• Aucun résultat trouvé

Endothelial nitric oxide synthase activity is inhibited by the plasma membrane calcium ATPase in human endothelial cells.

N/A
N/A
Protected

Academic year: 2021

Partager "Endothelial nitric oxide synthase activity is inhibited by the plasma membrane calcium ATPase in human endothelial cells."

Copied!
9
0
0

Texte intégral

(1)

. . . .

. . . .

Endothelial nitric oxide synthase activity is inhibited

by the plasma membrane calcium ATPase

in human endothelial cells

MaryLouisa Holton

1

, Tamer M.A. Mohamed

2,3

, Delvac Oceandy

2

, Weiguang Wang

4

,

Santiago Lamas

5

, Michael Emerson

6

, Ludwig Neyses

2

, and Angel L. Armesilla

1

*

1

Molecular Pharmacology Group, Department of Pharmacy, Research Institute in Healthcare Sciences, School of Applied Sciences, University of Wolverhampton, Wulfruna Street, Wolverhampton WV1 1SB, UK;2

Cardiovascular Research Group, School of Clinical and Laboratory Sciences, Biomedical Research Centre, Central Manchester NHS Foundation Trust, University of Manchester, Manchester, UK;3

Department of Biochemistry, Faculty of Pharmacy, Zagazig University, Zagazig, Egypt;4

Oncology Group, Research Institute in Healthcare Sciences, School of Applied Sciences, University of Wolverhampton, Wulfruna Street, Wolverhampton WV1 1SB, UK;5Laboratorio Mixto CSIC-FRIAT de Fisiopatologı´a Vascular y Renal, Centro de Investigaciones Biolo´gicas (CIB-CSIC), Fundacio´n Renal In˜igo Alvarez de Toledo, Ramiro de Maeztu 9, 28040 Madrid, Spain; and6

National Heart and Lung Institute, Imperial College London, Exhibition Road, London SW7 2AZ, UK

Received 14 September 2009; revised 12 February 2010; accepted 2 March 2010; online publish-ahead-of-print 7 March 2010

Time for primary review: 35 days

Aims Nitric oxide (NO) plays a pivotal role in the regulation of cardiovascular physiology. Endothelial NO is mainly pro-duced by the endothelial nitric oxide synthase (eNOS) enzyme. eNOS enzymatic activity is regulated at several levels, including Ca2+/calmodulin binding and the interaction of eNOS with associated proteins. There is emerging evidence indicating a role for the plasma membrane calcium ATPase (PMCA) as a negative regulator of Ca2+ /calmodulin-dependent signal transduction pathways via its interaction with partner proteins. The aim of our study was to inves-tigate the possibility that the activity of eNOS is regulated through its association with endothelial PMCA.

Methods and results

We show here a novel interaction between endogenous eNOS and PMCA in human primary endothelial cells. The interaction domains were located to the region 735 – 934 of eNOS and the catalytic domain of PMCA. Ectopic expression of PMCA in endothelial cells resulted in an increase in phosphorylation of the residue Thr-495 of endogenous eNOS. However, disruption of the PMCA – eNOS interaction by expression of the PMCA interaction domain significantly reversed the PMCA-mediated effect on eNOS phosphorylation. These results suggest that eNOS activity is negatively regulated via interaction with PMCA. Moreover, NO production by endothelial cells was significantly reduced by ectopic expression of PMCA.

Conclusion Our results show strong evidence for a novel functional interaction between endogenous PMCA and eNOS in endo-thelial cells, suggesting a role for endoendo-thelial PMCA as a negative modulator of eNOS activity, and, therefore, NO-dependent signal transduction pathways.

-Keywords Plasma membrane calcium ATPase † eNOS † Functional interaction † Nitric oxide regulation

1. Introduction

Cardiovascular disease, one of the leading causes of mortality in western populations, encompasses a number of different conditions including coronary heart disease, stroke, and peripheral vascular disease. The underlying pathology for all these disorders is associated with endothelial dysfunction.1Under normal conditions, the cells of

the vascular endothelium transmit extracellular signals to the arterial wall to regulate cardiovascular physiology. The ability of the

endothelium to synthesize and release the vasodilator nitric oxide plays a major role in this process.

In endothelial cells, NO is synthesized from the amino acidL-arginine and molecular oxygen by the constitutively expressed endothelial form of nitric oxide synthase (eNOS or NOS3).2Normal function of eNOS and the tonic production of NO are associated with a fully functional endothelium. In contrast, reduced bioavailability of NO is thought to be one of the central factors common to vascular disease.1eNOS enzymatic activity is regulated at different levels including Ca2+/ *Corresponding author. Tel:+44 1902 322756; fax: +44 1902 323465, Email: [email protected]

(2)

calmodulin binding,3post-translational lipid modifications,4multi-site phosphorylation5and its association with partner proteins.4

Studies in recent years have uncovered an increasingly important role for the plasma membrane calcium ATPase (PMCA) pump as a novel regulator of Ca2+/calmodulin-dependent signal transduction pathways via interaction with specific partner proteins.6PMCAs are enzymatic low capacity, high-affinity systems involved in the extrusion of Ca2+from the cell.7 Four different PMCA isoforms, PMCA1 – 4, have been identified in mammals and are encoded by four indepen-dent genes.8It is thought that PMCA regulates the activity of associ-ated proteins by tethering them to low Ca2+/calmodulin cellular microdomains created by the Ca2+extrusion activity of the pump. In this sense, PMCA has been shown to interact and inhibit the activity of the Ca2+/calmodulin-dependent proteins nNOS,9–11CASK,12and calcineurin.13–15

The role of PMCA as a regulator of Ca2+/calmodulin-dependent enzymes and, in particular, its involvement in the regulation of NO production by nNOS in neuronal, cardiac, and smooth muscle cells9–11prompted us to investigate the hypothesis that the activity of eNOS is regulated through its association with endothelial PMCA. Here we show a novel interaction between endogenous PMCAs and eNOS in human umbilical vein endothelial cells (HUVEC) and human dermal microvascular endothelial cells (HDMEC). PMCA expression in HUVEC and HDMEC leads to a significant increase in the phosphorylation of residue Thr-495 of eNOS. Conversely, ectopic expression of PMCA results in a slight reduction on the phos-phorylation of Ser-1177. Disruption of the PMCA – eNOS interaction (by expression of the PMCA interaction domain) reversed the PMCA-mediated increase in eNOS Thr-495 phosphorylation, demonstrating the functionality of this interaction. These PMCA-dependent modifi-cations in the phosphorylation status of key regulatory residues of eNOS suggest that eNOS activity is negatively regulated via inter-action with PMCA. In agreement with this hypothesis, expression of PMCA in HUVEC resulted in a significant reduction in NO production by endothelial cells.

Our results reinforce the emerging role of PMCA as a macromol-ecular complex organizer and a modulator of Ca2+ /calmodulin-dependent signal transduction pathways. Moreover, this work reveals eNOS as a new interaction partner of PMCA and suggests a role for PMCA as a regulator of NO production by endothelial cells, what might open new avenues for future therapeutic approaches to treat patients suffering from cardiovascular diseases.

2. Methods

2.1 Cell culture

HEK 293 cells were maintained in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich) supplemented with 10% foetal calf serum, 1% penicillin/ streptomycin and 1% L-glutamine. HUVEC (Clonetics or Promocell) were maintained in Endothelial Cell Growth Medium 2-Supplement mix (Promocell) supplemented with 1% penicillin/streptomycin. HDMEC (Promocell) were maintained in Endothelial Cell Growth Medium MV-Supplement mix (Promocell) supplemented with 1% penicillin/strep-tomycin. Endothelial cells were used at low passage numbers (3 – 5).

2.2 Plasmids

pcDNA3-hPMCA2b contains the human PMCA2b cDNA and was a gift from Professor Carafoli (University of Padova, Italy). pFlag-PMCA2b (462 – 684) and pFlag-PMCA2b(1143 – 1243) have been described

previously.14 pcDNA3-hPMCA4b contains the human PMCA4b cDNA.13 pFlag-PMCA4b(1 – 92) and pFlag-PMCA4b(428 – 651) have

been described previously.13 Plasmid pFlag-PMCA4b(652 – 840) has been previously reported.16pcDNA3-eNOS contains the human eNOS

cDNA. For details on the generation of plasmids pFlag-eNOS (401 – 934), pFlag-eNOS (193 – 735), pFlag-eNOS (735 – 934), and pFlag-eNOS (1 – 505), please see the expanded section Generation of plasmids in the Supplementary material on line.

2.3 Transient transfections

For immunoprecipitation experiments, HEK 293 cells were plated in 100× 20 mm2 tissue culture dishes (4.5× 106cells/plate) the day before transfection. Cells were transfected with 10 mg of the indicated expression plasmids by using LipofectAMINE 2000 reagent (Invitrogen) as described previously.13

For transfection of primary endothelial cells, 1× 106 HUVEC were transfected with 5 mg of the indicated expression plasmids in 100 mL of HUVEC nucleofector solution from a HUVEC nucleofector kit (Amaxa) following the recommendations of the manufacturer. Likewise, 1× 106 HDMEC were transfected with 5 mg of the indicated expression plasmids in 100 mL of nucleofector solution from a Basic nucleofector Primary Endothelial cells kit (Amaxa) following the recommendations of the man-ufacturer. After transfection, endothelial cells were resuspended in fresh media, plated in six-well tissue culture plates, and incubated overnight. The following day, cells were washed with PBS and incubated for 24 h more in 5 mL of endothelial medium with supplements.

2.4 cGMP and NO determination

For cGMP determination, transfected HUVEC were saturated with

L-arginine (30 min, 1 mM) and nascent NO was stabilized by addition of superoxide dismutase (100 U/mL of culture medium) (Sigma-Aldrich) 5 min before lyses. In parallel, 3-isobutyl-L-methylxanthine (IBMX, 1 mM; Sigma-Aldrich) was added to the culture 5 min before lyses (to inactivate phosphodiesterase activity), and NO synthesis was induced by addition of 0.5 mM A23487 calcium ionophore 3 min before lyses. cGMP content was determined by using a cGMP Enzymeimmunoassay BiotrakTM(EIA) system

(Amersham) according to the manufacturers instructions.

For the determination of intracellular nitric oxide bioavailability, HUVEC were transfected as indicated earlier, except that cells were plated on laminin-coated, glass-bottomed, black-walled 24-well plates. After incubation, cells were loaded with 10 mM of the NO-sensitive fluor-escence probe DAF-FM (Molecular Probes) at 378C for 30 min. The medium, containing loading dye, was removed and replaced with 1 mL of EGM-2 medium and incubated for another 45 min at 378C to ensure complete de-esterification. NO synthesis was induced by stimulation with acetylcholine (100 mM) for 5 min. Fluorescence was detected with a live cell imaging Leica AS MDW inverted fluorescence microscope in which the cells were kept at 378C. Relative fluorescence intensity per cell was quantified using ImageJ software.

2.5 Immunoprecipitation

(3)

2.6 Western blot

Samples were boiled and resolved as described previously.13 For a

detailed description of antibody sources and conditions for western blot experiments, please see the expanded section Western blot anti-bodies in the Supplementary material online.

2.7 Statistical analysis

Numerical data are expressed as mean + SEM and were analysed for stat-istical significance using Student’s t-test. The chosen significance criterion was P , 0.05.

2.8 PMCA 4 knockdown in endothelial cells

HUVEC were plated on laminin-coated, glass-bottomed, black-walled 24-well plates. After overnight incubation at 378C, cells were infected with Ad-PMCA4shRNA or Ad-CONTROLshRNA adenoviruses (MOI 25). Ad-PMCA4shRNA or Ad-CONTROLshRNA adenoviruses were generated by cloning sequence shPMCA4 (CAACGTTCTGGACCTCA TATTCAAGAGATATGAGGTCCAGAACGTTG) (encoding a short hairpin RNA silencer for isoform PMCA4), or CONTROL (TTCT CCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAA) (irrelevant sequence used as a control), respectively, into plasmid

pSilencer-U6 (Invitrogen). The resulting plasmids were used to generate recombinant adenoviruses Ad-PMCA4shRNA or Ad-CONTROLshRNA by using the ViraPower Adenoviral Gateway system (Invitrogen) following the recommendations of the manufacturer. Infected HUVEC were incu-bated at 378C for 5 days before being analysed for NO production; during this time, the culture medium was replaced by fresh medium every 2 days. To measure intracellular NO levels, cells were loaded with 10 mM of the NO-sensitive fluorescence probe DAF-FM (Molecular Probes) at 378C for 30 min. The medium, containing loading dye, was removed and replaced with 1 mL of EGM-2 medium and incubated for another 45 min at 378C to ensure complete de-esterification. NO syn-thesis was induced by stimulation with acetylcholine (100 mM) for 5 min.

3. Results

3.1 Endogenous PMCA and eNOS interact

in human endothelial cells

To investigate the interaction between endogenous PMCA and eNOS in endothelial cells, protein extracts from primary HUVEC or HDMEC were immunoprecipitated with the anti-PMCA 5F10

(4)

monoclonal antibody (Abcam). Immunoprecipitated proteins were probed by western blot with an anti-eNOS rabbit polyclonal antibody (Sigma). eNOS co-precipitated with PMCA in protein extracts iso-lated from both cellular types (Figure1A, left panels). Converse immu-noprecipitation of protein lysates with a rabbit polyclonal antibody raised against eNOS (Sigma), and subsequent western blot with the anti-PMCA 5F10 monoclonal antibody, showed co-precipitation of PMCA proteins (Figure1A, right panels). These results demonstrate the interaction between endogenous eNOS and PMCA in human endothelial cells.

PMCA1 and 4 isoforms have been reported to be expressed in most tissues.7 PMCA2 has a more restricted expression profile and it has been detected in the cardiovascular system.17Therefore, we decided to investigate whether these PMCA isoforms are expressed in HUVEC and HDMEC. For this purpose, we immunoprecipitated protein lysates isolated from these cellular types using the anti-PMCA 5F10 monoclonal antibody (that recognizes all PMCA isoforms). Western blot of the immunoprecipitated proteins with rabbit polyclo-nal antibodies reacting specifically with the isoforms 1, 2, or 4 of PMCA (Swant) revealed the presence of isoforms 1, 2, and 4 in human endothelial cells (Figure1B).

In order to determine whether these PMCA isoforms interact with eNOS, we immunoprecipitated protein extracts isolated from HUVEC with polyclonal antibodies specific for PMCA1 or PMCA2 isoforms (Swant) and probed the immunoprecipitated proteins with an anti-eNOS monoclonal antibody (Zymed). Likewise, HUVEC protein lysates were immunoprecipitated with the JA9 anti-PMCA4 monoclonal antibody and immunoprecipitated proteins probed with an anti-eNOS rabbit polyclonal antibody (Sigma). Immunoprecipita-tion of specific PMCA isoforms resulted in co-precipitaImmunoprecipita-tion of eNOS in all the cases (Figure1C).

These results further demonstrate the interaction between endogenous PMCA and eNOS and indicate that isoforms PMCA1, -2 and -4 interact with eNOS in endothelial cells.

Control immunoprecipitations carried out in each experiment using an irrelevant antibody (anti-luciferase) precipitated no protein, con-firming the selectivity of the interactions (Figure1A – C ).

3.2 The big, intracellular, catalytic domain

of PMCA interacts with eNOS

To map the domain of PMCA implicated in the interaction with eNOS, we transfected HEK293 cells with plasmids pFlag-PMCA4b (1 – 92), pFlag-hPMCA2b(1143 – 1243), pFlag-hPMCA2b(462 – 684), pFlag-PMCA4b(428 – 651), pFlag-PMCA4b(652 – 840), or pFlag-CMV7.1 empty (negative control). These plasmids encode PMCA N-terminal or C-terminal cytoplasmic tails, or different regions of its big catalytic intracellular domain. Commercially available recombinant human eNOS (Sigma) was added to protein lysates of the transfected cells, which were then immunoprecipitated with a rabbit polyclonal antibody against eNOS (Sigma), and analysed by western blot.

Flag-PMCA2(462 – 684), a Flag-tagged protein containing the prox-imal part of the big intracellular domain of PMCA2b, and Flag-PMCA4(428 – 651), containing the homologous region in PMCA4b, strongly co-precipitated with eNOS (Figure 2, upper panels). However, no precipitation was detected when Flag-PMCA4b(1 – 92), Flag-PMCA2b(1143 – 1243), or Flag-PMCA4b(652 – 840), Flag-tagged proteins containing the N-terminal intracellular domain of PMCA4b, the C-terminal intracellular domain of PMCA2b, or the distal part of the big intracellular domain of PMCA4b, respectively, were used in the assayed (Figure2, upper panels).

(5)

All Flag-tagged PMCA-truncated proteins were expressed at roughly equivalent levels (Figure2, lower panels), thus ruling out the scenario that poor expression led to the lack of interaction.

Cells transfected with empty vector p3xFlag-CMV7.1 were used as a negative control (Figure2, upper panel).

These results show that eNOS interacts with the proximal part (amino acids 462 – 684 for PMCA2b, or 428 – 651 for PMCA4b) of the PMCA catalytic, big intracellular loop located between transmem-brane regions 4 and 5.

3.3 The region 735 – 934 of eNOS is

essential for interaction with PMCA

To map the domain of eNOS responsible for the interaction with PMCA, a series of Flag-tagged deletion mutants of eNOS were gener-ated (Figure3A) and then assayed by immunoprecipitation for their ability to interact with PMCA in mammalian cells. HEK 293 cells were co-transfected with pcDNA3-hPMCA2b and either plasmid pFlag-eNOS(401 – 934), pFlag-eNOS(193 – 735), or pFlag-eNOS(1 – 505), and protein extracts were immunoprecipitated with the 5F10 anti-PMCA monoclonal antibody. A truncated version of eNOS con-taining only amino acids 401 – 934 was still able to co-precipitate with PMCA, indicating that the domain of eNOS implicated in the inter-action with PMCA must be included within this region (Figure 3B, upper panel). Overlapping mutants containing the regions 193 – 735 or 1 – 505 of eNOS failed to immunoprecipitate with PMCA (Figure 3B, upper panel), suggesting that the region of eNOS 735 –

934 is essential for the interaction with PMCA. In order to test this hypothesis, we generated a new expression plasmid, pFlag-eNOS (735 – 934), encoding a Flag-tagged version of eNOS containing amino acids from 735 to 934, and we analyse its capacity to interact with PMCA as described earlier. Flag-eNOS(735 – 934) co-precipitated with PMCA in immunoprecipitation assays (Figure3C, upper panel).

Levels of the Flag proteins prior to immunoprecipitation were analysed by western blot to ensure differences were not attributable to differential expression of the fusion proteins (Figure3B and C, lower panels).

These results demonstrate that the region 735 – 934 of eNOS is necessary and sufficient to maintain the interaction with PMCA.

3.4 PMCA modulates eNOS

phosphorylation in regulatory residues

Thr-495 and Ser-1177

Compelling evidence has recently revealed a novel role for PMCA proteins as regulators of Ca2+/calmodulin-dependent enzymes.6It is thought that PMCA inhibits the activity of these enzymes by tethering them to low calcium cellular microenvironments created by the calcium extrusion function of PMCA. The identification of eNOS as a PMCA interaction partner prompted us to investigate the functional consequences of this interaction upon eNOS activity and, therefore, NO production in endothelial cells.

(6)

Figure 4 PMCA modulates eNOS phosphorylation in regulatory residues Thr-495 and Ser-1177. (A) Ectopic expression of PMCA2b or 4b in endo-thelial cells increases the phosphorylation status of endogenous eNOS in Thr-495. HUVEC or HDMEC were transfected with 5 mg of plasmids pcDNA3-hPMCA2b, pcDNA-hPMCA4b, or p-cDNA3-Empty (negative control) and proteins analysed by western blot with a mouse antibody recog-nizing specifically eNOS phosphorylated in the residue Thr-495 (a-eNOS(pT495)). Histogram shows data as mean + SEM of seven independent experiments performed with four different batches of cells. **P , 0.01. (B) Expression of PMCA2b in endothelial cells leads to a reduction in eNOS Ser-1177 phosphorylation. HUVEC or HDMEC were transfected with 5 mg of plasmids pcDNA3-hPMCA2b or pcDNA3-Empty (negative control). Transfected cells were incubated with VEGF (25 ng/mL) for the times indicated to induce phosphorylation of eNOS in Ser-1177 as described.25Protein lysates were analysed by western blot with a mouse antibody recognizing specifically eNOS phosphorylated in Ser-1177

(7)

Multi-site phosphorylation is one of the mechanisms involved in the regulation of eNOS activity.5Phosphorylation at Ser-1177 of eNOS has been shown to increase its activity, whereas phosphorylation at Thr-495 is inhibitory.5To investigate the effect of ectopic expression of PMCA on the activity of eNOS, we transfected HUVEC and HDMEC with an expression vector encoding human PMCA2b or PMCA4b and analysed by western blot the phosphorylation status of endogenous eNOS at Thr-495 and Ser-1177 by using the corresponding phospho-specific antibodies. Ectopic expression of PMCA2b in endothelial cells signifi-cantly increased phosphorylation at Thr-495 of eNOS when compared with that of control cells transfected with empty plasmid (Figure4A, upper panels). Likewise, ectopic expression of isoform PMCA4b yielded an identical result (Figure4A, upper panels). Phosphorylation of Ser-1197 was, however, slightly reduced by ectopic expression of PMCA2b in endothelial cells (Figure4B, upper panels).

These results strongly suggest that PMCA negatively regulates eNOS activity by promoting a significant increase in phosphorylation of Thr-495 (inhibitory phosphorylation) and a slight decrease in phos-phorylation of Ser-1177 (activating phosphos-phorylation).

To investigative whether the interaction between PMCA and eNOS plays a significant role in the observed increase in eNOS phosphorylation at Thr-495, we blocked the interaction between PMCA and eNOS by co-expressing PMCA2b or 4b, together with Flag-PMCA2(462– 684) or Flag-PMCA4(428–651), respectively. In both cases, blockage of the

PMCA –eNOS interaction (by overexpression of the corresponding interaction domain) reversed the PMCA-mediated increase in Thr-495 phosphorylation (Figure4C, upper panels). These results demonstrate that the PMCA– eNOS interaction is essential for the PMCA-mediated increase in eNOS inhibitory phosphorylation.

In all cases, the levels of total eNOS in the samples were analysed using a rabbit polyclonal anti-eNOS antibody (Sigma) to rule out the possibility that the differences detected in the phosphorylation levels of eNOS were attributable to differential levels of the protein in the samples after transfection (Figure4A – C, lower panels).

3.5 PMCA significantly inhibits NO

production by endothelial cells

To determine whether the observed inhibitory effect exerted by PMCA on eNOS activity led to a reduction on NO production in endothelial cells, we transfected HUVEC with plasmid pcDNA3-hPMCA2b or pcDNA3-hPMCA4b.

NO production was determined by measuring cGMP as a surrogate marker. Ectopic expression of human PMCA2b in HUVEC resulted in a significant reduction (43% inhibition, P≤ 0.05) in NO production when compared with the levels of NO produced by HUVEC trans-fected with the pcDNA3-Empty vector (negative control) (Figure 5A). To further confirm the decrease in NO production in

(8)

endothelial cells transfected with PMCA, intracellular NO levels were measured by loading cells with 10 mM of the NO-sensitive fluor-escence probe DAF-FM (Molecular Probes). NO synthesis was stimu-lated by treating transfected cells with acetylcholine (100 mM) for 5 min. Acetylcholine-induced NO production in endothelial cells expressing PMCA2b or PMCA4b was significantly lower (28.2 and 30.6%, respectively, P≤ 0.01) than that of cells transfected with the pcDNA3-Empty vector (Figure5B).

Together, our results demonstrate a relevant role for PMCA as a negative regulator of NO production in primary endothelial cells via an inhibitory association with eNOS.

3.6 PMCA and calcineurin interact

in human endothelial cells

We have previously reported the interaction of PMCA with the Ca2+/ calmodulin-dependent phosphatase calcineurin in breast cancer cells.14 The interaction in endothelial cells of PMCA with eNOS (another Ca2+/calmodulin-dependent enzyme) that we show in this work prompted us to investigate whether PMCA also interacts with calcineurin in human endothelial cells. For this purpose, we immuno-precipitated protein lysates from HUVEC with the 5F10 anti-PMCA monoclonal antibody. Immunoprecipitated proteins were analysed by western blot using antibodies recognizing specifically PMCA iso-forms 1, 2, or 4. PMCA1, 2, and 4 were found within the immunopre-cipitated proteins (Figure6), demonstrating that endogenous PMCA interacts with calcineurin in human endothelial cells.

4. Discussion

Through the production of NO, eNOS represents a crucial regulator of cardiovascular physiology. In this work, we describe a novel role for the plasma membrane Ca2+/calmodulin ATPase pump, PMCA, as a negative regulator of NO production in endothelial cells. Endogenous eNOS and PMCA interact in primary HUVEC and HDMEC, leading to a decrease in eNOS activity and subsequent NO production by acti-vated endothelial cells. In agreement with our observations on the functional relevance of the PMCA– eNOS interaction as a novel mechanism for eNOS regulation, inhibitory interactions between eNOS and the intracellular domains of other plasma membrane pro-teins such as caveolin-1,18 the bradykinin B2 receptor,19 the endothelin-1 ETB receptor,20and the angiotensin II AT1 receptor20 have been reported previously.

We demonstrate in this paper that PMCA1, 2, and 4 interact with eNOS in endothelial cells (Figure1C). The three isoforms have calcium extrusion catalytic activity and, therefore, it is likely that there might be redundancy in their function as negative regulators of eNOS. In fact, supporting this hypothesis, knockdown of PMCA4 in endothelial cells by infection with an adenovirus expressing a short hairpin RNA silencer specific for PMCA4 did not alter NO production in either basal or acetylcholine-stimulated conditions (see Supplementary material on line, Figure S1).

The PMCA interaction domain is located in the proximal region of the big intracellular catalytic domain defined by trans-membrane seg-ments 4 and 5. PMCA2b and 4b interact with eNOS through the same homologous region: 462 – 684 in PMCA2, or 428 – 651 in PMCA4 (Figure 2). Given the high percentage of amino acid homology shown by the PMCA isoforms in this region, it is very likely that PMCA1 also interacts with eNOS through the domain equivalent to those mapped for PMCA2 and 4.

Our group has previously reported an inhibitory interaction between endogenous PMCA and the Ca2+/calmodulin-dependent phosphatase calcineurin A in breast cancer cells.14In this work, we demonstrate that PMCA also interacts with calcineurin A in human endothelial cells. The interaction between PMCA and eNOS takes place through the same domains of PMCA2 and 4 that reported for the PMCA – calcineurin interaction.14 The interaction of another Ca2+/calmodulin-dependent protein via the same domain of PMCA suggests an important role for this region in the association with partner proteins that are regulated by Ca2+.

We have also located the interaction domain with PMCA to the region 735 – 934 of eNOS (Figure3). An examination of the sequences corresponding to the interaction domains in eNOS (this work) and calcineurin A13 did not show any significant homology between the two regions, suggesting that, probably, eNOS and calcineurin interact with two different small fragments within the interaction domain of PMCA. This leads to the intriguing possibility that PMCA, eNOS, and calcineurin might be present in endothelial cells as a ternary complex.

In this work, we demonstrate that ectopic expression of PMCA results in a significant increment in the phosphorylation of residue Thr-495 of eNOS (Figure4A). The molecular mechanism behind the PMCA-mediated increase in eNOS phosphorylation is not under-stood at the moment. Interestingly, Harris et al.21reported that calci-neurin mediates dephosphorylation of Thr-495 of eNOS. We have previously reported that PMCA inhibits calcineurin activity,13,14thus, if PMCA, calcineurin, and eNOS are part of a macromolecular Figure 6Endogenous PMCA and calcineurin interact in

(9)

ternary complex, PMCA-dependent inhibition of calcineurin would result in a decrease in calcineurin-mediated dephosphorylation of Thr-495 contributing to eNOS inhibition. The possibility that PMCA, calcineurin, and eNOS are forming a ternary macromolecular complex, introducing a new level of regulation in NO production by endothelial cells, requires further investigation. Supporting this hypothesis, PMCA has been reported to participate in the organiz-ation of a macromolecular protein complex formed by endogenous PMCA, a-1 syntrophin, and nNOS in cardiac cells.22 Likewise, eNOS has been found to be part of a ternary complex together with caveolin-1 and NOSTRIN.23

Interestingly, when we disrupted the PMCA – eNOS interaction by co-expressing PMCA together with the PMCA interaction domain, the effect on eNOS Thr-495 phosphorylation was reversed (Figure4C). This result rules out the possibility that the PMCA inhibitory effect on eNOS activity was due to general Ca2+clearance resulting from PMCA ectopic expression, and demonstrates the functional sig-nificance of the PMCA– eNOS interaction. These data are in agreement with the idea of PMCA inhibiting the activity of Ca2+ /calmodulin-dependent proteins by tethering them to low Ca2+/calmodulin cellular microdomains created by the Ca2+extrusion activity of the pump.

The role of Ca2+in the PMCA – eNOS interaction is not known at present, but it is tempting to speculate with the possibility that the levels of intracellular Ca2+ could be implicated in the regulation of the PMCA– eNOS interaction. In this context, it has been reported that increments in the intracellular levels of Ca2+/calmodulin disrupt the interaction between eNOS and caveolin-1, leading to the acti-vation of eNOS.24In a similar way, increments in intracellular Ca2+ levels might disrupt the PMCA– eNOS interaction leading to eNOS activation. This increase in intracellular Ca2+ would also trigger PMCA activation. As a result of PMCA activation, Ca2+ would be removed around the PMCA microenvironment, and the local reduction in intracellular Ca2+ levels would restore the interaction between eNOS and PMCA, and the subsequent inhibition of eNOS activity. The involvement of intracellular Ca2+levels in the regulation of the PMCA – eNOS interaction, and in the potential formation of a ternary complex PMCA/eNOS/calcineurin, deserves further investigation.

In conclusion, this work shows an inhibitory interaction between endogenous PMCA and eNOS in human endothelial cells and suggests PMCA as an important regulator of NO signalling in endothelial cells. Considering the relevant role of NO in cardiovascular physiology and pathophysiology, the implications of this interaction are far-reaching. Loss of NO synthesis and bioavailability is a hallmark of cardiovascular disease.1 Disruption of the PMCA – eNOS interaction might, there-fore, have an important significance as a potential therapeutic target to modulate NO bioactivity in patients with cardiovascular disease.

Supplementary material

Supplementary material is available at Cardiovascular Research online.

Funding

This work was supported by the Research Institute in Healthcare Science (RIHS), School of Applied Sciences, University of Wolverhampton. M.H. is the recipient of a PhD studentship funded by RIHS, University of Wolver-hampton. M.E. is funded by Wellcome Trust Grant (085132/Z/08/Z). Conflict of interest. none declared.

References

1. Naseem KM. The role of nitric oxide in cardiovascular diseases. Mol Aspects Med 2005;26:33 – 65.

2. Stuehr DJ. Mammalian nitric oxide synthases. Biochim Biophys Acta Bioenerg 1999;1411: 217 – 230.

3. Andrew PJ, Mayer B. Enzymatic function of nitric oxide synthases. Cardiovasc Res 1999; 43:521 – 531.

4. Kone BC, Kuncewicz T, Zhang W, Yu ZY. Protein interactions with nitric oxide synthases: controlling the right time, the right place, and the right amount of nitric oxide. Am J Physiol Renal Physiol 2003;258:F178 – F190.

5. Dudzinski DM, Michel T. Life history of eNOS: partners and pathways. Cardiovasc Res 2007;75:247 – 260.

6. Oceandy D, Stanley PJ, Cartwright EJ, Neyses L. The regulatory function of plasma-membrane Ca(2+)-ATPase (PMCA) in the heart. Biochem Soc Trans 2007;35: 927 – 930.

7. Strehler EE, Zacharias DA. Role of alternative splicing in generating isoform diversity among plasma membrane calcium pumps. Physiol Rev 2001;81:21 – 50.

8. Di Leva F, Domi T, Fedrizzi L, Lim D, Carafoli E. The plasma membrane Ca2+ ATPase of animal cells: structure, function and regulation. Arch Biochem Biophys 2008;476: 65 – 74.

9. Schuh K, Uldrijan S, Telkamp M, Ro¨thlein N, Neyses L. The plasmamembrane calmodulin-dependent calcium pump: a major regulator of nitric oxide synthase I. J Cell Biol 2001;155:201 – 205.

10. Schuh K, Quaschning T, Knauer S, Hu K, Kocak S, Roethlein N et al. Regulation of vascular tone in animals overexpressing the sarcolemmal calcium pump. J Biol Chem 2003;278:41246 – 41252.

11. Oceandy D, Cartwright EJ, Emerson M, Prehar S, Baudoin FM, Zi M et al. Neuronal nitric oxide synthase signaling in the heart is regulated by the sarcolemmal calcium pump 4b. Circulation 2007;115:483 – 492.

12. Schuh K, Uldrijan S, Gambaryan S, Roethlein N, Neyses L. Interaction of the plasma membrane Ca2+ pump 4b/CI with the Ca2+/calmodulin-dependent membrane-associated kinase CASK. J Biol Chem 2003;78:9778 – 9783.

13. Buch MH, Pickard A, Rodriguez A, Gillies S, Maass AH, Emerson M et al. The sarco-lemmal calcium pump inhibits the calcineurin/nuclear factor of activated T-cell pathway via interaction with the calcineurin A catalytic subunit. J Biol Chem 2005; 80:29479 – 29487.

14. Holton M, Yang D, Wang W, Mohamed TM, Neyses L, Armesilla AL. The interaction between endogenous calcineurin and the plasma membrane calcium-dependent ATPase is isoform specific in breast cancer cells. FEBS Lett 2007;581:4115 – 4119. 15. Wu X, Chang B, Blair NS, Sargent M, York AJ, Robbins J et al. Plasma membrane

Ca2+-ATPase isoform 4 antagonizes cardiac hypertrophy in association with calci-neurin inhibition in rodents. J Clin Invest 2009;119:976 – 985.

16. Armesilla AL, Williams JC, Buch MH, Pickard A, Emerson M, Cartwright EJ et al. Novel functional interaction between the plasma membrane Ca2+ pump 4b and the proapoptotic tumor suppressor Ras-associated factor 1 (RASSF1). J Biol Chem 2004;279:31318 – 31328.

17. Santiago-Garcı´a J, Mas-Oliva J, Saavedra D, Zarain-Herzberg A. Analysis of mRNA expression and cloning of a novel plasma membrane Ca(2+)-ATPase splice variant in human heart. Mol Cell Biochem 1996;155:173 – 182.

18. Garcı´a-Carden˜a G, Martasek P, Masters BS, Skidd PM, Couet J, Li S et al. Dissecting the interaction between nitric oxide synthase (NOS) and caveolin. Functional signifi-cance of the nos caveolin binding domain in vivo. J Biol Chem 1997;272:25437 – 25440. 19. Ju H, Venema VJ, Marrero MB, Venema RC. Inhibitory interactions of the bradykinin B2 receptor with endothelial nitric-oxide synthase. J Biol Chem 1998;273: 24025 – 24029.

20. Marrero MB, Venema VJ, Ju H, He H, Liang H, Caldwell RB et al. Endothelial nitric oxide synthase interactions with G-protein-coupled receptors. Biochem J 1999;343: 335 – 340.

21. Harris MB, Ju H, Venema VJ, Liang H, Zou R, Michell BJ et al. Reciprocal phosphoryl-ation and regulphosphoryl-ation of endothelial nitric-oxide synthase in response to bradykinin stimulation. J Biol Chem 2001;276:16587 – 16591.

22. Williams JC, Armesilla AL, Mohamed TM, Hagarty CL, McIntyre FH, Schomburg S et al. The sarcolemmal calcium pump, alpha-1 syntrophin, and neuronal nitric-oxide synthase are parts of a macromolecular protein complex. J Biol Chem 2006;281: 23341 – 23348.

23. Schilling K, Opitz N, Wiesenthal A, Oess S, Tikkanen R, Mu¨ller-Esterl W et al. Trans-location of endothelial nitric-oxide synthase involves a ternary complex with caveolin-1 and NOSTRIN. Mol Biol Cell 2006;17:3870 – 3880.

24. Feron O, Michel JB, Sase K, Michel T. Dynamic regulation of endothelial nitric oxide synthase: complementary roles of dual acylation and caveolin interactions. Biochemis-try 1998;37:193 – 200.

Références

Documents relatifs

Ainsi, pour limiter la durée du calcul d’optimisation et adapter le résultat au but recherché (la simulation des essais de fatigue), nous avons choisi d’utiliser quatre

characteristics (median and interquartile range) in relation to Euphydryas desfontainii butterfly occupancy. In occupied patches, more host plants were found and there was a trend

[r]

q ¼ 4 ffiffiffi g p 2 logð 1:9 e=ð4aÞ Þð2aÞ 1:5 p ðp Gap  p Valve Þ=ðq w gÞ   1=2 ðD=nÞð1=r o  1=RÞ 1=2 ; ð4Þ where p Gap is the water pressure in the gap between

apices quite often not or only slightly digitate (Fig. The life cycle appears to be variable. In BRIP 7543/6045 and BRIP 6063/7548, spermogonia were associated with aecia or with

Depuis leur création dans les années quatre-vingt, les contrats aidés ont régulièrement changé de nom ou de modalités, ciblant plus ou moins et successivement le secteur marchand

Offres d’emploi collectées par Pôle emploi rapportées aux entrées à Pôle emploi (séries CVS) Évolution trimestrielle des entrées à Pôle emploi (CVS, %) Évolution