• Aucun résultat trouvé

Effect of Retinoids on UDP-Glucuronosyltransferase 2B7 mRNA Expression in Caco-2 Cells

N/A
N/A
Protected

Academic year: 2021

Partager "Effect of Retinoids on UDP-Glucuronosyltransferase 2B7 mRNA Expression in Caco-2 Cells"

Copied!
10
0
0

Texte intégral

(1)

HAL Id: hal-02657038

https://hal.inrae.fr/hal-02657038

Submitted on 30 May 2020

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Effect of Retinoids on UDP-Glucuronosyltransferase 2B7 mRNA Expression in Caco-2 Cells

Yang Lu, Stacie Bratton, Jean-Marie Heydel, Anna Radominska-Panndya

To cite this version:

Yang Lu, Stacie Bratton, Jean-Marie Heydel, Anna Radominska-Panndya. Effect of Retinoids on UDP-Glucuronosyltransferase 2B7 mRNA Expression in Caco-2 Cells. Drug Metabolism and Phar- macokinetics, Japanese Society for the Study of Xenobiotics, 2008, 23 (5), pp.364-372. �hal-02657038�

(2)

364 Received; March 9, 2008, Accepted; April 17, 2008

*To whom correspondence should be addressed:Anna RADOMINSKA-PANDYA, Ph.D.,Professor of Biochemistry, University of Arkansas for Med- ical Sciences, 4301 W. Markham, Slot 516, Little Rock, AR 72205, Tel.+1-501-686-5414, Fax.+1-501-603-1146, E-mail: RadominskaAnna@

UAMS.edu

This work was supported by Tobacco Settlement funds from UAMS and a grant from the National Institutes of Health (DK60109) to A.R-P.

Abbreviations: 4-OH RA, 4-hydroxy; AP-1, activator protein-1;atRA,all transretinoic acid; CYP, cytochrome P450; FXR, farnesoid X recep- tor; GR, glucocorticoid receptor; LCA, lithocholic acid; Oct-1, octamer binding protein-1; RAR, retinoic acid receptor; RXR, retinoid X receptor;

TR, thyroid receptor; TTNPB, (E)-4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetra-methyl-2-naphthylenyl)-1-propenyl]benzoic acid; UGT, UDP- glucuronosyltransferase.

364

Regular Article

Effect of Retinoids on UDP-Glucuronosyltransferase 2B7 mRNA Expression in Caco-2 Cells

Yuan LU1, Stacie BRATTON1, Jean-Marie HEYDEL2, and Anna RADOMINSKA-PANDYA1,*

1Departments of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Arkansas, U.S.A.

2UMR 1129 FLAVIC INRA/ENESAD/Universit áe de Bourgogne, Facult áe de Pharmacie, Dijon, France

Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk

Summary:Human UDP-glucuronosyltransferase 2B7 (UGT2B7) is one of the major isoforms involved in the glucuronidation of endogenous compounds and xenobiotics. This isoform is the only human UGT shown to glucuronidate retinoids and their oxidized derivatives. In this study, the effects of all-trans retinoic acid (atRA),9-cisRA, and the RAR agonist TTNPB, on UGT2B7 and UGT2B15 mRNA expression in Caco-2 cells have been examined. Each of these retinoids significantly suppressed UGT2B7 mRNA expression in a concentration-dependent manner with IC50values of 3.5, 0.3, and 0.2mM, respectively. However, no inhibi- tion was observed when two other UGTs, UGT2B15 or -1A6, were exposed toatRA,9-cisRA, or TTNPB, demonstrating that the inhibitory effect of retinoids might be specific for the UGT2B7 isoform. Further, ex- periments with oxidizedatRA derivatives, 4-OH-atRA, 4-oxo-atRA, and 5,6-epoxy-atRA showed that these RA degradation products have no inhibitory effect on UGT2B7 mRNA expression. These data lead us to hypothesize that biologically active forms of RA suppress the expression of UGT2B7 in intestinal cells. This in- formation provides a new pathway by which retinoids may enhance their own toxicity when accumulated in the body at pharmacological concentrations by down-regulating the enzymes involved in their biotransforma- tion into soluble derivatives.

Keywords: UDP-glucuronosyltransferase (UGT); retinoid; suppression; Caco-2 cells

Introduction

Retinoids are potent regulators of a variety of physio- logical processes including development, cell differentia- tion and proliferation, apoptosis, homeostasis, and reproduction.1) all-trans retinoic acid (atRA) and 9-cis retinoic acid (9-cis RA) have been recognized as im- portant signaling molecules and physiological ligands for the several nuclear receptors.2) Retinoids exert most of their function via interaction with two types of nuclear retinoid receptors, the retinoic acid receptors (RAR) and the retinoid X receptors (RXR), which act as ligand-acti- vated transcription factors controlling the expression of a number of target genes.3,4)RARs can bind bothatRA and 9-cis RA, but RXRs can only bind 9-cis RA.5) RXRs are

also known to be a heterodimer partners for a number of nuclear receptors.

Although RARs and RXRs are the major regulators of retinoid-mediated pathways, other pathways have also been found to be activated by retinoids. atRA has been found to down-regulate the transcriptional activities of AP–1 transcription complex.6) Furthermore, retinoids have been shown to alter the activity of MAP kinase path- ways.7) However, attention needs to be paid to the cells and genes involved, since all these signaling pathway have been shown to be cell-type dependent and target gene selective.

Interactions between retinoids and drug metabolizing enzymes have been demonstrated previously.8)This is es- pecially true in relation to cytochrome P450s (CYPs),

(3)

365 365 Effect of Retinoids on UGT mRNA Expression

which are regulated by retinoids and also actively metabolize them into their oxidized derivatives. The total number of CYPs that are regulatedin vivoby retinoids is not known; however, it has been suggested that CYP1A1, CYP3A and, most importantly, CYP26 and its variants are induced by and in turn metabolize these com- pounds.9–11)These enzymes are differentially expressed in various tissues, with the liver, intestine, and brain being the sites of highest expression.12)The role of the intestine in the metabolism of retinoids is clearly recognized.13) Dietary retinol can be oxidized in enterocytes to form atRA, which can be further metabolized by CYP26 to form various oxidized derivatives.14) It has also been shown that intestinal cells are the site of both CYP gene regulation and the metabolism of atRA.10,11,14)

UDP-Glucuronosyltransferases (UGTs) are quantita- tively the most abundant Phase II drug metabolizing en- zymes and are involved in the biotransformation of the greatest number of endogenous and exogenous com- pounds of any drug metabolizing enzyme. However, stu- dies of UGTs as enzymes responsible for the biotransfor- mation of retinoids are very limited. Our laboratory has carried out studies with recombinant human human UGTs that demonstrated that UGT2B7 is the only isoform able to glucuronidate atRA, 4-hydroxy (OH) atRA, 4-oxo atRA, and 5,6-epoxy atRA with activities similar to those found in human liver microsomes.15)We proposed that UGT2B7 might be involved in controlling intracellular levels of retinoids and their biological fate.

Our later publication confirmed the role of UGT2B7 in retinoid metabolism and further showed that both liver and all segments of intestine actively glucuronidateatRA, although the rate of atRA glucuronidation in liver was comparatively higher than that of intestine.16)It was cal- culated that, under normal physiological conditions, glucuronidation of retinoids in humans occurs at a con- centration of 5–17 nM.17)

In this report, a continuation of our previous retinoid- related metabolic studies,15,16)we have begun investigat- ing of the role of retinoids in the regulation of UGT2B7 expression. In order to examine the effect of retinoids on this isoform, Caco-2 and HepG2 cells were exposed to increasing concentrations of biologically active retinoids, including atRA, 9-cis RA, and 13-cis RA. These experi- ments showed dramatic suppression of UGT2B7 mRNA expression in the presence of these retinoids in Caco-2 but not HepG2 cells. However, similar experiments us- ing the oxidized derivatives of atRA showed no suppres- sive effects of these catabolic products. To clarify whether this down-regulation is isoform specific, we car- ried out similar experiments testing the effects of the ac- tive retinoids on the expression of two other human UGT isoforms, UGT1A6 and -2B15. These compounds had no suppressive effect on the expression of either isoform; however, the levels of UGT2B15 were slightly

up-regulated.

Based on these data, we hypothesize that exposure to pharmacological concentrations of biologically active retinoids induces a rapid down-regulation of UGT2B7 expression in intestinal but not hepatic cells. The differ- ent pattern of regulation between these two tissues may be an indication of tissue-specific mechanisms of regula- tion of UGT2B7 expression and is shown to be specific to this retinoid glucuronidating enzyme. The possible mechanism for this suppression is discussed here.

Methods

Materials: all-trans retinoic acid, 9-cis RA, 4-OH atRA, 4-oxo atRA, 5,6-epoxy atRA, and (E)-4-[2-(5,6,7,8- tetrahydro-5,5,8,8-tetra-methyl-2-naphthylenyl)-1-pro- penyl] benzoic acid (TTNPB) (chemical structures are shown inFig. 1) were all purchased from Sigma-Aldrich (St. Louis, Mo, USA). All procedures using retinoids were performed under yellow light to minimize photoisomeri- zation.

Cell culture: Caco-2 (ATCC HTB-37) and HepG2 (ATCC HB-8065) cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and kept in Dulbecco's Modified Eagle Medium (DMEM) sup- plemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA) at 379C in a humidified atmosphere of 5% CO2-air. Chemicals were dissolved in DMSO (Sig- ma-Aldrich) and cells we treat at indicated concentra- tions.

Cell viability assay: Cell viability was determined by Trypan Blue exclusion. Caco-2 cells were plated in 6- well plates at a density of 5×105cells per well and cul- tured for 24 hr.atRA,9-cisRA and TTNPB at concentra- tions corresponding to those used in UGT mRNA expres- sion level studies were then added. After an additional 48 hr incubation, the cells were released from the plates with trypsin/EDTA (Invitrogen), incubated with 0.4%

Trypan Blue (Mediatech, Herndon, VA, USA) for 5 min, and counted using a hemocytometer. Since the monolay- ers were not washed prior to trypsin-EDTA treatment or scraping of adherent cells, cells that detached during in- cubation with treated chemicals are detected.

RNA preparation: Total RNA was isolated from cell cultures using a phenol and guanidine isothiocyanate RNA extraction method (Trizol; Invitrogen), following the instructions of the supplier. To avoid any contamina- tion of the RNA by genomic DNA, DNase treatment was performed using RQ1 RNase-Free DNase (Promega, Madison, WI, USA). cDNA was synthesized by mixing 1 mg of total RNA from each sample with 100 pmol ran- dom hexamer primers in 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, containing 100 U M-MLV reverse transcriptase, 20 U RNase inhibi- tor, and 1 mM each dNTP (Promega) in a total volume of 20ml. The samples were incubated at 379C for 60 min

(4)

Fig. 1.Chemical structures of retinoids used.

Table 1.PCR primers and conditions for semi-quantitative analysis of UGT isoforms

Target

Transcript F: Forward primer 5?–3?

R: Reverse primer 5?–3? Annealing

Temp (9C) Amplicon

Size (bp) No. of cycles on Caco-2 cDNA UGT2B7 F: ttgcaccaggatgtctgtgaa

R: taccctctccatgaaagtcatttga 56 643 32 UGT2B15 F: gactgtgttgacatcttcggcttct

R: ccagtagctcaccacagggattaag 54.7 326 32 UGT1A6 F: gaagaaccgttaccaatcat

R: gaccattgatcccaaaga 55.4 670 35

GAPDH F: acccactcctccacctttg

R: ctcttgtgctcttgctggg 64 178 25

Nucleotide sequences are reported for primer pairs used in RT-PCR analysis of UGTs expressions in Caco-2 cells.

and then heated at 959C for 5 min to inactivate the reverse transcriptase. The reaction mixture was diluted to 100ml with sterile diethylpyrocarbonate-treated H2O.

RT-PCR analysis: Primers for UGT2B7, UGT2B15, UGT1A6 and GAPDH are described in Table 1. PCR reactions were performed as follows: a 10ml aliquot of cDNA was added to a reaction mixture containing 10 mM Tris-HCl buffer (pH 8), 20 mM KCl, 0.1% Triton X-100; 1.5 mM MgCl2, 0.2 mM of each dNTP, 50 pmol of each primer and 2 units of Taq DNA polymerase (Promega), in a total volume of 50ml. Amplification of

the ubiquitously expressed GAPDH cDNA was per- formed under the same conditions in separate experi- ments. The specificity of all primer pairs was confirmed through sequencing of the PCR products. For each primer pair, we performed PCR with different cycle numbers and plotted these data to form a standard curve.

We chose the cycle that was found to be within the non- saturable range of amplification for use in further experi- ments. All other conditions were kept consistent unless significant changes in mRNA level were observed. The PCR products were resolved by 2% agarose gel elec- trophoresis and detected with ethidium bromide. The bands were visualized under UV light and photographed by a computed-assisted camera. Quantification of each band was performed by densitometric analysis by using NIH Image software (NIH, Bethesda, MD).

Statistical methods: GraphPad Prism 4 (GraphPad Software, Inc., San Diego, CA, USA) was used for data analysis. The results were analyzed by one-way ANOVA followed by Dunnett's multiple comparison test. Mea- surements that vary significantly from the control are in- dicated *, pº0.05; **, pº0.01).

Results

Effect ofatRA,9-cisRA, and TTNPB on UGT2B7 mRNA expression: To determine whether atRA, a substrate for UGT2B7, can affect UGT2B7 gene expres- sion in cultured cell systems, Caco-2 and HepG2 cells

(5)

367

Fig. 2.Effect of retinoids on UGT2B7 mRNA expression in Caco-2 cells

Caco-2 cells were treated withatRA,9-cisRA and TTNPB at the indicated concentrations for 48 hours. Total RNA was isolated and RT-PCR analysis was performed to evaluate the expression level of UGT2B7 mRNA. The bar graphs show the relative expression of UGT2B7 mRNA (normalized to GAPDH expression). The IC50values for retinoid inhibition of UGT2B7 mRNA expression were calculated. The results were analyzed by one-way ANOVA followed by Dunnett's multiple comparison test. Measurements that vary significantly from the control are indi- cated (*,pº0.05; **,pº0.01).

367 Effect of Retinoids on UGT mRNA Expression

were treated for 48 hr with various concentrations of atRA, and 9-cis RA, as indicated in Figure 2. Caco-2 cells were also treated with low concentrations of the RAR agonist, TTNPB, under the same conditions. After treatment, total RNA was isolated from the cells and UGT2B7 mRNA levels were analyzed by semi-quantita- tive RT-PCR.atRA treatment of Caco-2 cells resulted in a significant dose-dependent decrease in UGT2B7 mRNA levels as compared with vehicle-treated (0.1% DMSO) cells (Fig. 2), with an IC50about 3.5mM. Incubation of Caco-2 cells with 9-cis RA had a similar effect on UGT2B7 mRNA levels but the decrease began at a much lower concentration, resulting in an IC50 of is 0.2mM, significantly lower than that ofatRA. The syntheticatRA analog, TTNPB, had a similar effect on UGT2B7 mRNA levels, with a low IC50of 0.3mM. These data showed that the RAR agonist TTNPB is the most potent suppressor of UGT2B7 mRNA expression in Caco-2 cells. On the other hand, in parallel experiments carried out in HepG2 cells under identical conditions, UGT2B7 mRNA expression was not affected by either retinoid or TTNPB (data not shown).

Effect of oxidized derivatives of retinoic acid on UGT2B7 mRNA expression: atRA is metabolizedin vivo by CYP26 and others to form 4-OH atRA, 4-oxo atRA, 5,6-epoxy atRA, all of which are generally accept- ed as inactive metabolites.14,18)To test the response of

UGT2B7 gene expression to these oxidized retinoids, Caco-2 cells were treated with 4-OHatRA, 4-oxo atRA, and 5,6-epoxyatRA at the same concentrations used for atRA. UGT2B7 mRNA levels were evaluated using semi- quantitative RT-PCR and normalized to GAPDH mRNA expression. As the data in Figure 3show, neither 4-OH atRA, 4-oxo atRA, nor 5,6-epoxy atRA induced or sup- pressed UGT2B7 mRNA levels, whereasatRA consistent- ly suppressed UGT2B7 mRNA expression. These data further demonstrate that UGT2B7 mRNA suppression is specific foratRA and9-cisRA, which are biologically ac- tive, while the three oxidized metabolites, the inactive in- termediates of the retinoid detoxification pathway, have no visible effects.

Effect of retinoids on UGT1A6 and UGT2B15 mRNA expression: To answer the question of whether retinoid mediated suppression of UGT2B7 is an observation related specifically to this isoform, the mRNA expression of UGT2B15 and UGT1A6 mRNA was examined under conditions identical to those used for UGT2B7 (Fig. 4). Treatment with atRA, 9-cis RA, and TTNPB had no effect on UGT1A6 mRNA expression except at the highest concentrations used, which cor- responds with the decreases in cell viability seen in Figure 5. On the other hand, treatment withatRA and TTNPB significantly increased the mRNA expression of UGT2B15 up to concentrations of 0.1mM and 10mM,

(6)

Fig. 3.Effect ofatRA and its oxidized derivatives on UGT2B7 mRNA expression in Caco-2 cells

Caco-2 cells were treated with each retinoid at the concentrations shown in the figure (0.1–50mM) for 48 hours. Total RNA was isolated and RT-PCR analysis was performed to evaluate mRNA expression level of UGT2B7. The results are shown as the relative mRNA expression (normalized to GAPDH expression). The results were analyzed by one-way ANOVA followed by Dunnett's multiple comparison test. Mea- surements that vary significantly from the control are indicated (*,pº0.05; **,pº0.01).

Fig. 4.Effect ofatRA on UGT2B15 and UGT1A6 mRNA expression

Caco-2 cells were treated withatRA at the indicated concentration for 48 hours. Total RNA was isolated and RT-PCR analysis was per- formed to evaluate UGT2B15 and UGT1A6 mRNA expression levels. The results are shown as relative mRNA expression (normalized to GAPDH expression). The results were analyzed by one-way ANOVA followed by Dunnett's multiple comparison test. Measurements that vary significantly from the control are indicated (*,pº0.05; **,pº0.01).

respectively. No effect of 9-cisRA on UGT2B15 mRNA expression was observed under the current experimental conditions.

Effect of retinoids on Caco-2 cell viability: Reti- noids are also known to be toxic to cells at pharmacologi- cal concentrations. To exclude the possibility that these retinoids might disrupt the Caco-2 cell membrane, cell viability was assayed using a Trypan Blue exclusion assay.

As shown in Figure 5, only the highest concentrations

of retinoids, which were far above pharmacological con- ditions, decreased Caco-2 cell viability. All other concen- trations of retinoids, including those that significantly suppressed UGT2B7 mRNA expression or induced UGT2B15 mRNA expression, were well-tolerated by the cell.

Discussion

In these studies, we report that human UGT2B7

(7)

369

Fig. 5.Effect of retinoids on Caco-2 cell viability

Caco-2 cells were plated in 6-well plates at a density of 5×105cells per well and cultured for 24 hr.atRA,9-cisRA, and TTNPB at were then added the indicated concentrations and cells were incubated for an additional 48 hr. The percentage viability was determined by Trypan Blue exclusion. The results were analyzed by one-way ANOVA followed by Dunnett's multiple comparison test. Measurements that vary sig- nificantly from the control are indicated (*,pº0.05; **,pº0.01).

369 Effect of Retinoids on UGT mRNA Expression

mRNA expression is negatively regulated by the biologi- cally active retinoids, atRA and 9-cis RA, and their syn- thetic derivative, TTNPB, in Caco-2 cells. This dose- dependant decrease in UGT2B7 mRNA levels seems to be specific to this UGT isoform, since it is not observed with the two other UGT isoforms tested, UGT1A6 and -2B15.

The different effects ofatRA,9-cisRA and TTNPB on UGT2B7 mRNA expression could be due to their differ- ent functions in the cell.9-cis RA is a unique ligand for the retinoid X receptor (RXR) and9-cisRA andatRA are both ligands for RAR. As for TTNPB, it is a strong agonist for RAR. These biologically actively compounds are in- volved in different signaling pathways. The receptors ac- tivated by these ligands could effect the regulation of totally different sets of genes, and therefore, the net ef- fect of this pathway on UGT2B7 expression could be different. Although similar, it is unlikely that their effects on 2B7 gene regulation would be identical.

Three P450-oxidized catabolic products of atRA, 4-OH-, 4-oxo-, and 5,6-epoxy-RA, showed no effect on the mRNA expression of this isoform, One concern that needs to be taken into consideration is whether the oxi- dized compounds can cross the cell membranes in Caco- 2 cells. However, there is evidence that these oxidized RAs can cross the membranes of Cos-7 cells19)and that oxidized metabolites of linoleic acids can cross in both colon cell lines, Caco-2 and HCT-116.20)Therefore, it is reasonable to make the assumption that oxidized reti- noids can also cross in Caco-2 cells, but are not able to cause the suppressive effects, which are more likely specific to the biologically active retinoids. The lack of suppression seen with these compounds provides im- portant proof that the suppressive effects are specific to biologically active retinoids and are not simply artifacts of the system.

Additionally, no suppressive response to retinoids was observed in HepG2 cells, indicating that the regulation of this isoform is tissue-specific with the major site of this action being the intestine: the first organ exposed to die-

tary retinoids and orally administered retinoid-based drugs. It is recognized that UGTs are expressed in a tis- sue-specific manner. Therefore, we can speculate that there are additional factors involved, such as the exis- tence and/or regulation of different nuclear receptors or signaling pathways. These could vary in the liver and col- on and differentially mediate the UGT regulation, includ- ing the observed suppression of UGT2B7. It is also possi- ble that other factors that we have not recognized, can be involved (i.e., the presence of the retinoid acid binding protein (RABP), etc).

A majority ofatRA enters the body in the form of vita- min A, or other dietary products13)and enters the organ- ism via the intestinal tract. Our previous studies have provided information that retinoids are actively metabo- lized by UGT2B7 in the human intestinal tract.16) The product of this biotransformation, retinoyl-b-glucuro- nide, is found in the liver, kidney, intestinal mucosa, and several other tissues. However, of all these tissues, the in- testinal mucosa seems to be the most active in synthesiz- ing and retaining retinoyl-b-glucuronide in vivo21).

It is recognized that, in addition to a large number of beneficial processes initiated by retinoids, this class of compounds can also be responsible for many deleterious effects on the body, when they either exceed physiologi- cal levels or are present in inadequate amounts.22) Be- cause of this, one can easily speculate on the conse- quences of the dramatic decrease of UGT2B7 expression seen in Caco-2 cells in response to retinoids. Most obvi- ously, since UGT2B7 is involved in the elimination of ex- cess retinoids and/or the termination of their biologicall activity, the suppression of this enzyme could result in the accumulation of excess retinoids, leading to toxicity in the cell and organism and an increase in teratogenesis and hypervitaminosis A syndrome.23,24) UGT2B7 is also an indispensable component of the overall detoxification network. In addition to its function in modulating the ac- tivity of biologically active compounds, it also plays an es- sential role in controlling steady-state concentrations of compounds such as fatty acids, bile acids, prostaglandins,

(8)

steroid hormones, and retinoids,25)which are ligands for nuclear receptors, such as RXR and RAR, and other sig- naling pathways. A lack of UGT2B7 would allow for prolonged interactions of active retinoids with nuclear receptors and signaling pathways, potentially resulting in non-specific activation of a variety of genes. Therefore, impairment of this isoform's activity could have far reaching effects on the homeostasis of many nuclear receptor-dependant systems throughout the organism.

In addition, a decrease in UGT2B7 could result in in- sufficient biosynthesis of retinoyl-b-glucuronide, which may itself possess biologically activity. In fact, it has been shown that retinoyl-b-glucuronide is more active than atRA or retinol in modulating differentiation in certain cell types and inducing differentiation of human promye- locytitic leukemia cells (HL–60) without being hydro- lyzed to retinoic acid.26)In cell differentiation, retinoyl-b -glucuronide might act as a carrier to transfer the retinoyl moiety to appropriate protein, as a transport a- gent from the cytosol to the nucleus, or as a slow-release precursor of retinoic acid.21)On the other hand, retinoyl- b-glucuronide might serve a protective role against the teratogenic events induced by retinoic acid. Retinoyl-b -glucuronide is much less teratogenic than atRA and crosses the placenta to the fetus at a much slower rate.27) Therefore, suppression of the formation of this com- pound could result in a decrease in the bioavailability of this important regulator.

From these results, we can only speculate on the puta- tive mechanism of the observed UBT2B7 mRNA suppres- sion in response to biologically active retinoids. Since all the major physiological effects of retinoids are mediated by nuclear receptors, one has to acknowledge the possi- ble role of the nuclear receptors in this process. Several recent studies have demonstrated that in some cases ligand-activated hormone and orphan receptors, such as the glucocorticoid receptor (GR), thyroid receptor (TR), and farnesoid X receptor (FXR), can suppress gene tran- scription, producing deleterious effects,28–31) and mechanisms accounting for this negative regulation have been proposed. A picture emerges of negative transcrip- tional regulation by nuclear receptors involving two basic mechanisms. One major form of this regulation occurs as a result of interaction between nuclear receptors and other transcriptional factors, including AP-1 and Oct-1.32) Ligand-activated GR and retinoic acid receptor were shown to interact with AP-1 in a DNA-independent man- ner and repress the induction of gene expression by AP-1.33,34) Another form based on the binding of ligand activated nuclear receptors to specialized negative response elements has been observed for GR,31)TR,28)the Vitamin D receptor,35)and most recently FXR.29,30)Grow- ing evidence has been collected that ligand-activated FXR is involved in the negative regulation of a number of tar- get genes encoding drug transporters, and drug

metabolizing enzymes.29,30)The most significant examples are P450 7A136)and cholesterol 12a-hydroxylase.37) Evi- dence has also been presented showing suppression of apolipoprotein A-I by activated FXR binding to negative FXR response elements.29)

The phenomenon of nuclear receptor mediated nega- tive transcriptional regulation has also been observed for UGTs.30)These studies from our laboratory revealed that lithocholic acid (LCA) dramatically decreased UGT2B7 mRNA expression in Caco-2 cells.30) We demonstrated that the mechanism of this negative regulation is mediat- ed by the interaction of LCA-activated FXR with a specif- ic negative FXR response element in the UGT2B7 gene promoter. We cannot currently conclude that UGT2B7 gene suppression by retinoids and, consequently, the metabolism of these compounds in intestinal cells, is regulated through a retinoid-specific receptor, such as RAR or RXR, but the fact that the RAR agonist, TTNPB, shows the highest potency of UGT2B7 gene suppression does suggest that this regulation might be at the tran- scriptional level. Experiments are in progress to identify the exact mechanism involved.

In summary, the present studies provide another novel example of the suppression of UGT2B7 in response to pharmacological concentrations of its substrate, in this case biologically active retinoids. It is important to em- phasize that the inhibition of the constitutively expressed human UGT2B7, an isoform that is recognized as one of the most effective detoxification enzyme widely ex- pressed in the body, may significantly contribute to the frequently observed toxicity of retinoids.

Acknowledgement:We would like to thank Joanna Lit- tle for suggestions and careful reading of the manuscript.

References

1) Ross, S. A., McCaffery, P. J., Drager, U. C. and De Luca, L. M.:

Retinoids in embryonal development.Physiol Rev.,80: 1021–54 (2000).

2) Nagpal, S. and Chandraratna, R. A.: Vitamin A and regulation of gene expression.Curr. Opin. Clin. Nutr. Metab. Care,1: 341–6 (1998).

3) Bastien, J. and Rochette-Egly, C.: Nuclear retinoid receptors and the transcription of retinoid-target genes. Gene, 328: 1–16 (2004).

4) Robertson, K. A., Emami, B., Mueller, L. and Collins, S. J.: Mul- tiple members of the retinoic acid receptor family are capable of mediating the granulocytic differentiation of HL-60 cells.Mol.

Cell. Biol.,12: 3743–9 (1992).

5) Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R. B., Eichele, G., Evans, R. M. and Thaller, C.: 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell, 68:

397–406 (1992).

6) Schule, R., Rangarajan, P., Yang, N., Kliewer, S., Ransone, L. J., Bolado, J., Verma, I. M. and Evans, R. M.: Retinoic Acid is a

(9)

371 371 Effect of Retinoids on UGT mRNA Expression

Negative Regulator of AP–1-Responsive Genes.Proc. Natl. Acad.

Sci. USA,88: 6092–6096 (1991).

7) Fisher, G. J. and Voorhees, J. J.: Molecular mechanisms of pho- toaging and its prevention by retinoic acid: ultraviolet irradia- tion induces MAP kinase signal transduction cascades that in- duce Ap-1-regulated matrix metalloproteinases that degrade hu- man skin in vivo.J. Investig. Dermatol.,3: 61–68 (1998).

8) Lampen, A., Meyer, S. and Nau, H.: Effects of Receptor-Selec- tive Retinoids on CYP26 Gene Expression and Metabolism of All-trans-Retinoic Acid in Intestinal Cells.Drug. Metab. Dispos., 29: 742–747 (2001).

9) McSorley, L. C. and Daly, A. K.: Identification of human cytochrome P450 isoforms that contribute toall-trans-retinoic acid 4-hydroxylation. Biochemical Pharmacology, 60: 517 (2000).

10) Taimi, M., Helvig, C., Wisniewski, J., Ramshaw, H., White, J., Amad, M. A., Korczak, B. and Petkovich, M.: A Novel Human Cytochrome P450, CYP26C1, Involved in Metabolism of9-cis and All-trans Isomers of Retinoic Acid. J. Biol. Chem., 279:

77–85 (2004).

11) Zhang, Q.-Y., Dunbar, D. and Kaminsky, L.: Human Cytochrome P–450 Metabolism of Retinals to Retinoic Acids.

Drug Metab. Dispos.,28: 292–297 (2000).

12) Nishimura, M., Yaguti, H., Yoshitsugu, H., Naito, S. and Satoh, T.: Tissue distribution of mRNA expression of human cytochrome P450 isoforms assessed by high-sensitivity real-time reverse transcription PCR. Yakugaku Zasshi, 123: 369–75 (2003).

13) Harrison, E. H.: Mechanisms of digestion and absorption of die- tary vitamin A.Annu. Rev. Nutr.,25: 87–103 (2005).

14) Lampen, A., Meyer, S., Arnhold, T. and Nau, H.: Metabolism of Vitamin A and Its Active Metabolite All-trans-retinoic Acid in Small Intestinal Enterocytes. J. Pharmacol. Exp. Ther., 295:

979–985 (2000).

15) Samokyszyn, V. M., Gall, W. E., Zawada, G., Freyaldenhoven, M. A., Chen, G., Mackenzie, P. I., Tephly, T. R. and Radomin- ska-Pandya, A.: 4-hydroxyretinoic acid, a novel substrate for hu- man liver microsomal UDP-glucuronosyltransferase(s) and recombinant UGT2B7.J. Biol. Chem.,275: 6908–14 (2000).

16) Czernik, P. J., Little, J. M., Barone, G. W., Raufman, J. P. and Radominska-Pandya, A.: Glucuronidation of estrogens and retinoic acid and expression of UDP-glucuronosyltransferase 2B7 in human intestinal mucosa. Drug Metab. Dispos., 28:

1210–6 (2000).

17) Barua, A. B. and Olson, J. A.: Retinoyl beta-glucuronide: an en- dogenous compound of human blood. Am. J. Clin. Nutr.,43:

481–495 (1986).

18) Napoli, J. L.: Biochemical pathways of retinoid transport, metabolism, and signal transduction.Clinical Immunology & Im- munopathology,80: S52–62 (1996).

19) Idres, N., Marill, J., Flexor, M. A. and Chabot, G. G.: Activation of retinoic acid receptor-dependent transcription by all-trans- retinoic acid metabolites and isomers. J. Biol. Chem., 277:

31491–31498 (2002).

20) Bull, A. W., Steffensen, K. R., Leers, J. and Rafter, J. J.: Activa- tion of PPAR gamma in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR gam- ma.Carcinogenesis,24: 1717–1722 (2003).

21) Genchi, G., Wang, W., Barua, A., Bidlack, W. R. and Olson, J.

A.: Formation of beta-glucuronides and of beta-galacturonides of various retinoids catalyzed by induced and noninduced microsomal UDP-glucuronosyltransferases of rat liver.Biochim.

Biophys. Acta.,1289: 284–290 (1996).

22) Russell, R. M.: The vitamin A spectrum: from deficiency to tox- icity.Am. J. Clin. Nutr.,71: 878–884 (2000).

23) Collins, M. D. and Mao, G. E.: Teratology of retinoids. Annu.

Rev. Pharmacol. Toxicol.,39: 399–430 (1999).

24) Silverman, A. K., Ellis, C. N. and Voorhees, J. J.: Hypervitamino- sis A syndrome: a paradigm of retinoid side effects.J. Am. Acad.

Dermatol.,16: 1027–39 (1987).

25) Radominska-Pandya, A., Little, J. M. and Czernik, P. J.: Human UDP-glucuronosyltransferase 2B7. Curr. Drug. Metab., 2:

283–98 (2001).

26) Zile, M. H., Cullum, M. E., Simpson, R. U., Barua, A. B. and Swartz, D. A.: Induction of Differentiation of Human Promyelo- cytic Leukemia Cell Line HL-60 by Retinoyl Glucuronide, a Bio- logically Active Metabolite of Vitamin A. Proc. Natl. Acad. Sci.

USA,84: 2208–2212 (1987).

27) Gunning, D. B., Barua, A. B. and Olson, J. A.: Comparative ter- atogenicity and metabolism of all-trans retinoic acid, all-trans retinoyl beta-glucose, and all-trans retinoyl beta-glucuronide in pregnant Sprague-Dawley rats.Teratology,47: 29–36 (1993).

28) Berghagen, H., Ragnhildstveit, E., Krogsrud, K., Thuestad, G., Apriletti, J. and Saatcioglu, F.: Corepressor SMRT functions as a coactivator for thyroid hormone receptor T3Ralpha from a negative hormone response element. J. Biol. Chem., 277:

49517–49522 (2002).

29) Claudel, T., Sturm, E., Duez, H., Torra, I. P., Sirvent, A., Kosykh, V., Fruchart, J. C., Dallongeville, J., Hum, D. W., Kuip- ers, F. and Staels, B.: Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J. Clin. Invest.,109: 961–971 (2002).

30) Lu, Y., Heydel, J. M., Li, X., Bratton, S., Lindblom, T. and Radominska-Pandya, A.: Lithocholic acid decreases expression of UGT2B7 in Caco-2 cells: a potential role for a negative farne- soid X receptor response element. Drug Metab. Dispos., 33:

937–946 (2005).

31) Ou, X. M., Storring, J. M., Kushwaha, N. and Albert, P. R.: Het- erodimerization of mineralocorticoid and glucocorticoid recep- tors at a novel negative response element of the 5-HT1A recep- tor gene.J. Biol. Chem.,276: 14299–14307 (2001).

32) Felli, M. P., Vacca, A., Meco, D., Screpanti, I., Farina, A. R., Maroder, M., Martinotti, S., Petrangeli, E., Frati, L. and Gulino, A.: Retinoic acid-induced down-regulation of the interleukin-2 promoter via cis-regulatory sequences containing an octamer motif.Mol. Cell. Biol.,11: 4771–4778 (1991).

33) Karin, M. and Chang, L.: AP-1-glucocorticoid receptor crosstalk taken to a higher level.J. Endocrinol.,169: 447–451 (2001).

34) Mehta, K.: Retinoids as regulators of gene transcription.J. Biol.

Regul. Homeost Agents,17: 1–12 (2003).

35) Okazaki, T., Nishimori, S., Ogata, E. and Fujita, T.: Vitamin D- dependent recruitment of DNA-PK to the chromatinized nega- tive vitamin D response element in the PTHrP gene is required for gene repression by vitamin D. Biochem. Biophys. Res. Com- mun,304: 632–637 (2003).

36) Xu, G., Li, H., Pan, L. X., Shang, Q., Honda, A., Ananthanaraya- nan, M., Erickson, S. K., Shneider, B. L., Shefer, S., Bollineni, J., Forman, B. M., Matsuzaki, Y., Suchy, F. J., Tint, G. S. and Salen,

(10)

G.: FXR-mediated down-regulation of CYP7A1 dominates LXRalpha in long-term cholesterol-fed NZW rabbits. J. Lipid Res.,44: 1956–1962 (2003).

37) Fayard, E., Schoonjans, K. and Auwerx, J.: Xol INXS: role of the liver X and the farnesol X receptors. Curr. Opin. Lipidol., 12:

113–120 (2001).

Références

Documents relatifs

Under the condition of mTOR-silenc- ing, whereby thrombin-induced up-regulation of TF protein level was augmented as compared with the control cells (Fig. lane 2), over-expression

The aim of this study was to determine the effects of orally administration of bovine colostrum (0,1 and 5 g daily) for three weeks on the immune Th1/Th2 response in weaned

To clarify the role of DNA methylation in the regulation of the 17q12-q21 asthma-associ- ated region, we have examined the impact of DNA-methyltransferase 1 inhibitor

To further understand the mechanism of OTA-in- duced apoptosis in human T lymphocytes, we investigat- ed the succession of apoptotic events in H9 cells, a human cutaneous CD4+

In this study, we report successful isolation and generation of global gene expression datasets of Arabidopsis embryos at key stages of development, determination of the

Nuclear organization and regulation of gene expression in mouse Embryonic Stem Cells by long non-coding RNAs..

The regulation of COX1 in MDCK cells functions bi-directionally: ectopic PV expression decreased COX1 by 20%, silencing of Pvalb mRNA by shRNA essentially restored the

Analysis of the microRNA expression profiles of chicken dendritic cells in response to H9N2 avian influenza virus infection...