• Aucun résultat trouvé

The 33 kDa Protein of the Oxygen-Evolving Complex: a Multi-Gene Family in Tomato

N/A
N/A
Protected

Academic year: 2021

Partager "The 33 kDa Protein of the Oxygen-Evolving Complex: a Multi-Gene Family in Tomato"

Copied!
6
0
0

Texte intégral

(1)

JSPP © 1993

Short Communication

The 33 kDa Protein of the Oxygen-Evolving Complex: a Multi-Gene Family

in Tomato

Jorn Gdrlach, Jiirg Schmid' and Nikolaus Amrhein

Institute of Plant Sciences, Swiss Federal Institute of Technology, Sonneggstrasse 5, CH-8092 Zurich, Switzerland

A cDNA was isolated by chance from tomato which had a high similarity to a cDNA clone from potato known to code for the 33 kDa protein of the oxygen-evolving complex [van Spanje et al. (1991) Plant Mol. Biol. 17: 157]. The sequence of a previously described partial cDNA clone from tomato [Ko et al. (1990) Plant Mol. Biol. 14: 217] which has also a high similarity but is not identical to the sequence described here indicates that tomato contains at least two genes coding for 33 kDa proteins per haploid genome. This conclusion is supported by Southern blot analysis. The tissue specific expression of the corresponding genes is described.

Key words: Multi-gene family — Oxygen-evolving complex — Photosynthesis — Tomato (Lycopersicon esculentum L.).

In plants, oxygen is evolved at the inner face of the thy-lakoid membrane in the so-called OEC, which is part of PSII. Three extrinsic luminal membrane proteins, the so called 33 kDa, 23 kDa and 16 kDa proteins, are involved in the manganese-dependent water splitting reaction (Anders-son et al. 1984). The detailed structure of the OEC and the molecular mechanism of the reaction are not yet known (Babcock et al. 1989, Rutherford 1989). The 23 kDa and 16 kDa proteins function in the stabilization and regulation of the complex. The 33 kDa protein seems to be a constitu-ent of the Mn-cluster and is directly involved in O2 -genera-tion. The 33 kDa proteins from plants show high structural and functional homologies to the 33 kDa manganese-stabilizing polypeptide of the PSII from cyanobacteria (Koike and Inoue 1985). This 33 kDa protein is one of four well characterized proteins of the thylakoid lumen. Like plastocyanin and the other extrinsic components of the OEC, the 33 kDa protein is a nuclear-encoded protein (Westhoff et al. 1985, Jansen et al. 1987). The higher molec-ular weight precursors are synthesized in the cytosol and processed to the mature form by proteolytic cleavage while Abbreviations: bp, base pair; OEC, oxygen-evolving com-plex; PCR, polymerase chain reaction; pfu, plaque forming units; RT, room temperature.

1 Author to whom all correspondence should be addressed. 2 EMBL Accession NO: Z11999.

traversing three membranes. This processing is a two step mechanism, which is mediated by N-terminal two-domain transit peptides (Hageman et al. 1986, Smeekens et al. 1986, James et al. 1989). A thylakoidal processing pep-tidase has been characterized (Kirwin et al. 1988, Shackle-ton and Robinson 1991). Here we present the nucleotide se-quence of a tomato cDNA which codes for a precursor of the 33 kDa protein (Fig. 1A).

The basic molecular techniques were carried out ac-cording to Sambrook et al. (1989) or Ausubel et al. (1987). A tomato cDNA library in the expression vector Uni-ZAP™ XR (Schmid et al. 1992) was screened. Positive clones were plaque purified and the cDNA inserts sub-cloned into the vektor pSK(+). The sequences of both strands were determined. Recombinant pBluescript cDNA phagemids were excised in vivo from the AZAP vector by in-fecting E. coli XL 1 -Blue with 200 fi\ of the amplified library (106pfu) and helper phage R408 according to the pro-cedure provided by Stratagene. After incubating E. coli XL 1-Blue cells with the rescued phagemids, ampicillin re-sistant bacterial colonies were selected on LB-plates. The colonies (3 x 105) were washed off the plates and plasmid DNA was isolated. This pool was used as template for an-chored PCR. The primers used for the PCR were the com-mercially available T3 primer (17mer, Stratagene) and a cDNA specific oligonucleotide (16mer, corresponding to position 230-245 in Fig. 1A). 150 ng plasmid DNA were 497

(2)

used in a 100/il reaction containing 5/iM primers, 200/iM Elmer Cetus). The mixture was overlaid with mineral oil dNTPs, 2 mM MgCl2, 1 * Stoffel-buffer and 10 units of the and subjected to 30 cycles of PCR amplification with a Stoffel-fragment of AmpliTaq DNA polymerase (Perkin- DNA thermal cycler (Perkin-Elmer Cetus) using 90°C/30 s

A 1 . . . . . . . . . . . 1 2 0 M A A S L Q A A A T L M Q P T K V G V R N N L Q L R S A Q S V S 1 1 0 2 0 3 0 1 2 1 . . . . . . . . . . . 2 4 0 K A F G V E Q G S C R L T C S L Q T E I K E L A Q K C T D A A K I A G F A L A T 40 5 0 6 0 7 0 241 . . . . . . . . . . . 3 6 0 TCTGCCCTCGTCGTCTCGGGAGCAAATGCGCAAGGAGTTCCAAAACGTITAACCTATGA S A L V V S G A N A E G V P K R L T Y D E I Q S K T Y M E V K G T G T A N Q C P 80 • 9 0 1 0 0 1 1 0 3 6 1 . . . . . . . . . . . 4 8 0 T I E G G V G S F A F K P G K Y T A K K F C L E P T S F T V K A E G V S K N S A 120 1 3 0 1 4 0 150 4 81 . . . • . . . 600 P D F Q K T K L M T R L T Y T L D E I E G P F E V S P D G T V K F E E K D G I D 160 170 180 190 601 . . . 720 TATGCTGCTGTTACAGTTCAGCTTCCTGGTGCTGAGCGTGTGCCCTrcCTCTTCACTATC Y A A V T V Q L P G G E R V P F L F T I K Q L V A S G K P E S F S G E F L V P S 200 2 1 0 2 2 0 2 3 0 7 2 1 . . . . . . . . . . . 8 4 0 Y R G S S F L D P K G R G G S T G Y D N A V A L P A G G R G D E E E L Q K E N V K N T A S L T G K I T L S V T Q S K P E T G E V I G V F E S I Q P S D T D L G A 280 290 300 310 961 . . . 1080 AAGGTTCCCAAGGATGTCAAAATCCAGGGTATCTGGTATGCCCAACrTCAATGATGGAGAGTT^ K V P K D V K I Q G I W Y A Q L E * 3 2 0 3 2 9 1 0 8 1 . . . . . . . . . 1 1 7 5 ATTCTGTGACCCAATTTGGACAAGCACTGAAACAACTATCTTGCTGIAIMTATC^ (A) n B 11 111 MI 111 ii 11111111 11111111 11111111111 I I 11111111111111111111111 ii 111 in 11111111 11111111 i 11111111111111111 1111111 11 11 11 111 i i I I i i II 8 1 TAAGGATGTAAAAATCC AGGGTATCTGGTATGCCCAGCTTGAATCATAQACAGATCTTAGACTTTGTGGATCATTTCTTCGTTTTTGATT 17 0 I I I I I I I I I I I I I I I I I I I I I 1 7 1 TTGTTATAAGTTACTACAAGGTTTCAACTTTCTATGACCCAATTGGATAAGTAATAGAACAACTATCTCCTGTATATATCAAGTATAAGT 26 0 114 9 ATTTCATGCTGGTAGCCAGTTATAAAC(A)n 1175 II I I 2 61 AATAATCCATTACAT(A)n 275 2 8 5 S V T Q S K P E T G E V I G V F E S I Q P S O T D L G A K V P K D V K I Q G I W Y A Q L E ' 3 2 9 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I l SNPQTGEVIGWESIQPSOTDLGAKTPKDVKIQGIWYAQL.ES* 42

Fig. 1 Tomato 33 kDa protein sequences. A. Nucleotide sequence and deduced amino acid sequence of the tomato 33 kDa protein cDNA. The terminal processing site of the transit peptide is indicated by (±)> potential polyadenylation sites are underlined. B. parison of the cDNA sequence (upper line) with a cDNA fragment isolated by Ko et al. (1990). Stop-codons are highlighted. C. Com-parison of the amino acid sequences deduced from the nucleotide sequences in B.

(3)

for denaturation, 64°C/60 s for annealing as well as for primer extension. The resulting products were separated on a 1% low melting agarose gel and DNA fragments of the expected size were isolated, subcloned and sequenced. Poly(A)+-RNA (2//g) from different tomato tissues were separated on 1.2% formaldehyde agarose gel (Sambrook et al. 1989) and transferred to a nylon membrane (Hybond N, Amersham) which was processed according to the manufac-turer's instructions. Prehybridization and hybridization were in 50% formamide, 5 x SSC, 20 mM PIPES, pH 6.4, 200 m ml"1 denatured carrier DNA, 2 x Denhardt's solu-tion, 0.5% SDS (1 x SSC: 150 mM NaCl, 15 mM sodium citrate, pH 7.0; 1 x Denhardt's: 0.02% of each Ficoll 400, bovine serum albumin and polyvinylpyrrolidone) at 42° C. The 33 kDa protein cDNA was used as radiolabeled probe (Feinberg and Vogelstein 1983). The filter was washed twice for a few minutes in 0.3 x SSC, 0.5% SDS at RT, three times for 30 minutes in the same buffer at 60° C and

H B Ori — 23.1 —. 9.4 — 6.6 — 4.4 — 2.3 — 2.0 —

once for a few minutes in 0.3 x SSC at RT and then expos-ed to Hyperfilm-MP (Amersham) at — 80°C with intensify-ing screen. Genomic tomato DNA was isolated from cotyle-dons as described (Murray and Thompson 1980), digested with restriction enzymes and subjected to electrophoresis in a 0.8% agarose gel. Processing of the gel and blotting of the DNA to a Zeta-Probe membrane (BioRad) were done according to the manufacturer's instructions. Prehybridiza-tion and hybridizaPrehybridiza-tion condiPrehybridiza-tions were 0.5 M sodium phos-phate, pH 7.2, 7% SDS and 1 mM EDTA at 55°C. The 33 kDa protein cDNA was used as radiolabeled probe (Feinberg and Vogelstein 1983). The membrane was wash-ed for 45 minutes in 40 mM sodium phosphate, 5% SDS, 1 mM EDTA at 57°C and again at 62°C, twice for a short time in 2 x SSC at RT. The autoradiography was perform-ed as outlinperform-ed above. The sequence comparisons were done with the program PILEUP and LINEUP (GCG package, University of Wisconsin). Similarity was calculated for a threshold =0.6.

Screening a tomato cDNA library for chorismate syn-thase clones, we isolated one clone which contained two cDNA inserts, one specific for chorismate synthase (J.G. and J.S., unpublished results). Based on sequence simi-larities with already known sequences the other cDNA was identified as one coding for a 33 kDa protein of the ox-ygen-evolving complex. This cDNA was incomplete at its 5-end and ended at position 37 in Fig. 1A. To extend the cDNA sequence anchored PCR was performed and the resulting PCR fragments were subcloned and sequenced. The sequence of one PCR fragment which was identical as

Ori _ 9.5 — 7.5 _ 4.4 — 2.4 _ 1.4 —

1 2 3

A

••>••% 0.6 —

Fig. 2 Southern blot analysis. High molecular weight

tomato DNA was digested with the restriction enzymes Hind III (lane H), BamH I (lane B), EcoR I (lane E) and Xba I (lane X) and subjected to Southern blot analysis using the 33 kDa protein cDNA as radiolabeled probe. Fragments of Hind III digested X-DNA were used as size marker (kb).

Fig. 3 Northern blot analysis. 2 fig poly(A)+-RNA from tomato leaves (lane 1), total flowers without sepals (lane 2), cotyle-dones (lane 3), stems (Jane 4), roots (lane 5) and tomato cells in sus-pension culture (lane 6) were subjected to Northern blot analysis using the 33 kDa protein cDNA as radiolabeled probe. RNAs of different length (BRL) were used as size marker (nucleotides

(4)

Species S. tuberosum S. oleracea P. saiivum A. thaliana T. aestivum C. reinhardlii Anabaena sp. Synechocystis sp. Synechococcus sp. %Identily 9 5 9 0 8 8 8 5 8 4 6 3 4 9 4 5 4 4 %Sirailarity 9 7 9 4 9 2 9 0 87 7 3 6 1 5 8 57 95(97) 92(92) 82(88) 75(84) 69(80) 53(66) 25(43) 66(72) 45(64) L. esculentum S. tuberosum S. oleracea P. sativum A. thaliana T. aestivum C. reinhardtii Anabaena sp. Synechocystis sp. Synechococcus sp.

Fig. 4 Comparison of the mature 33 kDa protein from different plants and the mature Mn-stabilizing peptides from cyanobacteria. A. Amino acid identity and similarity of tomato 33 kDa protein with other 33 kDa protein sequences and 33 kDa PSII extrinsic proteins from prokaryotes. Sequences compared were published by: S. tuberosum (van Spanje et al. 1991), 5. oleracea (Tyagi et al. 1987), P. sativum (Wales et al. 1989), A. thaliana (Ko et al. 1990), T. aestivum (Meadows et al. 1991), C. reinhardtii (Mayfield et al. 1989), Ana-baena sp. (Borthakur and Haselkorn 1989), Synechocystis sp. (Philbrick and Zilinskas 1988), Synechococcus sp. (Kuwabara et al. 1987). B. Relationship of the compared amino acid sequences. Distances are drawn to scale. Numbers give percentage of overall identity (similarity) for the organisms listed. Calculations were done as in A.

far as it overlapped with the already known sequence was used to complete the cDNA sequence2 shown in Fig. 1A. The first ATG of the sequence (Fig. 1A, bp position 25-27) resides within the open reading frame. The deduced amino acid sequence is almost identical to the primary structure of the precursor of the 33 kDa protein from potato (van Span-je et al. 1991). The N-terminal portion of the deduced amino acid sequence (Fig. 1A, amino acid position 1-82) resembles a transit peptide. It is known that for correct pro-cessing of the wheat precursor of the 33 kDa protein to the mature form, alanine residues are required at position — 3 and —1 with respect to the terminal cleavage site (Shackleton and Robinson 1991). The amino acid sequence GANAlEG (Fig. 1A, amino acid position 79-84) fulmlls this requirement and is almost identical to the cleavage site of the wheat precursor (GATA |EG). In the 3'-untrans-lated region of the 33 kDa protein cDNA, three potential polyadenylation signals (Joshi 1987) can be identified, suggesting differential polyadenylation of the primary transcription product. Similar heterogeneities have been observed for other plant genes (Schaller et al. 1991). So far isoforms of the 33 kDa protein have only been character-ized in pea (Wales et al. 1989). A comparison of the tomato 33 kDa cDNA with a cDNA fragment isolated by Ko et al. (1990) from tomato indicates the existence of isoforms of the 33 kDa protein in tomato (Fig. IB, 1C). The coding sequences of the two cDNA clones are similar, whereas the 3 -untranslated regions are unrelated to each other,

reminis-cent of many genes belonging to multi-gene families. This finding is further supported by a Southern blot analysis with chromosomal tomato DNA (Fig. 2). The rather com-plex pattern is a strong indication of a multi-gene family. The tissue specific expression of this gene family has been analyzed by Northern blots (Fig. 3). As expected for an en-zyme which is involved in photosynthesis and in agreement with results of other groups (Ko et al. 1990, van Spanje et al. 1991), the 33 kDa protein gene family is only expressed in photosynthetically active tissues like leaves, total flowers without sepals, cotyledons and stems, but not in roots and tomato cells grown in suspension. The comparison of the mature tomato 33 kDa protein to corresponding sequences of other plant species and to the 33 kDa manganese-stabiliz-ing polypeptide from cyanobacteria (Fig. 4) indicates the phylogenetic relationship of these organisms. The overall identity of all compared proteins is 25% (43% similarity). The 33 kDa proteins are well conserved between cyanobac-teria and photosynthetic eukaryotes, even though cyano-bacterial PSII does not contain peptides homologous to 23 kDa and 16 kDa proteins of higher plants.

References

Andersson, B., Larsson, C , Jansson, C , Ljungberg, U. and Akerlund, H.-E. (1984) Immunological studies on the organ-ization of proteins in photosynthetic oxygen evolution.

(5)

Bio-Mm. Biophys. Ada 766: 21-28.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1987) Current Pro-tocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York.

Babcock, G.T., Barry, B.A., Debus, R.J., Hoganson, C.W., Atamian, M., Mclntosh, L., Sithole, I. and Yocum, C.F. (1989) Water oxidation in photosystem II: from radical chemistry to multielectron chemistry. Biochemistry 28: 9557-9565.

Borthakur, D. and Haselkorn, R. (1989) Nucleotide sequence of the gene encoding the 33 kDa water oxidizing polypeptide in Anabaena sp. strain PCC 7120 and its expression in Escherichia coli. Plant Mol. Biol. 13: 427-439.

Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiola-beling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13.

Hageman, J., Robinson, C , Smeekens, S. and Weisbeek, P. (1986) A thylakoid processing protease is required for complete maturation of the lumen protein plastocyanin. Nature V2A: 567-569.

James, H.E., Bartling, D., Musgrove, J.E., Kirwin, P.M., Herrmann, R.G. and Robinson, C. (1989) Transport of pro-teins into chloroplasts. J. Biol. Chem. 264: 19573-19576. Jansen, T., Rother, C , Steppuhn, J., Reinke, H., Beyreuther, K.,

Jansson, C , Andersson, B. and Herrmann, R.G. (1987) Nucleo-tide sequence of cDNA clones encoding the complete '23 kDa' and '16 kDa' precursor proteins associated with the photosyn-thetic oxygen-evolving complex from spinach. FEBS Lett. 216: 234-240.

Joshi, C.P. (1987) Putative polyadenylation signals in nuclear genes of higher plants: a compilation and analysis. Nucl. Acids Res. 15: 9627-9640.

Kirwin, P.M., Elderfield, P.D., Williams, R.S. and Robinson, C. (1988) Transport of proteins into chloroplasts. J. Biol. Chem. 263: 18128-18132.

Ko, K., Granell, A., Bennett, J. and Cashmore, A.R. (1990) Isola-tion and characterizaIsola-tion of cDNAs from Lycopersicon esculen-tum and Arabidopsis thaliana encoding the 33 kDa protein of the photosystem II-associated oxygen-evolving complex. Plant Mol. Biol. 14: 217-227.

Koike, H. and Inoue, Y. (1985) Properties of a peripheral 34 kDa protein in Synechococcus vulcanus photosystem II particles. Its exchangeability with spinach 33 kDa protein in reconstitution of O2 evolution. Biochim. Biophys. Ada 807: 64-73.

Kuwabara, T., Reddy, K.J. and Sherman, L.A. (1987) Nucleotide sequence of the gene from the cyanobacterium Anacystis nidulans R2 encoding the Mn-stabilizing protein involved in photosystem II water oxidation. Proc. Natl. Acad. Sci. USA 84: 8230-8234.

Mayfield, S.P., Schirmer-Rahire, M., Frank, G., Zuber, H. and

Rochaix, J.-D. (1989) Analysis of the genes of the OEE1 and OEE3 proteins of the photosystem II complex from Chlamydo-monas reinhardtii. Plant Mol. Biol. 12: 683-693.

Meadows, J.W., Hulford, A., Raines, C.A. and Robinson, C. (1991) Nucleotide sequence of a cDNA clone encoding the precursor of the 33 kDa protein of the oxygen-evolving complex from wheat. Plant Mol. Biol. 16: 1085-1087.

Murray, M.G. and Thompson, W.F. (1980) Rapid isolation of high molecular weight plant DNA. Nucl. Acids Res. 8: 4321-4325.

Philbrick, J.B. and Zilinskas, B.A. (1988) Cloning, nucleotide se-quence and mutational analysis of the gene encoding the Photo-system II manganese-stabilizing polypeptide of Synechocystis 6803. Mol. Gen. Genet. 212: 418-^25.

Rutherford, A.W. (1989) Photosystem II, the water-splitting en-zyme. TIBS 14: 227-232.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laborato-ry Press, New York.

Schaller, A., Schrhid, J., Leibinger, U. and Amrhein, N. (1991) Molecular cloning and analysis of a cDNA coding for choris-mate synthase from the higher plant Corydalis sempervirens Pers. J. Biol. Chem. 266: 21434-21438.

Schmid, J., Schaller, A., Leibinger, U., Boll, W. and Amrhein, N. (1992) The in-vitro synthesized tomato shikimate kinase precursor is enzymatically active and is imported and processed to the mature enzyme by chloroplasts. Plant J. 2: 375-383. Shackleton, J.B. and Robinson, C. (1991) Transport of proteins

into chloroplasts. / . Biol. Chem. 266: 12152-12156.

Smeekens, S., Bauerle, C , Hageman, J., Keegstra, K. and Weisbeek, P. (1986) The role of the transit peptide in the routing of precursors toward different chloroplast compart-ments. Cell 46: 365-375.

Tyagi, A., Hermans, J., Steppuhn, J., Jansson, C , Vater, F. and Herrmann, R.G. (1987) Nucleotide sequence of cDNA clones encoding the complete "33 kDa" precursor protein associated with the photosynthetic oxygen-evolving complex from spin-ach. Mol. Gen. Genet. 207: 288-293.

van Spanje, M., Dirkse, W.G., Nap, J.-P. and Stiekema, W.J. (1991) Isolation and analysis of cDNA encoding the 33 kDa precursor protein of the oxygen-evolving complex of potato. Plant Mol. Biol. 17: 157-160.

Wales, R., Newman, B.J., Pappin, D. and Gray, J.C. (1989) The extrinsic 33 kDa polypeptide of the oxygen-evolving complex of photosystem II is a putative calcium-binding protein and is en-coded by a multi-gene family in pea. Plant Mol. Biol. 12: 439-451.

Westhoff, P., Jansson, C , Klein-Hitpafl, L., Berzborn, R., Larsson, C. and Bartlett, S.G. (1985) Intracellular coding sites of polypeptides associated with photosynthetic oxygen evolu-tion of photosystem II. Plant Mol. Biol. 4: 137-146.

(6)

Figure

Fig. 1 Tomato 33 kDa protein sequences. A. Nucleotide sequence and deduced amino acid sequence of the tomato 33 kDa protein cDNA
Fig. 2 Southern blot analysis. High molecular weight tomato DNA was digested with the restriction enzymes Hind III (lane H), BamH I (lane B), EcoR I (lane E) and Xba I (lane X) and subjected to Southern blot analysis using the 33 kDa protein cDNA as radiol
Fig. 4 Comparison of the mature 33 kDa protein from different plants and the mature Mn-stabilizing peptides from cyanobacteria.

Références

Documents relatifs

Molecular charac- terization of the gene encoding an 18-kilodalton small heat shock protein associated with the membrane of Leuconostoc oenos.... 0099-2240/97/$04.00

By the time the CPN(M) signed the peace agreement and joined the government in 2006, the death toll amounted to over 15,000. It is in such a context that the reader has to

In addition to academic articles, we publish book reviews, reports on research projects, information on Himalayan archives, news of forthcoming conferences, and funding

Notre série d’étude concerne 37 patients sur une période de 5 ans allant de 2010 à 2015, présentent une gonarthrose sur genou varum, traité au service de traumatologie du CHU rabat

However, no difference appeared in the growth rate of the different silenced lines and the wild-type (Figure 3 G).. Characterization of transgenic lines containing the LHCX2

Then, because it was shown that certain mutants affecting the formation of mcm 5 s 2 U could be rescued by overexpressing the tRNA containing these modifications, we expressed

In 5 day old pupae (2 days before emer- gence) the growth of spermathecal complex is completed. The 1-D and 2-D protein spectra of the 3 fluids still showed similarities but in

The disappearance of anomalous Δ 33 S signals from the sedi- mentary record is a crucial constraint on the rise of oxygen around the Archaean-Proterozoic boundary, but despite