ADP-induced platelet aggregation is associated with P2Y12 gene sequence variations in healthy subjects
Fontana
A gain-of-function P2Y12 haplotype
Pierre Fontana, MD; Annabelle Dupont, MSc; Sophie Gandrille, PhD; Christilla Bachelot-Loza, PhD; Jean-Luc Reny, MD, PhD; Martine Aiach, PhD and Pascale Gaussem, PhD
From the Service d’Hématologie Biologique A, Hôpital Européen Georges Pompidou and Inserm Unité 428, Faculté des Sciences Pharmaceutiques et Biologiques, Université Paris V, Paris, France.
Correspondence : Pierre Fontana
Service d’Hématologie Biologique A Hôpital Européen Georges Pompidou
20 rue Leblanc, F-75908 Paris cedex 15, France Phone: +33 1 56 09 39 01
Fax: +33 1 56 09 39 13
E-mail: pierre.fontana@egp.ap-hop-paris.fr
P. Fontana was supported by grants from the Swiss National Fund for Scientific Research (81LA-63350), the Holderbank, and the University of Lausanne, Switzerland. This work was partially funded by a grant from Programme Hospitalier de Recherche Clinique (Ministère chargé de la Santé, PHRC AOR01023, sponsor: Inserm) and the Association Claude Bernard.
Total word count: 4540.
Journal Subject Heads: [92] Platelets, [178] Aggregation.
Abstract
Background- The ADP receptor P2Y12 plays a pivotal role in platelet aggregation, as
demonstrated by the benefit conferred by its blockade in patients with cardiovascular disease.
Some studies have shown inter-individual differences in ADP-induced platelet aggregation responses ex vivo, but the mechanisms underlying this variability are unknown.
Methods and Results- We examined ADP-induced platelet aggregation responses in 98
healthy volunteers, and identified two phenotypic groups of subjects, with high and low responsiveness to 2 µM ADP. This prompted us to screen the recently identified Gi-coupled ADP receptor gene P2Y12 for sequence variations. Among the five frequent polymorphisms thus identified, four were in total linkage disequilibrium, determining haplotypes H1 and H2, with respective allelic frequencies of 0.86 and 0.14. The number of H2 alleles was associated with the maximal aggregation response to ADP in the overall study population (P=0.007). Down- regulation of the platelet cAMP concentration by ADP was more marked in ten selected H2 carriers than in ten non carriers.
Conclusion- In healthy subjects, ADP-induced platelet aggregation is associated with an
haplotype of the P2Y12 receptor gene. Given the crucial role of the P2Y12 receptor in platelet functions, carriers of the H2 haplotype may have an increased risk of atherothrombosis and/or a lesser clinical response to thienopyridine drugs.
Condensed abstract
The ADP receptor P2Y12 plays a key role in platelet aggregation and in the thrombotic risk. We examined the reported variability of ADP-stimulated platelet responses in 98 healthy volunteers.
We then sequenced the P2Y12 gene and evidenced 2 haplotypes, H1 and H2. Compared to the H1 haplotype, the H2 haplotype was associated with a stronger ADP-stimulated platelet
aggregation response, and with different regulation of intracellular cAMP levels. Carriers of the
H2 haplotype may have an increased risk of atherothrombosis and/or a lesser clinical response to thienopyridine drugs.
Keywords: Platelets - genetics - receptors.
ADP is one of the most important mediators of hemostasis and thrombosis.1 The effect of ADP on platelets is mediated by two P2Y receptors designated P2Y1 and P2Y12. Transduction of the ADP signal involves both a transient rise in Ca++ mediated by the Gq-coupled P2Y1 receptor,2 and inhibition of adenylate cyclase mediated by the Gi-coupled P2Y12 receptor.3,4 Simultaneous activation of the Gq and Gi pathways by ADP is necessary for normal aggregation.5,6 Activation of the Gq pathway through P2Y1 leads to platelet shape changes and a rapidly reversible wave of platelet aggregation,2,6 while activation of the Gi pathway through P2Y12 elicits slowly progressive and sustained platelet aggregation.7 The effect of P2Y12 is not limited to inhibition of adenylate cyclase and a subsequent reduction in intracellular cAMP content. Indeed, it has been shown that P2Y12 receptor activates glycoprotein (GP) IIbIIIa integrin via a phosphoinositide 3- (PI 3-) kinase pathway8 and/or another, unidentified G protein.9 P2Y12 thus appears to have a pivotal role in the irreversible wave of platelet aggregation that occurs on exposure to ADP.
The importance of P2Y12 is emphasized by the fact that it is the target of the thienopyridine drugs ticlopidine and clopidogrel.3,10 The P2Y12 gene, which encodes the 342-amino-acid receptor, was recently identified.3,4,11 Four patients have been described whose platelets, when exposed to ADP, undergo little, if any, reversible aggregation and show a decrease in the normal adenylate cyclase inhibition of prostaglandin E1 (PGE1)-stimulated platelets.12,13 In one patient, this
phenotype was associated with a P2Y12 gene abnormality.3
Considerable inter-individual variations in the concentration of ADP required to produce
irreversible aggregation have been reported.14 As inherited factors have a major role in platelet aggregation,15 we looked for sequence variations in the P2Y12 gene that might explain the inter- individual variability of platelet aggregation responses to ADP.
Methods
Subjects
Ninety-eight unrelated healthy Caucasian male volunteers aged from 18 to 35 years were recruited
and
investigated in the Clinical Investigation Center of Hôpital Européen Georges Pompidou. The volunteers were non smokers and denied taking any medication for at least 10 days before blood collection. Exclusion criteria were personal or family history of excessive bleeding or thrombosis. A physical examination and routine laboratory tests, including white blood cell, red blood cell and platelet counts, mean platelet volume, prothrombin time (PT), activated partial thromboplastin time (aPTT), plasma fibrinogen and C-reactive protein assays were performed before inclusion. Blood obtained from all the volunteers on day 0 (visit 1) and day 7 (visit 2) was subjected to aggregation tests. A third blood sample was obtained from a subset of 20 volunteers for platelet cAMP assay and comparison of maximal aggregation in citrated and in hirudin-anticoagulated platelet-rich plasma (PRP). All the subjects gave their written informed consent, and the study protocol was approved by the local ethics committee.Sample preparation
Venous blood was collected between 8:00 and 10:00 am, after an overnight fast, in tubes containing either 0.105 M sodium citrate (1 vol/9 vol) (BD Vacutainer®, Becton Dickinson, Le Pont de Claix, France) or 50 µg/mL lepirudine (Refludan®, Hoechst, Paris, France) using a 19- gauge needle and no tourniquet. The first 2 ml of blood was discarded. Platelet-rich plasma (PRP) was obtained by centrifugation at 150 g for 10 min at room temperature. Autologous platelet-poor plasma, obtained by further centrifugation at 2300 g for 15 min, was used to adjust the platelet count of PRP to 250 x 109/L.
Platelet aggregation studies
Aggregation studies were performed within 2 hours after blood collection. Aggregation was measured at 37oC by using a photometric method on a four-channel aggregometer (Regulest® Amneville, France). A 280-µL aliquot of PRP was incubated for 3 min at 37oC and then was stirred at 1100 rpm for 2 min before adding 20 µL of saline or ADP (Sigma-Aldrich, St Quentin Fallavier, France) at 1, 2 or 5 µM (final concentration). The platelet aggregation response was recorded for 5 min.
CAMP measurement
Platelet cAMP content was measured by incubating 270 µL of PRP with 10 µL of a solution of the stable prostacyclin analog iloprost (20 µg/L, final concentration) (Ilomédine®, Schering- Plough) for 1 min, with stirring, then adding 20 µL of saline or ADP (1, 2 or 5 µM). The reaction was stopped 3 min later by adding 20 µL of 12% trichloroacetic acid. CAMP was then extracted and measured with an enzyme immunoassay (EIA) (Amersham, Pharmacia Biotech, Orsay, France) according to the manufacturer’s instructions, without knowledge of the subject’s P2Y12
genotype.
Genotyping studies
Genomic DNA was isolated from peripheral blood mononuclear cells by using the Qiamp Maxi Kit® (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions.
P2Y12 receptor. We took advantage of the cDNA sequence reported by Hollopeter et al3, which is available under GenBank accession number AF313449. Assuming that P2Y12 gene organization was the same as that of other seven transmembrane-domain receptor genes, most of which comprise two exons separated by a single intron, we performed a preliminary amplification experiment using two oligonucleotides, designated E and J, as sense and antisense primers;
they were located at the 5’ and 3’ ends of the reported cDNA (figure 1). The amplification
product was then purified with the Pre-Sequencing Kit (Amersham Pharmacia Biotech).
Purification was followed by a cycle sequencing reaction using primers E, B and J. Subsequent sequencing using several other primers (G, H, K and L) (figure 1) allowed us to determine the nucleotide sequence of the amplification product. Sequence analysis was performed with an ABI Prism 3700 (Applera).
Screening of 40 subjects in a population is sufficient to identify polymorphisms with a frequency of 5% or more, with a confidence interval (CI) of 95%. Thus, a series of the first 48 consecutive healthy volunteers were screened for P2Y12 gene polymorphisms by sequencing the 58 nt of exon 1 with primer K, the 947 nt of its 3’ flanking region with primers E and G, the 1274 nt of exon 2 with primers L, C and M, and the 570 nt of its 5’ flanking region with primer H. The primers are described in figure 1 and the flanking regions of the exons in figure 2. The P2Y12
gene was then sequenced in the other 50 subjects by using primers targeting the identified polymorphisms, i.e. primer E for the i-C139T, primer G for the i-T745C and i-ins802A, and primer L for the C34T and G52T.
GPIIbIIIa: we used restriction fragment length polymorphism analysis to detect the substitution of cytosine for thymidine at position 1565 in exon 2 of the glycoprotein IIIa gene, that is responsible for the PlA2 polymorphism.16
PCR and sequencing results were analyzed without knowledge of the platelet aggregation results. Genotyping was repeated in ambiguous cases. All 98 subjects were successfully genotyped.
Platelet RNA extraction and reverse transcription
Four milliliters of PRP (109 platelets) was pelleted by centrifugation for 15 min at 2300 g. RNA was extracted with the RNeasy® kit (Qiagen) according to the manufacturer’s instructions.
Reverse transcription was performed using 10 units of RNasinTM ribonuclease inhibitor
(Promega, Charbonnières, France), 100 units of Superscript II Rnase H- reverse transcriptase
(Invitrogen) and 1.5 mM random hexanucleotides (Amersham Pharmacia biotech). The cDNA was stored at -20oC.
Statistical analysis
Data are shown as means SEM, except for skewed variables, which are expressed as medians. Individual subjects' values obtained at visits 1 and 2 were compared using a concordance test.17 The X2 test was used to compare the observed allele and genotype frequencies with the Hardy-Weinberg equilibrium prediction. Trends across genotype groups were tested using the non parametric Kruskall-Wallis test. Two-way ANOVA was used to compare cAMP values and maximal aggregation between genotype groups according to ADP concentrations. The association between the genotype and the maximal platelet aggregation response to ADP was tested, after adjustment for other variables, by using multivariate logistic regression models in which maximal aggregation < 50% was coded 0 and maximal aggregation
> 50% was coded 1. Considering the small number of subjects homozygous for the mutated allele (<7), whatever the polymorphism, these subjects were pooled together with heterozygotes for regression analysis.
Statistical tests were performed using the STATA 7.0 software package (Stata Corp, College Station, TX), and differences with P values <0.05 were considered statistically significant.
Results
To assess the variability of ADP-induced platelet aggregation, we tested two samples from each of 98 healthy volunteers, obtained one week apart. Figure 3 compares the maximal aggregation responses to 2 µM ADP in citrated PRP at the two visits. At least two phenotypic groups were identified. Maximal aggregation was below 50% at both visits in 47 subjects (48.0%). Moreover, 43 (91.5%) of the subjects in this subgroup had aggregation profiles consistent with a reversible primary phase. Conversely, maximal aggregation was above 50% at both visits in 29 subjects (29.6%), and 28 (96.5%) of these subjects had an irreversible second phase of ADP-induced aggregation. As maximal aggregation was stable between the two visits (r2=77%, P<0.001), we used the mean value for each subject (referred to below as maximal aggregation) for
subsequent analyses.
The existence of these two distinct phenotypic groups of platelet aggregation, together with the stability of ADP responses over time, pointed to possible genetic control of the ADP effect on platelet aggregation. Thus, we analyzed the P2Y12 gene in the study population and found that it contained at least two exons separated by one intron approximately 1700 bp in length, located upstream of the ATG codon (figure 1). Exon 2 encodes the entire 342-amino-acid protein.
Because of a 6-nucleotide (nt) repeat sequence (table 1), the exact 3’ end of exon 1 and 5’ start site of exon 2 could not be determined. Table 1 describes three possible sequence patterns. We arbitrarily chose pattern 1 to number the polymorphisms described below.
We found four SNPs and a single nucleotide insertion polymorphism (Table 2). Two variations were located 139 nt and 745 nt after the 5’ intron start site, consisting of a C to T (i-C139T) and a T to C (i-T745C) transition, respectively. Another polymorphism consisted of a single
nucleotide insertion (A) at position 802 of the intron (i-ins802A). The remaining two
polymorphisms were found in exon 2, and consisted of a C to T transition (C34T) and a G to T transversion (G52T), respectively 34 nt and 52 nt after the 5’ start site of exon 2 (figure 2), neither modified the encoded amino acid (Asn6 and Gly12, respectively).
As the i-C139T, i-T745C, i-ins802A and G52T polymorphisms were in complete linkage
disequilibrium in our population, we designated "H1" the major haplotype (a C in position 139, a T in position 745, and absence of the i-ins802A in the intron, and a G in position 52 of exon 2) and "H2" the minor haplotype (a T in position 139, a C in position 745, presence of the i-ins802A in the intron, and a T in position 52 of exon 2). The respective frequencies of haplotypes H1 and H2 were 86% and 14%. The allele frequencies of all the polymorphisms were in Hardy-Weinberg equilibrium.
The H2 haplotype was associated with higher maximal aggregation in response to ADP, with median values of 34.7% in subjects carrying none of the H2 alleles (H1/H1, n=74), 67.9% in subjects carrying one H2allele (H1/H2, n=21), and 82.4% in the three subjects carrying two H2 alleles (H2/H2) (Figure 4, P=0.0071). Two of the subjects who were homozygous for the H2 haplotype had values of 82 and 86%, while the third subject had a value of only 27%.
Multivariate logistic regression analysis indicated that the odds ratio (OR) of this association (OR 3.3, 95% CI: 1.1–10.4) did not change substantially after adjustment for age, body mass index, platelet count, mean platelet volume, white blood cell count, fibrinogen, PT, aPTT and the PlA1/PlA2 genotype. The C34T polymorphism was not associated with maximal aggregation in response to ADP.
To investigate the association of the H2 haplotype and a possible splice variant of the intron located between exon 1 and 2, we amplified and sequenced P2Y12 cDNA obtained by reverse transcription of platelet mRNA from volunteers with the H1/H1 (n=3), H1/H2 (n=3) and H2/H2 (n=3) genotypes. Nucleotide sequencing revealed no variations, whatever the haplotype.
Moreover, the sequence profile was consistent with amplification of both alleles in H1/H2 subjects, suggesting that both mRNA variants are transcribed (data not shown).
To further study the association between the H2 haplotype and ADP-stimulated platelet aggregation, we randomly selected 10 carriers and 10 non carriers of the H2 haplotype. As ADP-induced platelet aggregation is considered to be dependent on the extracellular Ca++
concentration,18 we measured maximal aggregation to 1, 2 and 5 µM ADP in medium containing a low Ca++ concentration (citrate-anticoagulated PRP) and in medium containing a physiological Ca++ concentration (hirudin-anticoagulated PRP). Carriers of the H2 allele had an increased maximal platelet aggregation to ADP when compared to non carriers in citrated PRP (P=0.027, figure 5A). However, in hirudin-anticoagulated PRP, maximal aggregation did not reach
significance, although following the same trend (P=0.061, figure 5B). This is probably due either to the small number of subjects in each group, and/or to the lack of sensitiveness to reveal a difference in this medium in terms of aggregation.
To identify a possible link between the H2 haplotype and P2Y12 regulation of adenylate cyclase, we determined the capacity of ADP to inhibit iloprost-stimulated cAMP accumulation in platelets from the same 20 subjects. In citrated blood, ADP inhibited cAMP formation in platelets from non carriers in a concentration-dependent manner, with 13%, 31% and 37% inhibition at 1, 2 and 5 µM ADP, respectively, compared to 31%, 39% and 50%, respectively, in carriers of the H2 haplotype (P=0.028, figure 6A). Similar results were found when platelets were obtained from hirudin-anticoagulated PRP (P=0.01, figure 6B).
Discussion
We identified three single-nucleotide polymorphisms (SNP) and a nucleotide insertion in the P2Y12 receptor gene, which determined two haplotypes designated H1 and H2. The H2
haplotype was associated with increased maximal platelet aggregation in response to ADP. This was related to differences in the mechanism regulating cAMP inhibition by ADP.
It has been shown in a large population study that ADP-induced platelet responses exhibit considerable variability as regards the ADP concentration required to produce a biphasic response with > 50% aggregation.14 In our study, ADP-induced aggregation in the 98 healthy volunteers was stable between two measurements one-week apart, i.e. after renewal of most platelets. These results pointed to genetic control of ADP-induced platelet aggregation.
To further study the difference in the aggregation response to ADP between carriers and non carriers of the H2 haplotype, we examined adenylate cyclase inhibition of iloprost-stimulated platelets and found a correlation between the H2 haplotype and the reduction in the intracellular cAMP concentration by ADP.
Data obtained with specific P2Y12 receptor inhibitors such as the thienopyridines ticlopidine and clopidogrel confirm that P2Y12 is the only known platelet ADP receptor responsible for adenylate cyclase inhibition and the subsequent reduction in intracellular cAMP.19 Moreover, selective P2Y1 receptor antagonists have no effect on ADP-induced adenylate cyclase inhibition.2 Thus, the difference in the platelet cAMP concentration between carriers and non carriers of the H2 haplotype after ADP stimulation may be involved in maximal ADP-induced aggregation observed in these two groups of subjects.
One of the three H2/H2 subjects had a maximal aggregation value of only 27%, and a reversible aggregation profile. P2Y12 gene sequence and platelet function of this subject was studied a third time, 11 months after visit 2. Similarly to visits 1 and 2, platelet aggregation to ADP 2 M was 37% with a reversible aggregation profile. However, bleeding time was normal (7 min) as well as platelet response to arachidonic acid and collagen. The capacity of ADP to inhibit iloprost-
stimulated cAMP accumulation in platelets was found in the same range of the one showed by carriers of the H2 allele and argues for a selective impairment of the ADP pathway. However, sequencing of exon 1 and exon 2 of P2Y12 gene in this subject ruled out a loss of function mutation. Possible explanations of the poor ADP response in this H2/H2 subject include a defect in the P2Y1 receptor, which is necessary for full ADP responsiveness,5 and a defect in the GPIIbIIIa activation cascade mediated by ADP.8
The molecular mechanism by which the H2 haplotype increases platelet aggregation in response to ADP remains to be determined. As the complete coding sequence of the P2Y12
gene was screened in our study population, an amino acid substitution affecting the protein structure can be ruled out. Moreover, cDNA analysis of both haplotypes showed normal sequences at the exon 1-exon 2 junction, ruling out a splice variant. Thus, an increase in the number of receptors on the platelet surface is most likely to explain the association between the H2 haplotype and platelet responsiveness to ADP. Polymorphisms in intronic and exonic
enhancer regions, that augment transcription efficiency and the quantity of protein synthesized, have been described in other genes.20-22 On the other hand, the H2 haplotype could be linked to a sequence variation in the promoter region, that could increase transcription efficiency. Studies of the regulatory regions of the P2Y12 gene are required to confirm the existence of such a mechanism.
Considerable evidence suggests that the P2Y12 receptor plays a central role in the formation of hemostatic plugs and in the occurrence of arterial thrombosis.23,24 The key role of P2Y12 in arterial thrombosis is confirmed by the beneficial effect of the antithrombotic drugs clopidogrel and ticlopidine in a variety of thrombotic diseases such as stroke, myocardial infarction and peripheral vascular disease.10,25 Our identification of a P2Y12 receptor haplotype that is strongly associated with increased ADP-induced platelet aggregation may have important clinical implications, particularly in screening for subjects at risk of atherothrombosis and suboptimal responses to thienopyridine therapy.
Acknowledgments
We thank Alvine Bissery for her help with the statistical analysis, and the nursing staff of the Clinical Investigation Center 9201-Inserm AP-HP of Hôpital Européen Georges Pompidou. We also thank Philippe Coudol from the Genetics Department of Hôpital Européen Georges Pompidou for his help with sequencing.
References
1. Storey RF, Sanderson HM, White AE, et al. The central role of the P(2T) receptor in amplification of human platelet activation, aggregation, secretion and procoagulant activity. Br J Haematol. 2000;110:925-934.
2. Jin J, Daniel JL, Kunapuli SP. Molecular basis for ADP-induced platelet activation. II. The P2Y1 receptor mediates ADP-induced intracellular calcium mobilization and shape change in platelets. J Biol Chem. 1998;273:2030-2034.
3. Hollopeter G, Jantzen HM, Vincent D, et al. Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature. 2001;409:202-207.
4. Foster CJ, Prosser DM, Agans JM, et al. Molecular identification and characterization of the platelet ADP receptor targeted by thienopyridine antithrombotic drugs. J Clin Invest.
2001;107:1591-1598.
5. Jin J, Kunapuli SP. Coactivation of two different G protein-coupled receptors is essential for ADP-induced platelet aggregation. Proc Natl Acad Sci U S A. 1998;95:8070-4.
6. Hechler B, Leon C, Vial C, et al. The P2Y1 receptor is necessary for adenosine 5'- diphosphate-induced platelet aggregation. Blood. 1998;92:152-159.
7. Hechler B, Eckly A, Ohlmann P, et al. The P2Y1 receptor, necessary but not sufficient to support full ADP-induced platelet aggregation, is not the target of the drug clopidogrel. Br J Haematol. 1998;103:858-866.
8. Kauffenstein G, Bergmeier W, Eckly A, et al. The P2Y(12) receptor induces platelet aggregation through weak activation of the alpha(IIb)beta(3) integrin--a phosphoinositide 3-kinase-dependent mechanism. FEBS Lett. 2001;505:281-290.
9. Daniel JL, Dangelmaier C, Jin J, et al. Role of intracellular signaling events in ADP- induced platelet aggregation. Thromb Haemost. 1999;82:1322-1326.
10. Quinn MJ, Fitzgerald DJ. Ticlopidine and clopidogrel. Circulation. 1999;100:1667-1672.
11. Zhang FL, Luo L, Gustafson E, et al. ADP is the cognate ligand for the orphan G protein- coupled receptor SP1999. J Biol Chem. 2001;276:8608-8615.
12. Nurden P, Savi P, Heilmann E, et al. An inherited bleeding disorder linked to a defective interaction between ADP and its receptor on platelets. Its influence on glycoprotein IIb- IIIa complex function. J Clin Invest. 1995;95:1612-1622.
13. Cattaneo M, Lecchi A, Randi AM, et al. Identification of a new congenital defect of platelet function characterized by severe impairment of platelet responses to adenosine diphosphate. Blood. 1992;80:2787-2796.
14. Feng D, Lindpaintner K, Larson MG, et al. Increased platelet aggregability associated with platelet GPIIIa PlA2 polymorphism: the Framingham Offspring Study. Arterioscler Thromb Vasc Biol. 1999;19:1142-1147.
15. O'Donnell CJ, Larson MG, Feng D, et al. Genetic and environmental contributions to platelet aggregation: the Framingham heart study. Circulation. 2001;103:3051-3056.
16. Lasne D, Krenn M, Pingault V, et al. Interdonor variability of platelet response to thrombin receptor activation: influence of PlA2 polymorphism. Br J Haematol. 1997;99:801-807.
17. Lin LI. A concordance correlation coefficient to evaluate reproducibility. Biometrics.
1989;45:255-268.
18. Packham MA, Kinlough-Rathbone RL, Mustard JF. Thromboxane A2 causes feedback amplification involving extensive thromboxane A2 formation on close contact of human platelets in media with a low concentration of ionized calcium. Blood. 1987;70:647-651.
19. Geiger J, Brich J, Honig-Liedl P, et al. Specific impairment of human platelet P2Y(AC) ADP receptor-mediated signaling by the antiplatelet drug clopidogrel. Arterioscler Thromb Vasc Biol. 1999;19:2007-2011.
20. Scohy S, Gabant P, Szpirer C, et al. Identification of an enhancer and an alternative promoter in the first intron of the alpha-fetoprotein gene. Nucleic Acids Res.
2000;28:3743-3751.
21. Galvagni F, Oliviero S. Utrophin transcription is activated by an intronic enhancer. J Biol Chem. 2000;275:3168-3172.
22. Watakabe A, Tanaka K, Shimura Y. The role of exon sequences in splice site selection.
Genes Dev. 1993;7:407-418.
23. Mills DC. ADP receptors on platelets. Thromb Haemost. 1996;76:835-856.
24. Cattaneo M, Gachet C. ADP receptors and clinical bleeding disorders. Arterioscler Thromb Vasc Biol. 1999;19:2281-2285.
25. A randomised, blinded, trial of clopidogrel versus aspirin in patients at risk of ischaemic events (CAPRIE). CAPRIE Steering Committee. Lancet. 1996;348:1329-1339.
Figure legends
Figure 1. Location of the primers and polymorphisms in the P2Y12 gene.
A PCR product of approximately 3100 bp was obtained with primers E and J. Subsequent sequencing analysis was performed using primers B: 5’TCATGCCAGACTAGACCGAA3’, C:
5’ATCGATCGCTACCAGAAGACCACC3’, E: 5’GGCTGCAATAACTACTACTT3’, F:
5’AATTCCTTTCTGTCCTTAATT3’, G: 5’TAAATAGGTGAGGAGATGCTG3’, H:
5’TGCATTTCTTGTTGGTTACCT3’, J:5’GTCGTTTGTTTTGCTGCTAATA3’, K:
5’CATTGAGAATTTCAGCTCCC3’, L: 5’ATACTAACTACTACAATGAAGAT3’ and M:
5’CCTTACACCCTGAGCCAAAC3’. ATG and TAA are start and stop codons, respectively. I- C139T, i-T745C, i-ins802A, C34T and G52T are the polymorphisms found in the study population.
Figure 2. Screened P2Y12 nucleotide sequence.
Section 1 describes exon 1 and its 5’ flanking region and section 2 describes exon 2 and its 5’
flanking region. Exon sequences are capitalized.
Figure 3. Maximal platelet aggregation responses to ADP in 98 healthy volunteers.
After a 3-min incubation period, platelets (250 x 109/L in citrated PRP) were stimulated with 2 µM ADP. The concordance coefficient between aggregation values recorded at visit 1 and visit 2 (one week later) was 77% (P<0.001).
Figure 4. Maximal aggregation in response to 2 µM ADP according to the P2Y12 haplotype.
The average of the maximal aggregation values recorded at visits 1 and 2 in each volunteer was used for analysis. The median value was 34.7% in subjects carrying no H2 alleles (H1/H1, n = 74), 67.9% in subjects carrying one H2allele (H1/H2, n = 21) and 82.4% in the three subjects carrying two H2 alleles (H2/H2) (P=0.0071).
Figure 5. Maximal aggregation to ADP 1, 2 and 5 M in 10 carriers and 10 non-carriers of the H2 allele. A: citrate-anticoagulated PRP, B: hirudin-anticoagulated PRP.
Triangles and circles denote carriers and non carriers of the H2 haplotype, respectively. Means
SEM.
Figure 6. Inhibition of iloprost-induced cAMP formation by ADP in carriers and non carriers of the H2 haplotype. A: citrate-anticoagulated PRP, B: hirudin-anticoagulated PRP.
Iloprost (20 µg/µL final concentration) was added to citrated PRP 1 min after incubation at 37oC.
Saline (control) or ADP at 1, 2 or 5 µM was added 1 min later. The reaction was stopped 3 min later and the cAMP concentration was determined using a commercial assay kit. Triangles and circles denote carriers and non carriers of the H2 haplotype, respectively. Means SEM.
Tables.
TABLE 1.
Possible nucleotide sequence patterns describing the exact 3’ end of exon 1 and the 5’
start site of exon 2. The repeat sequence is underlined. We arbitrarily chose pattern 1 for nucleotide numbering.
Pattern Exon 1 and 3’flanking region Exon 2 and 5’flanking region 1 …ACAGTTATCaggtaatgttattt… …tgttctctAGGTAACCAACAAG…
2 …ACAGTTATCAGGTAAtgttattt… …tgttctctaggtaaCCAACAAG…
3 …ACAGTTATCAG gtaatgttattt… …tgttctctagGTAACCAACAAG…
TABLE 2.
Description of the polymorphisms detected in the study population. The H1/H2 haplotype is defined by the i-C139T, i-T745C, i-ins802A and G52T polymorphisms.
Name of SNP amino acid Region Allele frequency
i-C139T - Intron C: 86.2% T: 13.8%
i-T745C - Intron T: 86.2% C: 13.8%
i-ins802A - Intron Insertion of an A: 13.8%
G52T G / G Exon 2 G: 86.2% T: 13.8%
C34T N / N Exon 2 C: 72.5% T: 27.5%
Figure 1.
G
ATG
Exon 2
E K L H C B M J
Exon 1
TAA C34T G52T
i-T745C i-C139T
i-ins802A
Figure 2.
Section 1 :
-50 TAACTACTAC TTACTGGATA CATTCAAACC CTCCAGAATC AACAGTTATC aggtaatgtt atttctacaa 31 gtacttgaca aatatatgta tttacactct gatatgtgtg tacatttttt ccaagtttct cttaaaattg 91 taaaccttaa taactatcaa tgcaagcatg tatttggaat aaaaatta(c/t)a attaaaatag aagtctaatt 161 agtgatgtca gagacaattg ttaattagcc tctttattaa gaaaaattat acaaagcata gaaataaaat 231 ataaatggtc ttagttactt tgcctcaagt ataaaatgag atttaaatac agataaaggg agctgaaatt 301 ctcaatgtca agaatacttg ttaaatatct tacagactac acaaaatgta tattcactaa gtcgaatttc 371 caaaacggtc agggatgaac taagaccaca cagcagtagc aggaaaggtt aaaatcagtg atcttgtatt 441 ggaaaacatt aggttttgtt tagcattatt ttaaagcgct aaataggtga ggagatgctg aaaattgaag 511 ccatactgtg acaacatgat tcttaatcgt tttccttcca taattaagga cagaaaggaa ttccatggac 581 attttgggga atttaagtgc tacattcatt tatctaaata tcttttacac gaaagttatt ttttaaaatt 651 tgttatttgt acctttcaat atatctctga ttattaagaa tattttatat agaatcaatt tcacttatct 721 ctggtgaaat aaaaagatta caaa(t/c)gtcat ttcaaattcc caagatgtag atgccatata gcatattcaa 791 gtcacttgtt a(ins-a)gttttcat tatagctgcc tattgtggta ataacctata ttttatttta gctaccatta 861 cacactccat aaatctggaa agtatgccct gttttgagga atgccaactc atgaccatat atacacaggc 931 catttctgac tcttattt…
Section 2 :
…actgattcag tattttattt aataagtttc ccaagagt aatttttcatca atttcttccc cctttttatt actttaggat tctaacaggc aattatccat catttctctc tcaactgttt tgacggtact acagtaaaag aagctcagaa ataaggacgt tggggggaaa agtgactgtg aatagaaacc aaaaagctaa aaggcatgga ggggaagcta gagaagagta aagcacagcc ccattatttc tcttccagct tttgcatata aatatgagtg agctctaaga caaaatgtgc tttaagaggc aaacattcaa caaataaaaa aatactaagc atctataact tcacatattg tacttcagat catttctctt cagcagagat gcaatatttg ctgcaatgaa atattttggg attcagtttt ctgtgttcat actaactact acaatgaaga tgagaaacct caacttttag aggaggctgt gtccaaaaaa gttacacaca gagataacag caataataac taccttaggc tgaaaataac catcctctct -29 tttgttctct AGGTAACCAACAAGAAATGCAAGCCGTCGACAA(C/T)CTCACCTCTGCGCCTG 31 G(G/T)AACACCAG TCTGTGCACC AGAGACTACA AAATCACCCA GGTCCTCTTC CCACTGCTCT 91 ACACTGTCCT GTTTTTTGTT…
Figure 3.
50
0 100
100 50
Maximal aggregation response at visit 1 (%)
Maximal aggregation response at visit 2 (%)
Figure 4.
0 50 100
H2/H2 H1/H2
H1/H1
Mean maximal aggregation (%)
n = 74 n = 21 n = 3
Figure 5.
A:
B:
25 10
20 30 40 50 60 80 70
Maximal aggregation (%)
10 20 30
Control 1 2 5
40 50 60 80 Maximal aggregation (%) 70
Figure 6.
A:
B:
40 50 60 70 80 90 100
% o f co ntr ol
ADP concentration (µM)
Control 1 2 5
40 50 60 70 80 90 100
% o f co ntr ol
