects of these procedures on the results of protein or gene 172

expression. The groups of animals used for plasma volume measurement (Blue Evans) did not 173

undergo other procedures. BP measurements were carried out on groups of animals that did 174

not undergo other procedures (blood collection, metabolic cages, pharmacological treatment).

175

Results are shown as mean ± s.e.m. Data were tested for significance using two-way ANOVA 176

test followed by a Bonferroni’s multiple comparisons post-test or Student’s test where 177

appropriate (Prism Software). Outliers were tested by ROUT analysis (Prism Software).

178 179 180

(9)

Results 181

Gestation-induced extracellular volume expansion is blunted in HKA2KO mice 182

The bodyweight of the non-pregnant NP and pregnant P WT and HKA2KO mice are similar 183

(Table 1) and the number of fetus observed after sacrifice of pregnant females at day 16 post- 184

coïtus is not significantly different between both genotypes (Table1). In WT mice, the late 185

phase of gestation is characterized by a decrease of plasma osmolality (331±14 vs 296±5 186

mOsm/kg, p=0.038 in non-pregnant NP and pregnant P WT mice, respectively Figure 1A, 187

dots), a decrease of plasma Na+ (150.0±0.4 vs 144.6±0.4 mM, p<0.01 in NP and P WT mice, 188

respectively Fig 1B dots) and a decrease of haematocrit (38.9±0.8 vs 36.5±0.4 %, p=0.019 in 189

NP and P WT mice, respectively Figure 1C, dots). To clearly characterize the volume 190

expansion occurring during gestation we measured it directly with the Evans blue dye dilution 191

method and observed that plasma volume is 1.6-fold increased during gestation in WT mice 192

(990±60 µl vs 1592±193 µl, p<0.01 in NP and P WT mice, respectively Figure 1D, dots). All 193

these modifications induced by the gestation are blunted in HKA2KO mice (Figures 1A-C, 194

squares), their plasma osmolality and haematocrit remain stable (compare to NP HKA2KO 195

mice), their plasma Na+ significantly decreases (Figure 1B, 146.5±0.5 mM) but less than in 196

WT (p<0.01) and their plasma volume expansion is limited and is only increased by 20%

197

(1012±71 µl vs 1273±61 µl, p<0.01 in NP and P HKA2KO mice Figure 1D, squares).

198

ENaC expression is differentially regulated in WT and HKA2KO mice during gestation 199

To understand why the HKA2KO mice did not expand their plasma volume during gestation 200

as the WT mice did, we analyzed the expression of different renal ion transporters known to 201

participate in the salt homeostasis by qPCR (normalized by the expression of rps15, Figure 202

2A), by Western blot and immunolabelling. ENaC, mediating the electrogenic Na+ 203

reabsorption in the collecting duct is composed of three subunits (α, β and γ). As shown in 204

Figures 2B, the expression of ENaCα is stimulated (by 40%, p<0.05) during gestation in 205

kidney of pregnant WT mice (circles) but that of the HKA2KO remains similar before and 206

during gestation (squares). Consequently, the expression level of ENaCα is 30% higher in 207

pregnant WT than in pregnant HKA2KO (p<0.05). As for the β subunit of ENaC, its mRNA 208

expression is not modified by pregnancy and is similar in both genotypes (Figure 2C). The 209

ENaCγ subunit expression only tends to increase during pregnancy in WT mice (Figure 2D, 210

circles, not significant) but is significantly (p<0.05) decreased by 50% in pregnant vs non- 211

(10)

pregnant HKAKO mice. Thus, the level expression of ENaCγ subunit is also much lower in 212

pregnant HKA2KO than in pregnant WT (p<0.05). As shown in Figure 2E, although urine 213

aldosterone is increased during pregnancy in both genotypes, it is significantly lower in 214

pregnant HKA2KO mice. When we investigated the protein expression of ENaCα subunit 215

during gestation, we confirmed that it is increased in WT pregnant mice compared to WT 216

non-pregnant mice (Figure 3A, both full-length 90kDa and cleaved 30 kDa bands). In 217

HKA2KO mice, the protein expression of the ENaCα subunit is not modified by pregnancy 218

(Figure 3A). As for the ENaCγ, its protein expression is increased in pregnant WT compared 219

to non-pregnant WT mice (Figure 3B-C) but is not modified by pregnancy in HKA2KO mice 220

(Figure 3B-C).

221

NCC, pendrin and NDCBE expression during gestation of WT and HKA2KO mice 222

In addition to ENaC, the distal nephron also expresses two thiazide-sensitive systems of Na+ 223

reabsorption, NCC in the distal convoluted tubule (DCT) and the pendrin/NDCBE couple in 224

the β-intercalated cell of the collecting duct. During gestation of WT mice, mRNA expression 225

of NCC is decreased by 50% (Figure 4A, circles, p<0.05) whereas it remains stable in 226

HKA2KO mice (squares, Figure 4A). The mRNA expression of pendrin is strongly increased 227

in pregnant WT (Figure 4B, circles, p<0.01) whereas it remains unchanged in HKA2KO mice.

228

As for NDCBE, its mRNA expression is not significantly modified during gestation in any 229

genotypes (Figure 4C). At the protein level the results are in good agreement with the 230

observed change at the mRNA level since total NCC expression decreased by 50% during 231

gestation in WT mice but remains unchanged in HKA2KO mice (Figure 4D-E). Protein 232

expression of pendrin is also strongly increased by pregnancy in WT mice and remained 233

unchanged in HKA2KO mice (Figure 4F).

234

AQP2 expression is not differentially regulated in WT and HKA2KO mice during gestation 235

We tested the possibility that the water transport system mediated by AQP2 could also be 236

altered during pregnancy in HKA2KO compared to WT mice. As shown in Figure 5, the 237

expression of AQP2 (A and B) and its localization (C) in the principal cells of the collecting 238

ducts are similar in both genotypes whatever the gestational status.

239

HKA2KO mice exhibit urine salt loss and hypotension during pregnancy 240

(11)

As shown before (30) , WT or HKA2KO mice increase their food intake by 15-20% during 241

gestation (Figure 6A, p<0.05). However, in parallel, the renal excretion of Na+ is not 242

increased (Figure 6B) in the same proportion in pregnant WT mice, characterizing the 243

gestation-induced renal Na+ retention. Conversely, the renal excretion of Na+ (Figure 6B) is 244

increased in pregnant HKA2KO mice (p<0.05), matching their food intake and revealing that 245

they do not retain Na+ as the WT did and therefore do not adapt to the context of gestation.

246

The Na+ retention induced by pregnancy in WT mice is correlated with an increased 247

sensitivity of Na+ excretion to amiloride (by 50%, p<0.05, Figure 6C, circles), a result, which 248

is also in a good agreement with the increased expression of ENaC in WT pregnant mice 249

(Figure 2B, 3A-C). This gestation-induced stimulation of ENaC activity is not present in 250

HKA2KO mice (Figures 6C, squares). Interestingly, two transport systems, NCC and the 251

couple pendrin/NDCBE have been described as being sensitive to thiazide (21). As shown in 252

Figure 6D, the thiazide-sensitive Na+ excretion is not modified by pregnancy, neither in WT 253

nor in HKA2KO mice. This suggests that in WT pregnant mice, the downregulation of NCC 254

(Figure 4A-D-E), is compensate by the upregulation of the pendrin (Figure 4 B-F) as recently 255

proposed by West and collaborators (40) during pregnancy in rat.

256

HKA2KO mice exhibit a decreased blood pressure level during pregnancy 257

In non-pregnant WT and HKA2KO mice, the BP is similar (117.6 vs 114.1 mm Hg, Figure 7 258

day 0) but the inability of HKA2KO mice to expand their plasma volume during gestation 259

compared to WT mice (because of their renal loss of Na+) negatively impacts their blood 260

pressure (BP). Thus, in WT (circles) and HKA2KO mice (squares), the BP is significantly 261

modified during gestation. Indeed, as shown in Figure 7, the BP of pregnant WT mice 262

remained similar to that measured before pregnancy (day 0) as already reported (12, 34).

263

However, the BP of HKA2KO mice decreased during the middle phase of gestation and 264

remained 10 mm of Hg lower than that of WT mice.

265 266 267

(12)

268 269

DISCUSSION 270

The ability to retain K+ during gestation through the activation of the HKA2 is of crucial 271

importance since the absence of this transporter disturbs the process of fertility (30). During 272

gestation, the HKA2KO mice exhibited a slight renal and strong intestinal loss of K+ resulting 273

in the decrease of litter size, however, without any impact on the plasma [K+] level (30). This 274

was intriguing since in parallel, gestation is a physiological situation characterized by a 275

plasma volume expansion that should lead to a dilution of the plasma components if they are 276

not efficiently retained. We therefore hypothesized that the gestational volume expansion that 277

occurs normally in WT mice could be attenuated in HKA2KO mice.

278 279

Limiting plasma volume expansion to avoid the development of hypokalemia?

280

As shown before (37, 39), the renal adaptation of the WT mice and rats to pregnancy involves 281

the stimulation of Na+ reabsorbing pathways in the collecting duct (ENaC and pendrin) and 282

the downregulation of NCC expression. This situation, somehow, resembles at the 283

mechanisms observed to excrete a load of K+, but in WT pregnant mice or rats, this process is 284

counterbalanced by the stimulation of the HKA2 (30, 41), allowing K+ to be retained even 285

when ENaC is stimulated. Interestingly, in the absence of HKA2, the lack of K+ reabsorption 286

should have resulted to a decrease of plasma [K+], but instead, we observed that it is the Na+ 287

and fluid reabsorption, and in fine, the size of the plasma compartment that is affected. In the 288

absence of the HKA2, the mice are in a paradoxical situation since they need to reduce K loss 289

by decreasing aldosterone production and ENaC activity whereas the increase of the vascular 290

compartment size requires a stimulation of these systems to fill it in. This explains the 291

limitation of the aldosterone production that we observed and is well correlated with the 292

similar gestational phenotype observed in aldosterone synthase KO mice (34) or in pregnant 293

rats treated with benzamil (38) in which the extracellular volume expansion is also blunted.

294

This crosstalk between the processes controlling the plasma [K+] and the volemia has already 295

been observed in order to protect male mice under dietary K+ restriction against the 296

development of hypokalemia (35). Indeed, in the absence of the HKA2 male mice under low- 297

K+ diet for a short period of time display a renal loss of Na+ and fluid that has been partially 298

attributed to a blockade of the vasopressin action. This eventually contributes to a reduction 299

(13)

system of the collecting duct, based on AQP2 expression analysis, does not seem disturbed 301

neither in normal pregnancy of WT mice, which is different of what has been observed in rat 302

(28) nor in HKA2KO mice. Here, our results rather suggest that in pregnant mice, the lack of 303

HKA2 contributes to a renal loss of fluid through the inappropriate regulation of ENaC 304

(which is not stimulated in pregnant HKA2KO mice). The mechanisms by which this blunted 305

stimulation of ENaC takes place in HKA2KO mice are not known but they may be related to 306

preservation of the plasma [K+], avoiding an excess of K+ secretion trough the principal cells 307

of the collecting duct. In parallel, this impaired stimulation of ENaC would also result in an 308

inappropriate Na+ retention impeding the normal extracellular volume expansion. Since the 309

HKA2 is strongly expressed in colon, we cannot exclude that the effects observed in the KO 310

mice are linked to a fecal loss of K+. However, whatever the origin of the K+ balance 311

disturbance, it requires a renal adaptation that leads to the observed gestational phenotypes.

312

We propose that these two effects protect the organism against the development of 313

hypokalemia, by limiting the K+ loss in the urine and reducing the plasma volume. Indeed, if 314

the HKA2KO mice expand their plasma volume as their WT littermate do, their plasma [K+] 315

level should decrease by 25%, which would result to a severe hypokalemia.

316 317

Is HKA2 a putative target to deal with blood pressure modification during the pregnancy ? 318

The HKA2 therefore appears to be at the crossroad between the regulation of K+, Na+ and 319

water metabolism. Its absence during pregnancy leads to compensatory mechanisms that tend 320

to preserve plasma [K+] level but that leads to hypotension. Interestingly, chronic hypotension 321

during gestation is observed in 2-3% of the pregnancies and is associated with a higher rate of 322

threatened abortion, higher occurrence of severe nausea or vomiting and anemia (2). It would 323

be interesting to investigate whether a low blood pressure during gestation could be related to 324

polymorphisms in the Atp12a gene encoding the catalytic subunit of the HKA2.

325

Conversely, the identification of the HKA2 as a possible target to reduce blood pressure 326

during pregnancy may also be interesting in the context of gestational hypertension and more 327

particularly during preeclampsia. The volemic status of preeclamptic patient remains 328

controversial, perhaps because this disease is heterogeneous with at least two different 329

components, an early- and a late-onset preeclampsia. At least, the late-onset preeclampsia has 330

been correlated with an increase of total body fluid (18) and of the plasma volume (31, 32). In 331

this context, the inhibition of the HKA2 could be an interesting therapeutic approach to help 332

decreasing BP. The pharmacology of the HKA2 is complicated and has not been fully 333

investigated (for review see (9)). However, some data exist in the literature that suggest that 334

(14)

the HKA2 may be inhibited by the “proton-pump inhibitors” (PPI) of the omeprazole family 335

(11, 20, 23, 36). These compounds are well-known to inhibit the H,K-ATPase type 1, which 336

is structurally and functionally closely related to the HKA2. Recently, these compounds have 337

been proposed to reduce the level of blood pressure in a model of preeclamptic mice (29). In 338

this paper, the authors did not formerly identify the target of omeprazole in this pathological 339

context. Interestingly, PPIs were also shown to reduce blood pressure in hypertensive patients 340

(19). In light of our own results, we propose that omeprazole may inhibit the HKA2 in the 341

preeclamptic, leading to a modification of the K+, Na+ and water balances and thus favoring a 342

decrease of plasma volume and of blood pressure. This hypothesis would have to be 343

investigated further.

344 345

Perspectives and Significance 346

The results of this study establish that the correct expansion of the plasma volume during 347

pregnancy requires the presence of an active HKA2. Indeed, the absence of the HKA2 in 348

pregnant mice, which is already known to promote intestinal and renal K+ leaks (30), results 349

in a reduced volemic expansion allowing the concentration of K+ in the extracellular 350

compartment to limit the development of hypokalemia. The consequence of this “underfilled”

351

situation is a lowering of the blood pressure during the late phase of the gestation. The HKA2 352

appears therefore as a key ion transporter in the physiological adaptation to gestation that 353

controls both K+ and Na+ metabolisms.

354 355

AKNOWLEDGMENTS 356

Physiological analysis have been performed with the help of Gaelle Brideau and Nadia 357

Frachon from the “platforme d’exploration fonctionnelle du petit animal” of the team 358

“Physiologie Rénale and Tubulopathies” at the Centre de Recherche des Cordeliers. We are 359

grateful for the technical assistance of the CEF crews in the management of our colony of 360

mice. This study was supported by recurrent grants from the Institut National de la Santé et de 361

la Recherche Médicale (INSERM) and from the Centre National de la Recherche Scientifique 362

(CNRS). It was also supported by the Fondation pour la Recherche Médicale (FRM, project 363

DPC20171138949).

364 365 366

(15)

REFERENCES 367

1. Asano S, Hoshina S, Nakaie Y, Watanabe T, Sato M, Suzuki Y, and Takeguchi 368

N. Functional expression of putative H+-K+-ATPase from guinea pig distal colon. Am J 369

Physiol 275: C669-674, 1998.

370 2. Banhidy F, Acs N, Puho EH, and Czeizel AE. Hypotension in pregnant women: a 371

population-based case-control study of pregnancy complications and birth outcomes.

372

Hypertens Res 34: 55-61, 2011.

373

3. Barron WM, Stamoutsos BA, and Lindheimer MD. Role of volume in the 374

regulation of vasopressin secretion during pregnancy in the rat. J Clin Invest 73: 923-932, 375

1984.

376

4. Burnay M, Crambert G, Kharoubi-Hess S, Geering K, and Horisberger JD.

377 Bufo marinus bladder H-K-ATPase carries out electroneutral ion transport. Am J Physiol 378

Renal Physiol 281: F869-874, 2001.

379

5. Codina J, Pressley TA, and DuBose TD, Jr. The colonic H+,K+-ATPase functions 380

as a Na+-dependent K+(NH4+)-ATPase in apical membranes from rat distal colon. J Biol 381

Chem 274: 19693-19698, 1999.

382

6. Cole JM, Khokhlova N, Sutliff RL, Adams JW, Disher KM, Zhao H, Capecchi MR, 383

Corvol P, and Bernstein KE. Mice lacking endothelial ACE: normal blood pressure with 384 elevated angiotensin II. Hypertension 41: 313-321, 2003.

385

7. Cougnon M, Bouyer P, Planelles G, and Jaisser F. Does the colonic H,K-ATPase 386

also act as an Na,K-ATPase? Proc Natl Acad Sci U S A 95: 6516-6520, 1998.

387

8. Cougnon M, Planelles G, Crowson MS, Shull GE, Rossier BC, and Jaisser F. The 388

rat distal colon P-ATPase alpha subunit encodes a ouabain-sensitive H+, K+-ATPase. J 389

Biol Chem 271: 7277-7280, 1996.

390

9. Crambert G. H-K-ATPase type 2: relevance for renal physiology and beyond. Am J 391 Physiol Renal Physiol 306: F693-700, 2014.

392

10. Crambert G, Horisberger JD, Modyanov NN, and Geering K. Human nongastric 393

H+-K+-ATPase: transport properties of ATP1al1 assembled with different beta-subunits.

394

Am J Physiol Cell Physiol 283: C305-314, 2002.

395

11. Delpiano L, Thomas JJ, Yates AR, Rice SJ, Gray MA, and Saint-Criq V.

396

Esomeprazole Increases Airway Surface Liquid pH in Primary Cystic Fibrosis Epithelial 397 Cells. Front Pharmacol 9: 1462, 2018.

398

12. Doridot L, Passet B, Mehats C, Rigourd V, Barbaux S, Ducat A, Mondon F, 399

Vilotte M, Castille J, Breuiller-Fouche M, Daniel N, le Provost F, Bauchet AL, 400

Baudrie V, Hertig A, Buffat C, Simeoni U, Germain G, Vilotte JL, and Vaiman D.

401

Preeclampsia-like symptoms induced in mice by fetoplacental expression of STOX1 are 402

reversed by aspirin treatment. Hypertension 61: 662-668, 2013.

403

13. Durr JA, Stamoutsos B, and Lindheimer MD. Osmoregulation during pregnancy 404 in the rat. Evidence for resetting of the threshold for vasopressin secretion during 405

gestation. J Clin Invest 68: 337-346, 1981.

406

14. Edwards A, and Crambert G. Versatility of NaCl transport mechanisms in the 407

cortical collecting duct. Am J Physiol Renal Physiol 313: F1254-F1263, 2017.

408

15. Elabida B, Edwards A, Salhi A, Azroyan A, Fodstad H, Meneton P, Doucet A, 409

Bloch-Faure M, and Crambert G. Chronic potassium depletion increases adrenal 410

progesterone production that is necessary for efficient renal retention of potassium.

411 Kidney Int 80: 256-262, 2011.

412

16. Geering K, Crambert G, Yu C, Korneenko TV, Pestov NB, and Modyanov NN.

413

Intersubunit interactions in human X,K-ATPases: role of membrane domains M9 and 414

M10 in the assembly process and association efficiency of human, nongastric H,K- 415

(16)

ATPase alpha subunits (ATP1al1) with known beta subunits. Biochemistry 39: 12688- 416

12698, 2000.

417

17. Grimont A, Bloch-Faure M, El Abida B, and Crambert G. Mapping of sex 418 hormone receptors and their modulators along the nephron of male and female mice.

419

FEBS Lett 583: 1644-1648, 2009.

420

18. Gyselaers W, Vonck S, Staelens AS, Lanssens D, Tomsin K, Oben J, Dreesen P, 421

and Bruckers L. Body fluid volume homeostasis is abnormal in pregnancies 422

complicated with hypertension and/or poor fetal growth. PLoS One 13: e0206257, 2018.

423

19. Joya-Vazquez P, Bacaicoa MA, Velasco R, Chicon JL, Trejo S, Carrasco MA, 424

Robles NR, and Munoz-Torrero JFS. Proton-pump inhibitors therapy and blood 425 pressure control. Intern J Pharmacol Res 4: 142-147, 2014.

426

20. Lameris AL, Hess MW, van Kruijsbergen I, Hoenderop JG, and Bindels RJ.

427

Omeprazole enhances the colonic expression of the Mg(2+) transporter TRPM6. Pflugers 428

Arch 465: 1613-1620, 2013.

429

21. Leviel F, Hubner CA, Houillier P, Morla L, El Moghrabi S, Brideau G, Hassan H, 430

Parker MD, Kurth I, Kougioumtzes A, Sinning A, Pech V, Riemondy KA, Miller RL, 431

Hummler E, Shull GE, Aronson PS, Doucet A, Wall SM, Chambrey R, and Eladari D.

432 The Na+-dependent chloride-bicarbonate exchanger SLC4A8 mediates an electroneutral 433

Na+ reabsorption process in the renal cortical collecting ducts of mice. J Clin Invest 120:

434

1627-1635, 2010.

435

22. Meneton P, Schultheis PJ, Greeb J, Nieman ML, Liu LH, Clarke LL, Duffy JJ, 436

Doetschman T, Lorenz JN, and Shull GE. Increased sensitivity to K+ deprivation in 437

colonic H,K-ATPase-deficient mice. J Clin Invest 101: 536-542, 1998.

438

23. Min JY, Ocampo CJ, Stevens WW, Price CPE, Thompson CF, Homma T, Huang 439 JH, Norton JE, Suh LA, Pothoven KL, Conley DB, Welch KC, Shintani-Smith S, Peters 440

AT, Grammer LC, 3rd, Harris KE, Hulse KE, Kato A, Modyanov NN, Kern RC, 441

Schleimer RP, and Tan BK. Proton pump inhibitors decrease eotaxin-3/CCL26 442

expression in patients with chronic rhinosinusitis with nasal polyps: Possible role of the 443

nongastric H,K-ATPase. J Allergy Clin Immunol 139: 130-141 e111, 2017.

444

24. Morgan TK, Rohrwasser A, Zhao L, Hillas E, Cheng T, Ward KJ, and Lalouel 445

JM. Hypervolemia of pregnancy is not maintained in mice chronically overexpressing 446 angiotensinogen. Am J Obstet Gynecol 195: 1700-1706, 2006.

447

25. Morla L, Brideau G, Fila M, Crambert G, Cheval L, Houillier P, Ramakrishnan 448

S, Imbert-Teboul M, and Doucet A. Renal proteinase-activated receptor 2, a new actor 449

in the control of blood pressure and plasma potassium level. J Biol Chem 288: 10124- 450

10131, 2013.

451

26. Morla L, Doucet A, Lamouroux C, Crambert G, and Edwards A. The renal 452

cortical collecting duct: a secreting epithelium? J Physiol 2016.

453 27. Nakamura S, Amlal H, Galla JH, and Soleimani M. Colonic H+-K+-ATPase is 454

induced and mediates increased HCO3- reabsorption in inner medullary collecting duct 455

in potassium depletion. Kidney Int 54: 1233-1239, 1998.

456

28. Ohara M, Martin PY, Xu DL, St John J, Pattison TA, Kim JK, and Schrier RW.

457

Upregulation of aquaporin 2 water channel expression in pregnant rats. J Clin Invest 101:

458

1076-1083, 1998.

459

29. Onda K, Tong S, Beard S, Binder N, Muto M, Senadheera SN, Parry L, 460 Dilworth M, Renshall L, Brownfoot F, Hastie R, Tuohey L, Palmer K, Hirano T, 461

Ikawa M, Kaitu'u-Lino T, and Hannan NJ. Proton Pump Inhibitors Decrease Soluble 462

fms-Like Tyrosine Kinase-1 and Soluble Endoglin Secretion, Decrease Hypertension, and 463

(17)

30. Salhi A, Lamouroux C, Pestov NB, Modyanov NN, Doucet A, and Crambert G.

465

A link between fertility and K+ homeostasis: role of the renal H,K-ATPase type 2.

466

Pflugers Arch 465: 1149-1158, 2013.

467 31. Schrier RW, and Briner VA. Peripheral arterial vasodilation hypothesis of 468

sodium and water retention in pregnancy: implications for pathogenesis of 469

preeclampsia-eclampsia. Obstet Gynecol 77: 632-639, 1991.

470

32. Stergiotou I, Crispi F, Valenzuela-Alcaraz B, Bijnens B, and Gratacos E.

471

Patterns of maternal vascular remodeling and responsiveness in early- versus late-onset 472

preeclampsia. Am J Obstet Gynecol 209: 558 e551-558 e514, 2013.

473

33. Swarts HG, Koenderink JB, Willems PH, and De Pont JJ. The non-gastric H,K- 474 ATPase is oligomycin-sensitive and can function as an H+,NH4(+)-ATPase. J Biol Chem 475

280: 33115-33122, 2005.

476

34. Todkar A, Di Chiara M, Loffing-Cueni D, Bettoni C, Mohaupt M, Loffing J, and 477

Wagner CA. Aldosterone deficiency adversely affects pregnancy outcome in mice.

478

Pflugers Arch 464: 331-343, 2012.

479

35. Walter C, Ben Tanfous M, Igoudjil K, Salhi A, Escher G, and Crambert G. H,K- 480

ATPase type 2 contributes to salt-sensitive hypertension induced by K+ restriction. Pflug 481 Arch Eur J Phy 468: 1673-1683, 2016.

482

36. Watanabe T, Suzuki T, and Suzuki Y. Ouabain-sensitive K(+)-ATPase in 483

epithelial cells from guinea pig distal colon. Am J Physiol 258: G506-511, 1990.

484

37. West C, Zhang Z, Ecker G, and Masilamani SM. Increased renal alpha-epithelial 485

sodium channel (ENAC) protein and increased ENAC activity in normal pregnancy. Am J 486

Physiol Regul Integr Comp Physiol 299: R1326-1332, 2010.

487

38. West CA, Han W, Li N, and Masilamani SM. Renal epithelial sodium channel is 488 critical for blood pressure maintenance and sodium balance in the normal late pregnant 489

rat. Exp Physiol 99: 816-823, 2014.

490

39. West CA, McDonough AA, Masilamani SM, Verlander JW, and Baylis C. Renal 491

NCC is unchanged in the midpregnant rat and decreased in the late pregnant rat despite 492

avid renal Na+ retention. Am J Physiol Renal Physiol 309: F63-70, 2015.

493

40. West CA, Verlander JW, Wall SM, and Baylis C. The chloride-bicarbonate 494

exchanger pendrin is increased in the kidney of the pregnant rat. Exp Physiol 100: 1177- 495 1186, 2015.

496

41. West CA, Welling PA, West DA, Jr., Coleman RA, Cheng KY, Chen C, DuBose 497

TD, Jr., Verlander JW, Baylis C, and Gumz ML. Renal and colonic potassium 498

transporters in the pregnant rat. Am J Physiol Renal Physiol 314: F251-F259, 2018.

499 500 501

(18)

502

FIGURE LEGENDS 503

504

Fig. 1: Characteristics of the plasma volume expansion during gestation in WT and 505

HKA2KO mice 506

Plasma osmolality (A), plasma Na+ level (B), and haematocrit (C) were measured on the 507

same groups of animals following a retro-orbital puncture. (D) The measurement of the 508

plasma volume by the Evans blue dye dilution technic was performed in separated 509

groups of mice to avoid consequences of retro-orbital puncture on the results. The 510

presented groups are non-pregnant (NP) and pregnant (P) WT (circles) and NP and P 511

HKA2KO mice (squares). Results are shown as the mean ± s.e.m. Numbers in italic = n of 512

mice. Two-way ANOVA test followed by a Bonferroni’s multiple comparisons test, (**

513

p<0.01; * p<0.05). Plasma osmolality (A) is significantly impacted by the state of the 514

mice (NP or P, p=0.0292), by the genotype (WT or HKA2KO, p=0.009) but not by the 515

interaction of both (p=0.116). Plasma Na+ (B) is significantly impacted by the state of the 516

mice (NP or P, p<0.0001), by the genotype (WT or HKA2KO, p=0.004) but not by the 517

interaction of both (p=0.067). Hematocrit (C) is significantly impacted by the state of the 518

mice (NP or P, p=0.007), not by the genotype (WT or HKA2KO, p=0.694) and by the 519

interaction of both (p=0.007). Plasma volume (C) is significantly impacted by the state of 520

the mice (NP or P, p<0.0001), by the genotype (WT or HKA2KO, p=0.048) and by the 521

interaction of both (p=0.027).

522 523

Fig. 2: Regulation of ENaC mRNA and urine aldosterone level in WT and HKA2KO mice 524

during gestation 525

Expression of Rps15 (A), ENaC α subunit (B), ENaC β subunit (C), ENaC γ subunit (D) 526

mRNAs and urine aldosterone level (E) in WT (circles) and HKA2KO mice (HKA2 KO, 527

squares) under normal condition (non-pregnant, NP) or at day 16 post-coïtus (pregnant, 528

P). Results are shown as the mean ± s.e.m. Numbers in italic = n of mice. Two-way 529

ANOVA test followed by a Bonferroni’s multiple comparisons test, (** p<0.01; * p<0.05).

530

ENaC α subunit expression (B) is not impacted by the state of the mice (NP or P, 531

p=0.2232), neither by the genotype (WT or HKA2KO, p=0.757) but by the interaction of 532

(19)

(NP or P, p=0.357), neither by the genotype (WT or HKA2KO, p=0.912) nor by the 534

interaction of both (p=0.368). ENaC γ subunit expression (D) is not impacted by the state 535

of the mice (NP or P, p=0.495), neither by the genotype (WT or HKA2KO, p=0.453) but 536

by the interaction of both (p=0.0005). Aldosterone level (E) is impacted by the state of 537

the mice (NP or P, p<0.01), the genotype (WT or HKA2KO, p=0.014) and by the the 538

interaction of both (p=0.026).

539

Fig. 3: Protein expression of ENaC in WT and HKA2KO mice during gestation 540

Protein expression of the ENaCα (A) and ENaCγ (Β) subunits of in NP and P WT and 541

HKA2KO mice (HKA2KO). (C) Immunolabelling of ENaCγ subunit on NP and P WT and 542

HKA2KO mice (HKA2KO). For each antibody, four samples (WT NP, WT P, HKA2KO NP 543

and HKA2KO P) were positioned on the same glass slide and treated simultaneously to 544

permit direct comparison of signal intensity. For all slides, the pictures were taken with 545

the same parameters of exposition and magnification (x40). Scale bars: 20 µm 546

Fig. 4: Regulation of NCC, pendrin and NDCBE in WT and HKA2KO mice during gestation 547

Expression of NCC (A), pendrin (B) and NDCBE (C) mRNAs in WT (circles) and HKA2KO 548

mice (HKA2 KO, squares) under normal condition (non-pregnant, NP) or at day 16 post- 549

coïtus (pregnant, P). Results are shown as the mean ± s.e.m. Numbers in italic = n of mice.

550

Two-way ANOVA test followed by a Bonferroni’s multiple comparisons test, (** p<0.01;

551

* p<0.05). NCC expression (A) is impacted by the state of the mice (NP or P, p=0.013), 552

neither by the genotype (WT or HKA2KO, p=0.186) nor by the interaction of both 553

(p=0.313). Pendrin expression (B) is impacted by the state of the mice (NP or P, p<0.01), 554

by the genotype (WT or HKA2KO, p=0<0.01) and by the interaction of both (p<0.01).

555

NDCBE expression (C) is not impacted by the state of the mice, neither by the genotype 556

nor by the interaction of both. (D) Protein expression of NCC in NP and P WT and 557

HKA2KO mice (HKA2KO). (E) Immunolabelling of NCC on NP and P WT and HKA2KO 558

mice (HKA2KO). For each antibody, four samples (WT NP, WT P, HKA2KO NP and 559

HKA2KO P) were positioned on the same glass slide and treated simultaneously to 560

permit direct comparison of signal intensity. For all slides, the pictures were taken with 561

the same parameters of exposition and magnification (x40). Scale bars: 20 µm. (F) 562

Protein expression of pendrin in NP and P WT and HKA2KO mice (HKA2KO).

563 564

Références

Documents relatifs

Les RP sont incorporées à différents stades de la maturation des sous-unités ribosomiques. Suivre la localisation d’une RP marquée qui s’incorpore dans une

Je voulais lui prouver que mon amour est vrai, Je voulais qu´on soit heureux tous les deux , Je voulais qu´on vie de liberté et tendresse, Qu´on soit tous les deux unis dans

Lisa entra dans une petite pièce mansardée, sommairement meublée Au milieu, elle distingua une petite table ronde avec une cruche et une cuvette.. Dans un

D’abord, ces activités reposent encore souvent sur la mobilisation familiale, rejouant alors les inégalités sexuées du travail domestique et familial, dans les cas où l’entreprise

However, as IGF-1R - transcripts cannot be translated into functional protein 15 , IGF-I receptor levels in IGF-1R +/- mice were half those in wild type IGF-1R +/+ mice

As shown in Fig.  4 B–D, the mRNA expression of the ENaC α subunit was similar in N5/6 WT and HKA2KO mice whatever the K + intake and that.. of the ENaC γ subunit was

Purpose: The goal of that study was to assess the correlation of biventricular diffuse myocardial fibrosis in pulmonary hypertension (PH) as assessed by late gadolinium

Identification des tableaux dans les collections du château de Tervuren 129 et des palais de Bruxelles et de