• Aucun résultat trouvé

Effect Of Bovine Colostrum Supplementation On Cytokine mRNA Expression In Weaned Piglets

N/A
N/A
Protected

Academic year: 2021

Partager "Effect Of Bovine Colostrum Supplementation On Cytokine mRNA Expression In Weaned Piglets"

Copied!
1
0
0

Texte intégral

(1)

Effect of bovine colostrum supplementation on cytokine mRNA expression of

weaned piglets

C. Boudry*,1, A. Buldgen*, D. Portetelle, P. Gianello, A. Théwis*, P. Leterme§, J.P. Dehoux

* Unité de Zootechnie, Faculté universitaire des Sciences Agronomiques, Passage des

Déportés 2, 5030 Gembloux, Belgium.

Unité de Biologie animale et microbienne, Faculté universitaire des Sciences Agronomiques,

Passage des Déportés 2, 5030 Gembloux, Belgium.

Unité de Chirurgie expérimentale, Faculté de Médecine, Université catholique de Louvain,

Avenue Hippocrate 55/70, 1200 Brussels, Belgium.

§ Prairie Swine Centre, 2105 8th Street East, Saskatoon, SK, S7H 5N9, Canada

Abstract

The aim of this study was to evaluate the influence of a bovine colostrum supplementation on the immune Th1/Th2 response in weaned piglets. After weaning at 21 days, 21 piglets were fed daily ad libitum with a starter diet supplemented for 3 weeks with 0, 1 or 5 g of bovine colostrum. Growth performances were measured weekly. Spleen and gut-associated lymphoid tissues (GALT) (ileal Peyer’s patch (iPP), jejunum wall (JW) and mesenteric lymph nodes (MLN)) biopsies were collected on each piglet after the 3 weeks treatment and analyzed for their cytokine mRNA expression (IL-2, IL-4, IL-10, IL-12 and

1 Correspondence : Passage des déportés 2, B-5030 Gembloux, Belgium. (Phone:

+32-81-622117; fax: +32-81-622115 ; E-mail: [email protected]).

1 1 2 3 4 5 6 7 8 9 10 11 13 14 15 16 17 18 19 20 21 22 23 1 2 3

(2)

IFN) by RT-PCR. Growth performances were not affected by bovine colostrum (P > 0.05). In the colostrum groups, the iPP cells showed higher IL-4, IL-10 and IL-12 cytokine levels (P < 0,05), associated with a decrease of IFN-γ (P < 0,01) and no effect on IL-2 production (P > 0,05). IL-10, IL-2 and IL-12 productions increased (P < 0,05) in MLN, with no effect on IFN-γ and IL-4 levels (P > 0,05). The IL-12 production was also increased (P < 0,01) in JW cells with no modification for the other cytokine. No modification of cytokine production was observed in the spleen (P > 0,05). These results suggest an immunomodulatory effect of bovine colostrum on the GALT which answered by producing, at different levels, both Th1 proinflammatory cytokines IL2, IFNγ and IL12 and Th2 antiinflammatory cytokines -IL-4 and IL-10. This bipolarity of the Th1/Th2 response protects the weaned piglets from both allergic (food) as well as infectious (pathogens) diseases.

Keywords : Piglet, Bovine colostrum, Cytokine, Th1/Th2, RT-PCR

Introduction

Bovine colostrum is a milk secreted during the first few days after calving, which has a critical role in post-neonatal health as an immune booster. In addition to nutrients bovine colostrum also contains various kinds of bioactive components like growth and anti-microbial factors. Growth factors promote the growth and the development of the newborn calf, while anti-microbial factors provide passive immunity and protect against infections during the first weeks of life (Mero et al., 1997; Pakkanen and Aalto, 1997).

The most abundant and well-characterized growth factors in bovine colostrum are insulin-like growth factors (IGF-1 and IGF-2), insulin, transforming growth factors (TGF-1 and TGF-2) and epidermal growth factors (EGF) (Pakkanen and Aalto, 1997). Anti-microbial factors in bovine colostrum include immunoglobulins, lactoferrin, lysozyme and

2 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 4

(3)

lactoperoxidase. Bovine colostrum is also an extremely important source of immunoglobulins. The concentrations of IgG, IgM, and IgA are 100-fold higher than in normal milk (Rooke and Bland, 2002; Uruakpa et al., 2002).

Weaning is a major critical period of pig production because of increased susceptibility to gut disorders, infections and diarrhoea due to psychological, social, environmental and dietary stresses interfering with gut development and adaptation. The immediate effects of weaning are gut structural changes, essentially villous atrophy and crypt hyperplasia, with a decrease of digestive and absorptive capacity of the small intestine and a dramatic reduction of feed intake leading to undernutrition, transient growth check and infection sensitivity (Pluske et al., 1997). The weaning period in young pigs is also correlated with an inflammation of the gut, involving some alteration of the intestinal immunity and the intestinal immune responses against dietary and bacterial antigens (Hannant, 2002).

Bovine colostrum has been used as a health food supplement for humans. It improves diarrhoea in patients suffering from immunodeficiency syndromes, non anti-inflammatory steroidal drugs-induced inflammatory colitis, or acute phase-responses to surgery (He et al., 2001; Morein et al., 2002; Yoshioka et al., 2005). The mechanisms by which bovine colostrum protects the host from infections have been attributed to the anti-microbial action of its functional components on infective agents and toxins and/or on host immune responses which may be beneficial for host health. Nevertheless, the data available on the immuno-modulatory effects of bovine colostrum in non-ruminants (as well as human subjects) are still limited.

The aim of this study was to determine the effects of orally administration of bovine colostrum (0,1 and 5 g daily) for three weeks on the immune Th1/Th2 response in weaned piglets. 3 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 5

(4)

Material and methods

Animals, diet and experimental design

Twenty-one 3-weeks-old newly weaned outbred Belgian Landrace male piglets (Buggenhout, Belgium) weighing 7.4  0.4 kg were used in this study . Piglets were randomly allocated among three groups. Each group was fed ad libitum with the same diet and each piglet received daily 0 g (Group 0), 1 g (Group 1) or 5 g (Group 5) of bovine colostrum (Centre d’Economie Rurale, Marloie, Belgium) for three weeks. Colostrum solutions were administrated orally to the piglets and prepared by dissolving colostrum powder in sterilized water at the concentration of 10 % (w/v).

On day 21, all the animals were operated after being anesthetized with tiletamine/zolazepam (Zoletil 100 R, 6 mg/kg, Virbac) and xylazine (Rompun 2% R, 2 mg/kg,

Bayer) for induction and enflurane (Ethrane R 0.8%)/nitrous oxide (0.2 L/min) for

maintenance. Mesenteric lymph nodes (MLN), pieces of the jejunum wall (JW) (100 cm after pylorus) and biopsies of the ileal Peyer’s patch (iPP) and the spleen were harvested and immediately frozen in liquid nitrogen before storing at –80°C.

After surgery, the animals were sacrified by lethal iv injection of embutramide/mebenzonium/tetracaine hydrochloride (T61R, Intervet). All procedures were

handled according to the guidelines established by the ethical committee of the Catholic University of Louvain (Belgium) and according to the Belgian legislation about care and use of laboratory animals.

RNA extraction and analysis by real-time PCR (RT-PCR )

4 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 6

(5)

Total RNA was extracted from the frozen samples (400 mg) with TriPure Isolation Reagent (Roche Diagnostics Corporation, Indianapolis, IN, USA), according to the instructions of the manufacturer. RNA was quantified by spectrophotometry (λ=260 nm). Reverse transcription (RT) was performed on 1 µg of total RNA in a reaction volume of 20 µl involving random hexamers, RT buffer 5X, 9 mM dithiothreitol, 220 µM of each deoxyribonucleotide triphosphate (dNTP) and 200 U of M-MLV (Invitrogen, California, USA). Final RT product was adjusted to 50 µl using RNase free water. cDNA product was amplified on a GeneAmp 5700 Sequence Detection System and software (Applied Biosystems, Den Ijssel, the Netherlands) using SYBR Green detection (Applied Biosystems, Foster City, CA, USA). RT-PCR was carried out using the following cycle parameters: 10 min at 95°C, followed by 50 cycles of 1 min at 60°C and 15 s at 95°C. The following primers were used:

- for IL2, forward: cagttgcttttgaaggaagttaagaa ; reverse: gcctgcttgggcatgtaaa; - for IL-12: forward: cgtgcctcgggcaattataa ; reverse: caggtgaggtcgctagtttgg; - for IFNγ, forward: ttcaaagataaccaggccattca ; reverse: cactgatggctttgcgctg; - for IL-4, forward: cacagcgagaaagaactcgt ; reverse: gtccgctcaggaggctcttc; - for IL-10, forward: cttgttgctgaccgggtctct ; reverse: tcggcattacgtcttccaggt.

The ribosomal protein L19 (RPL19) RNA was chosen as an internal standard reporter gene (forward: caagcggattctcatggaaca ; reverse: tggtcagccaggagcttctt). Results were expressed using the comparative cycle threshold (Ct) method as described in the User Bulletin #2 (Applied Biosystems). Results 5 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 7

(6)

The results of cytokine mRNA expressions are presented on Figure 1.

For IFN-γ, daily 5 g-colostral supplementation induced a significant decrease of IFN mRNA expression in iPP (P < 0.01). No significant influence was observed in the other organs (P > 0.05).

For IL-2, daily 1 and 5 g-colostrum supplementations induced a significant increase of its expression in MLN (P < 0.01). No significant influence was observed in the other organs (P > 0.05).

For IL-12, daily 5 g-colostral supplementation induced a significant increase of its expression in MLN, intestine and iPP (P < 0.05, P < 0.01 and P < 0.01, respectively). Daily 1 g-colostrum supplementation induced a significant increase of its expression in intestine and iPP (P < 0.05). In spleen, no significant influence was recorded (P > 0.05).

For IL-4, daily 1 g- as well as 5 g-colostral supplementations induced a significant increase of its expression in iPP (P < 0.01 and P < 0.001, respectively). No significant influence was observed in the other organs (P > 0.05).

Finally, for IL-10, daily 1 g- -colostral supplementation induced a significant increase in its expression in MLN and in iPP (P < 0.01). No significant influence was observed in the other organs (P > 0.05).

Discussion

Conclusion

These results suggest an immunomodulatory effect of bovine colostrum on the GALT which answered by producing, at different levels, both Th1 pro-inflammatory cytokines - IL-2, IFN-γ and IL-12 - and Th2 anti-inflammatory cytokines - IL-4 and IL-10. This bipolarity of

6 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 8

(7)

the Th1/Th2 response protects the weaned piglets from both allergic (food) as well as infectious (pathogens) diseases.

References 7 149 150 151 152 9

Références

Documents relatifs

It appears that improving piglet colostrum intake along with the reduction of the shedding in sows may favor the control of Salmonella infection in breeding farms.. © The

Aliquots of the total RNA samples were prepared from bovine liver (used through- out the experiment as positive controls for the expression of boAGP), the somatic cells (all 18

Le shamisen est un instrument d'origine chinoise qui fut introduit dans l'île d'Okinawa au milieu du XVI e siècle et utilisé dans la musique populaire.. Le

Seventy young participants, 65 younger-old, 53 older-old, and 13 MCIs were presented with forced-choice and yes/no visual recognition memory tasks with the

La même démarche est initiée dans la situation-problème « Les quartiers d’orange » (cf annexe II), à partir d’une situation de la vie quotidienne : tous les matins,

This study aimed to further investigate recognition memory for positive, negative and neutral words in depressed patients and matched comparison participants with

Das Gesetz von 1995 stellt jegliches Verhalten unter Strafe, bei dem der während des zweiten Weltkriegs vom deutschen nationalsozialistischen Regime begangene Völkermord geleugnet,

b/i Institute of Clinical Neuroscience and Medical Psychology/C. Vogt Institute for Brain Research, Heinrich Heine University, Düsseldorf, Germany c Research Imaging