Article
Reference
Comparative evaluation by semiquantitative reverse transcriptase polymerase chain reaction of MDR1, MRP and GSTp gene
expression in breast carcinomas
LACAVE, R., et al .
LACAVE, R., et al . Comparative evaluation by semiquantitative reverse transcriptase
polymerase chain reaction of MDR1, MRP and GSTp gene expression in breast carcinomas.
British Journal of Cancer , 1998, vol. 77, no. 5, p. 694-702
PMID : 9514046
DOI : 10.1038/bjc.1998.115
Available at:
http://archive-ouverte.unige.ch/unige:47033
Disclaimer: layout of this document may differ from the published version.
1 / 1
Comparative evaluation by semiquantitative reverse transcriptase polymerase chain reaction of MDR1, MRP and GSTp gene expression in breast carcinomas
R Lacavel, F
Coulet', S Ricci',
ETouboul2,
AFlahault3, JG Rateaul,
DCesari', JP Lefranc4 and JF Bernaudin'
'Laboratoired'HistologieetBiologie TumoraleetUniversit6 PierreetMarie Curie-Paris6,H6pitalTenon,4ruedelaChine,75020Paris,France;
2Oncologie-Radiotherapie,H6pitalTenon,4 ruede laChine,75020Paris,France;3BiostatistiquesetInformatiqueM6dicale, H6pital Tenon,4,ruedelaChine, 75020Paris,France;4ChirurgieGynecologique, Groupe hospitalierPiti6-Salpetriere,95 Bd deI'h6pital,75013Paris,France
Summary Identificationandquantitative evaluation ofdrugresistance markersareessentialtoassessthe impactofmultidrugresistance (MDR) inclinical oncology. The MDR1geneconferspleiotropic drug resistance in tumourcells, butothermolecular mechanisms arealso involved in drug resistance. In particular, the clinical pattern ofexpression of the other MDR-related genes is unclear and their inter- relationships arestill unknown. Here,wereport standardization of the procedures usedtodetermine areliable method ofsemiquantitative reverse transcriptase polymerase chain reaction (RT-PCR) usingastandard series ofdrug-sensitive and increasingly resistant cell linesto evaluate theexpressionof three MDR-related genes, i.e. MDR1(multidrug resistance gene1),MRP(multidrugresistance relatedprotein) and GSTp(glutathione-S-transferase p), reportedtobe endogenous standardgenesfor normalizationof mRNAs. A total of74breastcancer surgical biopsies, obtained before any treatment, were evaluated by this method. When compared with classical clinical and laboratory findings, GSTp mRNA levelwashigherindiploid tumours.However, the mainfinding of our study suggests a clear relationship between two of theseMDR-related geneexpressions, namelyGSTp andMRP.Thisfinding provides new insight into human breast tumours, which may possibly be linkedtothe glutathione conjugate carrier function of MRP. Well defined semiquantitative RT-PCR procedures cantherefore constitute a powerful tool toinvestigate MDR phenotype at mRNA levels ofdifferent related genes in small and precious tumour biopsy specimens.
Keywords:chemoresistance; breast carcinoma;
MRF,
MDR1;GSTp; reverse transcriptase polymerase chain reaction; glutathione S conjugate carrierA wide varietyofcell
changes,
either spontaneous orinduced by cytotoxic exposure, can lead to multidrug resistance phenotype (MDR) (Simon and Schindler,1994). They are frequently inter- related and may coexist in a population of tumour cells. Some proteins have been demonstrated to be overexpressed in MDR cell lines, defining agroupofMDR-related genes. Thefirst of these proteinstobeidentifiedwasP-glycoprotein(P-gp),productoftheMDRJ
(multidrug resistance gene 1) (Endicott and Ling, 1989;Gottesman and Pastan, 1993) gene in man, belonging to the ATP-bindingcassette(ABC) proteins superfamily,allmembersof which are membrane transporters. The multidrug resistance relatedprotein(MRP), which has beenrecently demonstratedtobe involved in the MDRphenotype (Coleet al, 1992;Slovak et al, 1993),is a190 kDaprotein, whichalsobelongstothe ABC trans- portersuperfamily.LikeP-gp,MRP, whichismainlylocated in the plasmamembrane of resistant cells (Flens etal, 1994;Zaman etal, 1994;Almquistetal, 1995)actsby extrudingdrugsfrom the cells (Breuningeretal, 1995). Among otherproteins frequentlyover- expressed in tumour cells presenting a MDR phenotype, GSTp (glutathione-S-transferase p) has been extensively implicated
Received30April1997 Revised11August 1997 Accepted12August1997
Correspondenceto:RLacave,Laboratoired'HistologieetBiologie Tumorale, Hopital Tenon,4 ruedelaChine,75970 ParisCedex 20, France
(Moscow etal, 1989; Tew, 1994), although its precise role in the MDR phenomenon has notyet beenfullyclarified.
Thedevelopment of drug resistance marker evaluation in clin- ical samples is therefore particularly worthwhile to lead subse- quentlytoprospectiveclinical correlative studies.Transcriptional rate measurementof the genesinvolvedin MDRconstitutes afirst step to delineate the in vivomechanisms used by tumour cells to acquire clinical MDR characteristics. Todate, partly due to high material consuming methods, the majority of investigations in patients have focused on asingleparameter,mainly P-gpexpres- sion. Multiparameter studies, which are not always easily performed on small tissue samples, can use low material consuming methods such as reverse transcriptase polymerase chain reaction (RT-PCR) or RNAase protection assay to simultaneously screen the transcriptional rate of sets of genes involved in MDR.
The maingoalof thepresentstudywas,therefore, todevelopa technically validmethod able to investigatethe coexpression of three MDR-related genes, i.e. MDRJ,MRP, and GSTp on small tumourspecimens. The first step in thisprocess, using RT-PCR, was toestablishstandard curves tosemiquantitativelymeasure the expressionofdrugresistance genes in control cell lines.Theywere independently ascertained and their respective precise experi- mentalproceduresarereported here.
Inthe second partof thisstudy,weused thismethod to screen the MDRphenotypeofaconsecutiveseries of 74 untreated inva- sive breastcarcinomas andtocomparethe levels ofexpression of
Multidrug resistance and breastcancer 695 each of the three genes with the other twodrug resistance genes.
The MDR phenotype appeared independent of other clinical, histopathological and laboratory parameters, except that diploid tumours exhibitedahigher level of GSTp expression than aneu- ploidtumours.However, ourstudyprovidesa newintriguing clue in the clinical investigation of MDR, by demonstrating, for the firsttimein human tumoursamples,aclearrelationship between MRP and GSTp gene expression. This finding needs to be discussed in the light of the considerable recent experimental evidence(Jedlitschkyetal, 1994;Mulleretal, 1994;Zaman etal, 1995)concerningthe roleofthe membraneassociated MRP pump in the exportof glutathioneSconjugates (GS-X)fromcells.
MATERIALS
ANDMETHODS
Patients and tissue samples
Seventy-fourtumoursampleswereobtainedduringsurgery from previously untreated primary breast cancers. All patients gave theirinformed consent before surgery. Samples (100mg to 1 g) wereremovedfrom the tumour zone,immediatelysnapfrozenand stored inliquid nitrogen,then cutinto severalequal piecesfor the variousanalyses.Representative sampleswereexaminedhistolog- icallyto ensure verylarge predominance oftumour overstromal cells(above 90%)insamplesusedforanalysis. Histopathological typing, Scarff-Bloom-Richardson (SBR) grading and measure- ments of oestrogen (ER) and progesterone (PR) receptor levels (cut-off values 10fmol mg-' protein) were performed by other independent investigators (Pathology Department-hopitalPitie- Salpetriere, Professor Lecharpentier and Biochemistry Laboratory
-h6pital Bicetre,ProfessorMilgrom)in a tumour areaveryclose tothesurgical specimen.
Flow
cytometryprocedures
Flowcytometry wasperformed afterDNAlabelling with propidium iodide(Sigma Chemical,StLouis, MO, USA).Asingle-cellsuspen- sion wasprepared from eachtumoursample bymechanical disag- gregation,asdescribedpreviously (Costeetal,1996).Cellular DNA content was analysed on an Epics Eliteflow cytometer (Coulter Electronics, Hialeah, FL, USA).Debris andclumpswereeliminated and the results were recorded on 15 000 cells.
Table I Designation of RT-PCR primers used foramplificationof bothMDR- relatedgenesand internalstandards
Transcript Primersequence(5'-3') Fragment length
MDR1 CCCATCATTGCAATAGCAGG 167
GTTCAAACTTCTGCTCCTGA
P2m
ACCCCCACTGAAAAAGATGA 120ATCTTCAAACCTCCATGATG
MRP GGACCTGGACTTCGTTCTCA 291
CGTCCAGACTTCTTCATCCG
GSTI CTCCGCTGCAAATACATCTC 137
ACAATGAAGGTCTTGCCTCC
PGK CAGTTTGGAGCTCCTGGAAG 247
TGCAAATCCAGGGTGCAGTG
Control
tumourcell lines
Thedrug-sensitive human epidermoidcarcinoma KB 3.1 cellline and its multidrug-resistant derivativeKB8.5 cell linewerekindly donated by M Gottesman (Akiyama et al, 1985). MCF7 human breastcarcinoma cells (Soule et al, 1973) were obtained from J Robert, who selected a doxorubicin-resistant cell line (MCF7R) from MCF7S wild-type cells. The IGROV celllinewas agift from JBenard (1985).
Cell culture media and their supplements wereobtained from Gibco BRL (Eragny, France). The KB cell lines were maintained in Dulbecco'smodified Eagle medium,while MCF7 and IGROV celllines were grownin RPMI 1640 medium.All were supple- mented with 1.5 mm glutamine, 10%fetalcalf serum, 50 IU ml penicillin and 50 mg ml-' streptomycin. Cells were cultured at 37°C in a humidifiedatmosphere containing5% carbon dioxide.
Theselectionpressure wasmaintained onresistant cell lines by the addition of either 10 ng ml of colchicine or 2 mmdoxorubicin for KB8.5 and MCF7Rrespectively.
Semiquantitative RT-PCR analysis
Semiquantitative determination of
MDRJ,
GSTp and MRP gene expressionwasassessed on asingletissue sample per patient. As proposed by Noonan et al (1990) and as more recently recom- mended (Beck et al, 1996), we used the ,B2-microglobulin (p2) gene asthe internal control sequence for MDR] analysis. As the MCF7R cell line did not express 32,MRPandGSTp gene expres- sion wasmonitoredusingthephosphoglyceratekinase (PGK) gene asendogenous standard (Ozceliketal, 1995).Total RNA was extractedfrom either control cell lines or tissue samples usingRNA BTMprotocol(Bioprobe Systems,Montreuil, France),accordingtothemanufacturer's instructions.RNAswere quantitated by absorbance spectrophotometry measurements and theirqualitywasestimated aftermigrationon a2% agarosegel.
A
2-jg
sample oftotal cellular RNAfromeachadequateRNA preparationwastreated in a10-pl
volume,with2units ofDNAase Ifrombovinepancreas(Boehringer Mannheim)inthe presence of 20 units of RNAase inhibitor(Boehringer Mannheim) for15min at 37°C.DNAase I was inactivatedby heating for5min at65°C before cDNA preparation. cDNA was then synthesized from DNAase treated RNA in a20-pl
reverse transcription reaction mixture containing 100 ng of random hexamer primers (Pharmacia, Sollentuna, Sweden),4pl
of buffer5X,2pl
of0.1 M dithiothreitol (Gibco), 2gl
of dNTPs 5 mm (Boehringer), and 100 Uofreverse transcriptase SuperscriptII (Gibco, UK). After 15 min at42°C,cDNA wasdiluted to 1:5 with water then stored at -20°C untiluse.PCR amplification was performed on 5p1 of the RT product incubated with 1 U of Taq polymerase (ATGC, Noisy le grand, France) in a
25-gl
reaction mixture containing 0.5mM deoxy- nucleoside triphosphate, 2.5 mm magnesium chloride, 2.5pl
of 10xTaqpolymerasebuffer fromATGC, 10pmolofbothspecitic
and internal standard gene upstream and downstream primersto minimize tube-to-tube variations inamplification
efficiency,and 1jCi of [a-32P]dCTP (Amersham, Les Ulis, France), which was alwaysused within 5 daysof the date ofradiolabellingindi- catedbythe manufacturer. Theamplimersequencesfor MDR] andP2
(Noonan et al, 1990), PGK (Ozcelik et al, 1995), MRP (Abbaszadegan etal, 1994) and GSTp (Morrow etal, 1989) are thosepreviously published (Table 1).BritishJournal ofCancer(1998) 77(5),694-702 0 Cancer Research
Campaign
1998Table 2 Characteristicsof patients and samples
Characteristics n %
Age(years)
< 50 23 31
. 50 51 69
Tumoursize (mm)
<30 57 77
. 30 17 23
Axillary nodal status
N- 65 88
N+ 9 12
Histological typing
Infiltrating ductal carcinomas 63 85
Infiltrating lobular carcinomas 10 13
Others 1 2
Histologicalgrading(SBR)
19 26
11 42 59
III 11 15
Oestrogen receptorstatus
Negative 14 28
Positive 35 72
Progesterone receptor status
Negative 16 33
Positive 33 67
*SBR, Scarff-Bloom and Richardson index. The cut-off value is 10 fmol mg-' protein for bothoestrogen and progesterone receptors.
A
F
1.2 1.0 0.8 Z 0.8 2 0.4 0.2 0
B
IQ
C:
0PCRwas carried out in athermal cycler (Perkin Elmer, Paris, France), and, after an initial denaturation at 95°C for 5
min,
PCR consisted of 30cycles,correspondingtotheexponentialrange of theamplificationreaction. Thethermal profile was as follows: 60 s at940C,60 s at 550C and 90 s at 72°C. Negative controlreactions, containing water instead of cDNA, were included in eachexperi- ment.Three microlitres of the radiolabelled PCR products were submitted to run on 8% polyacrylamide gel electrophoresis in a buffer containing 89 mm Tris-borate and 2 mM ethylenediamine tetraacetate disodium (EDTA, pH 8.3) at 50 V cm-'. Gels were dried for 2 h at 80°C then exposed against X-O-Mat films (Eastman Kodak) for 6 h at - 800C. Autoradiographs were densitometricallyscanned on a Biorad densitometer(Biorad,Ivry, France) using Molecular Analyst software(Biorad). Specificgene expression was determined semiquantitatively by calculating the ratio of the densitometric values fromspecificgenesexpressedin relation to the intemal standard.Determination of standard
curvesFor each gene investigated, a semiquantitative determination method ofRT-PCRyieldswas developed usingastandardcurve established from threeRT-PCR reactions from controlcell lines assessed under identical reactionconditions. MDR] gene expres- sion was determined by densitometry estimating the MDR1432 ratio from autoradiographs obtained following coamplification of MDRJ and[2 cDNAfromserialdilutionsofdrug-resistantKB8-5 cells withdrug-sensitiveKB3-1 cells.
C
co)
]
a.
1.2 1.0,
.9
0.8 9 0.6 0 0.4 0.2 0KB8.5 / KB 3.1 RNAdflutons -MCF7RIIGROVI RNAdilutons MCF7R/CW SRNA ciluions
Figure1 Semiquantitative RT-PCR determination of MDR1,MRPandGSTpgeneexpressionincontrol celllines. Standardcurves(bottom)wereestablished forMDR1(A),MRP(B)andGSTp (C) usingserial dilutionstandard series ofdrug sensitive(KB3.1, IGROV and MCF7Srespectively)RNAandincreasingly resistant cellline(KB8.5for MDR1 and MCF7R for both MRP andGSTp) total RNA. Autoradiograms(top)ofRT-PCRproducts(30cycles) from MDR related genesand internal standardsweredensitometricallyscanned for calculation ofrespectiveMDR-relatedgene/internalstandard ratios. Insertsshow the ranges of dilution for whichamplificationratio and MDR-related gene mRNA showedalinear increment andwerestrictly proportional.TheparametricPearson correlation wasusedfor data analysis
Multidrug resistanceand breast cancer 697 MRP/PGK and GSTp/PGK standard curves were establishedby
serial dilutions of MCF7R cells with either IGROV or MCF7S cellsrespectively.
The values of these ratios were independently assessed for respective control celllines onsix experiments performedunder identical reaction conditions andthecoefficient of variation was calculatedfor each one.
Statistical analysis
Linear regression was used to model standard curves (with Pearson coefficientofcorrelation). Spearman rank ordercorrela- tionanalysiswasperformedto testallother continuous variables, namely correlation studies between the expression ofthe three genes. Mann-Whitney non-parametric tests were performed to comparecontinuous clinicopathologicalandlaboratory variables.
Anominalsignificance level ofa'=0.01 wasusedfor individual tests toguarantee anoverall level of a=0.05 with ten stages.
RESULTS
Sample characteristics
andflow cytometry
Table 2 summarizes the main characteristics ofthe samples: 23 (31%)patientswereunder 50 yearsofage,ranging from21 to 49 years,and51(69%)wereover50 yearsold, ranging from 50to84 yearswith a meanof42.2 ±6.1 and60.2±8.2respectively.The majority ofthe tumours werelocallynonadvanced, as 57(77%) wereless than 3 cm in diameter (15.4 ±6.1 mm) and 65 (88%) werenode negative. All tumours were non-metastatic. All were invasive tumours: 63 (85%) were ductal cancers whereas ten (13%)wereoflobularorigin; onlyone wasofmedullarytypeand was nottaken into account inthe subsequent statistical analysis.
The hormonal status was available on 49 samples for tissue receptor determination: 35 (72%) were classified as oestrogen receptor
(ER)-positive,
whereas 33 (67%)wereconsidered tobe progesterone receptor(PR)-positive.Sixtyfoursamples wereevaluatedforflow cytometry studies.
Tumours containing asingle cell population with a DNA index rangingbetween 0.9 and 1.1 were classified as diploid (n = 34, 55%); thosewithanadditionalcellpopulation withaDNAindex beyond thelimits of0.9and1.1weredefinedasaneuploid (n=28, 45%).Noneofthesampleswasexclusively composed ofasingle cellpopulationwith ananeuploid index.
RT-PCR analysis
Determination of standard
curvesStandardcurvesfor RT-PCRanalysisareshownonFigure1.
The
MDRJ
standard curve was obtained by submitting serial dilutions of total RNA from KB 8.5 cells mixed with total RNA extractedfrom KB 3.1 cells notexpressingtheMDRJ
gene to RT- PCR(Figure IA). This curve was used to define a range of dilu- tions within which theMDRJ/j2
ratio increased inastrictlylinear fashion with the dilution factor. As shownmore preciselyonthe inset,this range extended from 1/256to 1/16 (y=9.4x+0.03,r=0.992).This result is consistent with that
reported by
Chevillardet al (1996) using the KBAI cell line asMDRJ-positive
control.Under these
conditions,
with linear increment ofthe curve, theMDRJ/f2
ratio increased in proportion to increasing concentra- tions ofMDRJ
mRNAcontainedin the KB 8.5/KB3.1 RNAmixTable 3 RT-PCR determination in control cell lines (arbitrary units)
MDR1/f2 MRP/PGK GSTpIPGK
mean±s.d. mean±s.d. mean±s.d.
(CV %) (CV %) (CV%)
KB3.1 0 - -
(0%)
KB8.5 0.836 -
± 0.064
(8%)
MCF7S - - 0
(0%)
MCF7R - 1.140 0.784
±0.051 ± 0.055
(4.5%) (7%)
IGROV - 0.243 -
+ 0.018 (7.4%)
The coefficient of variation(CV) was calculated on six independent experiments.
to IS4
*1
I
Is1%S
a
*
*0 . ..
0
2.,S 1 o.'
.. .a.a.w.
.
* .. V. -; -
i> ,...
Figure2 RT-PCR analysis oftumoursamples.MDR1, MRP andGSTp mRNA content wasexpressed in relationtorespective internal standards (,2for MDR1 andPGKforbothMRPandGSTp).The resultsareexpressed asthepercentageofthe ratio assessedineachsetofexperimentforpositive control celllines(KB8.5 andMCR7R for MDR1 and both MRP andGSTp respectively). Horizontal bars represent themeanvalues oftheseries
and there was nocompetitionforPCRbetween the twocouplesof primers.Finally,asreportedin Table 3, the coefficient of variation calculated from sixdeterminations of the
MDRI/f2
ratio on KB 8.5 assessed under identical reaction conditions was low (8%), allowing us to compare tumour samples with KB 8.5 cells in subsequentrounds of PCR.Toestablish the MRP standard curve, total RNA from theMRP- positiveMCF7R celllinewasdiluted in RNA extracted from the low BritishJournal of Cancer (1998) 77(5), 694-702
:-. -,- -- 'L.. -..---... :. % .-. -%-!- .-----,-.-.
I.-, -4L-,.,.q:-T-,v:"*!i t%,Vm
-.t ..r... '.
0 Cancer Research
Campaign
1998Table4 MDRphenotype andcharacterisics oftumours
Mean ± s.d.
Characteristics Age(years)a
<50 .50
Tumour size(mm)
<30 .30
Axillary nodal status N-
N+
Histologicaltypingb
Infiltrating ductal carcinomas Infiltrating lobular carcinomas Histological gradingSBRc
11 III
Oestrogen receptorstatus Negative
Positive
Progesterone receptor status Negative
Positive
MDR1 19.2 ± 31.3 12.0 ± 18.1 14.08±24.2 13.07±20.5 14.7±24.1 10.9±12.9 14.4 ±21.9 14.9±30.9 13.9±26.8 13.7±17.8 18.9±31.1 12.5±14.6 11.0±20.1 12.5±13.7 10.9±20.7
MRP 66.1±26.1 57.3±20.3 56.8±20.7 70.1±26.4 59.2±23.1 66.1± 17.2 62.4±23.2 47.3±9.8 63.0±23.9 62.2±22.6 67.4±26.4 51.8±19.0 59.3±19.6 55.7 ± 19.3 57.9±19.9
GSTp 85.1±7.7 77.34±31.0
77.8±29.8 85.6±43.6 80.5±33.1 74.7±32.8 80.8±33.8 73.9±29.5 79.6±36.4 80.4 ±29.7 91.3±45.8 74.0 ±44.8 84.5 ± 30.0 78.0 ± 41.6 83.2±31 .4 aAge ofpatients; botherhistological types were excluded;cSBR,Scarff-Bloom and Richardson index; Values are mean±s.d. of mRNA levels ratiosof MDR1, MRP,GSTp RT-PCR products expressed as a percentage of control cell lines. Mann-Witney testswere usedfor comparison of these variables. Nosignificant statistical difference was observed. For SBR subgroups, expression of each MDR-related genewascompared between group and 11, and Ill and 11 and Ill.
MRPexpressingIGROV cell line andsubmittedtoRT-PCR(Figure IB).Under theseconditions,theMRP/PGKratio increased linearly forMCF7R/IGROV RNAdilutions rangingbetween 1/32 and 1/1 (y=0.85x +0.26,r=0.975).This linearincrement for low dilutions canbeexplained bytherelatively low levelof MRPexpressionby MCF7R andbythefact that IGROVcellswerenottotally negative for MRPexpression (Table 3).As forMDRJ determination, these RT-PCRprocedures, designedtodetermineMRPexpression,were highly reproducible on the MCF7Rcell line with acoefficient of variation of 4.5% on six separateexperiments (Table3).
Similarly,toestablishtheGSTpstandard curve,totalRNAfrom the
GSTp-positive
MCF7Rcell line wasdilutedinGSTp-negative
MCF7Scells RNAandsubmitted to RT-PCR(Figure IC). MCF7 wasthe first cell line described to overexpress GSTp when selected by doxorubicin andwassubsequently usedas areference forGSTp expression (Batistetal,1986;Moscow etal, 1989).High dilutions, ranging between 1/512 and 1/16, were characterizedby a high slope (y = 4.8x + 0.003, r = 0.977), whereas weak dilutions, rangingbetween 1/8 and 1/1, werecharacterized by alow slope (y=0.33x+0.49, r=0.98).Nevertheless,it mustbeemphasized that, under these conditions, a plateau could never have been reached. The coefficient of variation forMCF7R was 7% when calculated on sixGSTp/PGKratio determinations(Table 3).RT-PCR analysis
of tumoursamples
Figure2showsthedetermination ofMDR],MRPandGSTpgene expressionin the 74samples. Whencomparedwithnegative KB 3.1 and positive KB 8.5 control cell lines, 13 (17.6%) of the
e..
E* "
5_
.0
*.
NW
113~~~~~~.
*13 !0>
I~~~~~h iTqfrJ.
..0
S~~~~~~~~~~~~
-,, --.- i- .:
Figure3 MDR relatedgeneexpressionand DNAploidyTumourswere classifiedasdiploidwhenthe DNAindexrangedbetween0.9 and 1.1 (n=34)andaneuploid whenthe DNAindexwasoutsidethesevalues (n=28).RT-PCRproductsof the three MDR-relatedgenes areexpressedas apercentageof controlcell lines. The twogroupsofsampleswerecompared usingtheMann-Whitneynon-parametric test;P<0.01wasconsidered tobe significant(*) (anominalsignificancelevel of a'=0.01wasused for individual test toguaranteeanoverall level ofa=0.05with tenstages)
Multidrugresistance andbreastcancer 699
A .-";
B0 rho 0.07P= 0.546 220 rho=0.1P=0.402
10
...~~~~~200
40 8 180
20DO io1014004
.60
*CD~~~~~~S
20 40'~
0
~~~~~~~~~20
0 20 40
80 80 100
120 020 40 60 100120
MDRI (% of KB 8.5 control) MDRI(%of KB65
contr6l)
*I
It
0
0.
C:
GSTS(%ofUMCF7R ont) Figure4 Correlation studies between MDR1,MRPandGSTpgene expressioninbreast tumours.Yields ofRT-PCR products are expressed as a percentage of the MDR-relatedgene/internal standard compared with thepositivecontrol cell lines. For MDR1 and MRP(A),MDR1 andGSTp (B)and MRP andGSTp (C) expression data,Spearmanrank order correlationanalysiswasused;P <0.05wasconsideredtobesignificant
samples definitely did not express the MDRI gene, whereas 61 (82.4%) were found to express MDRJ: 45 (60.8%) of these samples showed a gene expression less than 20% of that ofKB 8.5; 14 (18.9%) showed moderate expression, between 20 and 100%, whereas onlytwosamples (2.7%)showed slightly higher expression thanthe control (101% and 104% ofKB 8.5 respec- tively). Ifwecorrelate thesevalues, expressedas apercentageof thepositive controlcellline,tothestandardcurveestablishedby dilutionsoftheRNAcontrol celllines,72samples(97.3%)corre- spondedtothelinearportion of thecurve(dilution1/256to1/16 of the KB 8.5 mRNA dilutions). This observation allowed us to validate our semiquantitative RT-PCR method when applied to samples expressingarelatively low level of
MDRJ
mRNA, such asbreastcancers.For MRP expression, the values ofMRP/PGK ratio ranged between 21% and 146% (mean ± s.d.: 60± 22.4). Again, only three tumoursexpressedMRP/PGK ratioathigher levelsthanthe MCF7R control cell line (102, 117, and 146% of the MCF7R values respectively).Considering thatthestandardcurveshoweda linear increment for dilutions between 1/32 and 1/1,70of the74 (94.6%) tumours corresponded to this
portion
of the curve. The majority ofoursamples weretherefore able to be evaluated for MRPgeneexpression usingthismethod.Finally, concerning GSTp expression, the GSTp/PGK ratio ranged between 35% and 197% (mean±s.d.: 79.8± 32.9) ofthe MCF7Rcontrol cell line.Twentysamples (27%)hadahigherratio than MCF7R. The distributionofthese valuesonthestandard curve indicated that 31 of the 74 tumours(41.9 %)
corresponded
tothe higher slope ofthe curve(dilutions 1/512to1/8),
whereas 23 of74(31.1%) corresponded
tothe second partofthecurve(lowerslope).Table 4 reports the levels ofexpression of the three different genesinrelationtothe clinical andlaboratory
findings
ofpatients andsamples.As shown,noneofthevarioussubgroups
expressed anyof the MDR-related genes withasignificant statisticaldiffer- ence. However,asshownonFigure
3,diploid
tumoursexpressed
GSTp atsignificantly
higher levels thananeuploid
tumours (93.6± 33.5vs70.9 ± 28.7% ofcontrols,
P<0.007).
Incontrast, theproliferation
stateofthetwotypesoftumoursdidnotinfluence theexpression ofthe three genes(datanotshown).
Correlation studies between the
expression
of the three genes investigated also revealed apotentially important finding.
TocomparetheMDR]levels to the levels of the other twodrugresis- tance genes, we checked that a correlation close to 1:1 was observed between ,B2 and PGK levels in clinical samples (not shown).As shown on Figure 4, although MDR] and either MRP or GSTp gene expressiondid not seem to be correlated, our study revealed a significant positive correlation between MRP and GSTp expression whenusing Spearman correlation (rho = 0.47, P <0.0015).
DISCUSSION
Thedevelopment of accurate andreliabletests to identify MDR determinants in clinicalstudies isnow oneof the majorgoals in the follow-up of cancerchemotherapy. Only afew of themany putative molecular mechanisms for clinical chemoresistance can be semiroutinely investigated. In addition to the P-gp mediated multidrugphenomenon, which hasbeen extensively investigated in human pathology (Fojo et al, 1987; Pastan and Gottesman, 1987; Gottesmanetal, 1989;Noonan etal, 1990; Weinsteinetal, 1990;Areci etal, 1993andcited inGottesman and Pastan, 1993), othermechanismshavebeenmorerecentlyidentified; some, such asMRP-mediatedmultidrugresistance, havenotbeenwellinves- tigated,whereasothers,such asGSTp,have notbeenclearlyiden- tifiedasdirectly involved inMDRand need tobeinvestigatedin conjunctionwith other factors.
OurstudyreportsreliableexperimentalRT-PCRproceduresthat areable tosimultaneously measuremRNAlevels of threeMDR- related genes. A variety ofmethods using either quantitative or semiquantitative RT-PCR have been used to determine relative initialtarget mRNAinsamples. However,inall ofthesemethods undefined variations in amplification efficiency complicate the interpretationofresultsand, inanattempt to correctfor tube-to- tubevariationsinamplificationefficiency, mostinvestigatorsuse internal amplification standards, either gene transcript normally present in the sample, or an exogenous fragment added to the amplification reaction. In this study, as in many other studies, particularly concerning human tumour tissue samples (Noonan, 1990; Horikoshi, 1992; Chevillard, 1996), we chose to use endogenousstandards. One -of the greatest
advantages
ofusingthe expression ofan endogenous sequenceasan internalstandard is that thereferencemRNAand target mRNAareusually
processed British Journal ofCancer(1998)
77(5),694-702'R
8 1.
~8
t1l
'
a-
I.,
0 Cancer Research
Campaign
1998together
throughouttheexperiment,i.e. from RNAextraction until PCR amplification. This tends to minimize differences in RNAyield
between samples, an important advantage, particularly foranalysis
of small tissue samples. Inaddition, if the entire popula- tion of RNA is converted to cDNA, the overall efficiency of cDNA synthesis is somewhat normalized. Our assays were alsoperformed
in agreement with the consensus recommendations recently proposedbythe workshop onMDR]evaluation (Beck etal, 1996):
to work on a dominant tumour cell population in theexponential
rangeof theamplification reaction; to chooseoptimal internalstandards;toavoid anycompetitionbetween primer pairs in multiplex reactions; and finally to establish PCR assays withnegative
controls as well as standard series of drug-sensitive andincreasingly
resistant cell lines to establish a titration of the sequences tobe amplified and to be sure that the target/standard PCRproductsratioincreaseslinearly with the initial concentration of the target sequenceduring theexponentialphase ofamplifica- tion ofthetwosequences. Concerningthis last point, the standard curves determined in the present work for the three genes investi-gated,
demonstrate that theconditions used here are validated for therelatively
low mRNA levels measuredin our series of breast cancersamples.
Thechoiceof relevant control cell lines isparticularlyimportant to validate such a method. Both parental and drug-resistant KB and MCF7 cell lines arewellreferencedcontrol cell lines to study MDR] andGSTp gene expression (Gottesman, 1993; Moscow et
al, 1989).
The MCF7R cell line expresses MRP at a relatively lower level than other classical positive control cell lines, such as H69AR(Cole,
1992)and GLC4 /ADR(Zijlstraet al, 1987; Zaman etal,
1993). Nevertheless, the use of this cell line as positive controlforMRP in ourstudyonbreastcancer can be justified, as it is derived from human breast cancer and also because there isgrowing
evidencethat MRP can act as amembranous glutathioneconjugate
carrier(see below). We, therefore, preferredto use the samepositive
control cell line forboth MRP and GSTpi expres- sion. The IGROV cell line was chosen as low expressing control cell linebecause,toourknowledge, few other cell lines have been shown to express MRP at low levels when using ultrasensitive detection methods such as RNAase protection assay or RT-PCR excepttheparental H69cell line as reported by Cole et al (1992).Indeed,
like the GLC4 cell line (Nooter et al, 1995), the IGROV celllineisweakly positive forMRPexpression. Furthermore, the IGROV cell lineexpressed the PGKinternal standardgene at an identicalleveltotheMCF7R-positivecontrol cell line.Concerning
the choice oftheinternal standards f2andPGK,,2 is the gene recommended for calibrating MDR] in the recent consensus recommendations. However as MCF7R failed to express theP2
gene, we therefore had to choose another geneconstitutively
expressedinbreast,namelyPGK, tocalibrateMRP andGSTpi expression
(Ozceliket al, 1995).Fromamolecularpointof view, the mechanismsofMDR are often
opportunistic
in their manipulation and modification of normalpathways
of cellularhomeostasis. Consequently,it would beinteresting
to evaluate whether a particular subgroup of untreated breast carcinomas could be isolated beforechemotherapy
onthebasis of MDRphenotype.We showed that MDR]expression wasrelativelyweak in the overall
panel
ofsamples and appearedindependentof both clini-copathological
andlaboratory features. Thepresent study shows thatMDRJ
mRNAquantitationcanbeconsideredas an indepen-dent drug resistance marker in untreated breast cancer when
compared
with theexpression
ofother mainMDR-related genes.One ofthe presentquestions iswhether theassessmentofmRNA by RT-PCR of certaindrug resistance markers is relevant toclin- icalendpoints oftreatmentwhencompared withprotein.
Charpin
et al (1994) evidenced a goodcorrelation
betweenquantitative
immunocytochemical assay forP-gp andPCRanalysis of MDRJexpression
in frozen untreated breast carcinomas. Alvarez et al (1995) described a drug resistance profile when theyquantitated
MDRJ expression by RT-PCR in cell lines. Overexpression of either the MDR] gene or its P-gp product has beenfrequently
reported in breast cancer and has often been linked to either in vitro resistance phenomenon or clinical resistance, namely to anthracyclines(Fojoetal, 1987; Merckeletal, 1989; Salmonet
al,
1989; Schneider et al, 1989; Keith et al, 1990; Ro et al, 1990;Wishart et al, 1990; Sanfilipo et al, 1991; Verelle et al,
1991;
Wallneretal, 1991; Hennequinetal 1993; Chevillardetal, 1996).
In addition, the presence of increased levels of P-gp in several typesoftumours has been
correlated
with short progression-free survival andoverall survival (van Kalkenetal, 1991). Gregorcyk etal (1996) demonstrated a greater risk of recurrence at 5 yearsin P-gp overexpressing untreated breast carcinomas. Finally, P-gp overexpression has beencorrelated
with c-erbB-2 expression, which is known to be another poor prognostic marker in breast carcinomas(Brotherick et al, 1996).MRP is ubiquitously expressed in normal human tissue (Zaman etal, 1993; Kruhetal, 1995;Nooter etal, 1995), but few data are available
concerning
MRP expression in human cancers. Kruh et al(1995) detected transcripts in all ofnine breast cancer celllines.Using a RNAase protection assay, Nooter et al (1995) classified breastcarcinomasaslow MRP-expressing tumours. In the present study, weconfirm that almost all samples tested expressed rela- tively low levels of MRP mRNA. Using the MRP-specific mono- clonal antibody MRPrl
Flens
et al (1996), Nooter et al (1997) recently reported the first study showing a higher MRP expression in the operable primary tumour ofrecurrent
breast cancers treated withfirst-line systemic chemotherapy. The present work provides additional evidenceconcerning
a possible relationship with GSTpi in breast carcinoma (see below).Our results
concerning
GSTp mRNA levels are in accordance with those published by Moscow et al (1988). However, as re- portedby Sheaetal(1990)
and Peters et al(1993),
wedid not find anyrelationship between GSTp expression andhormone
receptor status. Such a result is at variance with previous reports (Moscow etal, 1988; Gilbert et al, 1993). In addition, we also showed that diploid tumours exhibited higher GSTp mRNA levels than aneu- ploid tumours. Although GSTp has not been unambiguously directly involved in MDR (Moscow et al, 1988; Tew, 1994 and cited in Morrow et al, 1993), its value as a prognostic marker has tobe appraised. Indeed, an increased GSTp expression has been suggested tobe predictive of early recurrence and death in node- negative breast cancer (Gilbert et al, 1993; Silverstini et al, 1997), particularly when not treated by adjuvant radiotherapy (Silverstini et al, 1997).Finally, one of the main findings of our study is the suggested relationship between MRP and GSTp expression. There is convincing evidence that the transport of glutathione conjugates (GS-X) might be mediated by the membranous MRP, GS-X pump (Muller et al, 1994; Zaman et al, 1995). In addition, it has been suggested that the MRP/GS-X pump might transport the metabolic
Multidrug resistance and breast cancer 701 derivatives of doxorubicin, but not the native drug (Cole et
al,1994). Zaman etal (1995) have provided important evidence thatcellularGSHis acritical factor for the export of doxorubicin by the MRP/GS-X pump and Ishikawaetal (1995) proposeda scheme indicating that both MRP/GS-X pump and metabolic enzyme systems including GST, as well as GSH,could be criti- callyinvolved in the mechanisms underlying doxorubicin resis- tance. The correlation between MRP and GSTp expression suggests that genes coding for conjugation enzymes of toxic compounds toGSH, such asGSTp,as wellasMRP/GS-Xpump might be co-regulated duringthedevelopment of breast tumours before anychemotherapy and couldsubsequently beinvolvedin clinical chemoresistance. Resistance to many anti-cancer drugs has been linked to increased cellular levels of GSH and glutathione-S-transferases (Tew, 1994) and, although conjugates ofanthracyclines and vinca alkaloids with GSH have not been described,thisfinding isin favourofolderexperiments in which resistance to anthracyclines was found to be correlated with increased levels of cellularGSH, GSHsynthesis orglutathione- S-transferases (cited in Morrow, 1993 and Tew, 1994). Such a hypothesis is in accordance with the recent report (Kuo etal, 1996) showing, in human colorectal cancers, a frequent coordinated overexpression of the MRP gene and the g-glutamylcysteine synthetase(g-GCS) gene, anenzyme involved in GSHsynthesis.
Inconclusion,accurate andreliablequantitation of different types of MDR-related geneexpressionbyfineand sensitive methods such asRT-PCRpresented in thispaper,couldprovideapowerful toolto easily investigate possible interrelationshipsbetween these genes on a singletumoursample.The purposeof this methodological paper was not toprovidedata on treatment outcomeofpatients, but the clinical relevance of our data now needs to be investigated by prospectiveclinicalcorrelativestudies, namely by sequential semi- quantitative determinationofdifferent MDR-related gene expres- sionin termsofprediction ofresponse tochemotherapy,design of studiesaimedatreversalofdrugresistance and also in terms of the overallprognosisofbreastcarcinomas.
ACKNOWLEDGEMENTS
This workwas supported in partby the
ACT]
(Amis du Centre des Tumeurs de Tenon-Paris).Wethank MGottsman,JRobert, and JBenardfor providingcontrol celllines,MLestratforhelp in collecting dataand VGerberfor editorial assistance.REFERENCES
Abbaszadegan MR, Futcher BW, Klimecki WT, List A and Dalton W (1994) Analysisofmultidrug resistance associatedprotein (MRP) messenger RNA in normal andmalignant hematopoieticcells. Cancer Res 54: 4676-4679 AkiyamaS,FojoA, Hanover JA, PastanIand Gottesman MM(1985) Isolation and
geneticcharacterizationof human KB cell linesresistant to multiple drugs. Som Cell MolGenet 11: 117-126
Almquist KC,LoeDW,HipfnerDR, MackieJE, Cole SPC and Deeley RG (1995) Characterization of the Mr190,000MultidrugResistance Protein (MRP) in drug-selectedandtransfected humantumorcells. Cancer Res 55: 102-110 AlvarezM, Paull K, Monks A, Hose C, LeeJS,WeinsteinJ, Grever M, Bates S and
FojoT(1995) Generation ofadrugresistanceprofileby quantitation of mdr- 1/P-glycoproteininthe cell lines of the National Cancer Institute Anticancer Drug Screen. J Clin Invest 95: 2205-2214
Areci RJ(1993) Clinical significance ofP-glycoproteininmultidrugresistance malignancies.Blood81: 2215-2222
BatistG, TulpuleA, SinhaBK,KatkiAG, MyersCE andCowan K.H(1986) Overexpressionofanovel anionicglutathionetransferase inmultidrug-resistant human breast cancer cells. J Biol Chem 261: 15544-15549
Beck WT, GroganTM, WillmanCT,Cordon-CardoC,ParhamDM,Kuttesch JF, Andreeff M, BatesSE,BerardCW, Boyett JM,Brophy NA,BroxtermanHJ, ChanHSL, DaltonWS,DietelM,Fojo AT,Gascoyne RD,HeadD, Houghton PJ, SrivastavaDK, Lehnert M, Leith CP, PaiettaE, Pavelic ZP, Rimsza L, RoninsonIB, Sikic BI,TwentymanPR,Wamke R and Weinstein R(1996) Methods todetectP-glycoprotein-associatedmultidrugresistance inpatients' tumors: consensusrecommendations. Cancer Res 56: 3010-3020 B6nard JD, Silva JD, Blois MC,BoyerP,DuvillardP,Chiric E and Riou G(1985)
Characterization of human ovarian adenocarcinomaline,IGROV1,in tissue culture and in nude mice. Cancer Res 45: 4970-4979
Breuninger LM, PaulS, GaughanK, Miki T, Chan A, Aaranson SA and Kruh GD (1995)Expression ofMultidrugResistance-associatedproteininNIH/3T3cells confers multidrug resistance associated with increaseddrugefflux and altered intracellulardrug distribution. Cancer Res 55: 5342-5347
BrotherickI, Shenton BK, EganM, Cunliffe WE, BrowellDA,LuntLG, YoungJR,Higgs MJ (1996) Examination ofmultidrugresistance in cell lines andprimarybreasttumoursbyflow cytometry. Eur J Cancer 32A:
2334-2341
Cole SPC,Bhardwaj G, Gerlach JH, MackieJE, GrantCE, AlmquistKC,Stewart AJ,KurzEU, Duncan AMVandDeeleyRG (1992)Overexpressionofa transporter genein amultidrug-resistant cell line. Science258: 1650-1654 ColeSPC, SparksKE,FraserK, LoeDW,GrantCE,Wilson GM andDeeleyRG
(1994)Pharmacologicalcharacterization ofmulti-drugresistant MRP- transfected human tumor cells. Cancer Res 54: 5902-5910
CosteA, RateauJG, Roudot-ThoravalF, Chapelin C,Gilain L, Poron F, Peynegre R, Bemaudin JF and Escudier E (1996) Increasedepithelial cellproliferation in nasal polyps. Arch Otolaryngol Head Neck Surg 122: 432-436
Charpin C,VielhP,Duffaud F. Devictor B, Andrac L, LavautMN,AlasiaC, Horschowski Nand Piana L(1994) Quantitative immunocytochemical assays ofP-glycoproteinin breast carcinomas:correlation to messenger RNA expressionand toimmunohistochemical prognostic indicators. J Natl Cancer Inst86: 1539-1545
Chevillard S, Pouillart P,Beldjord C,AsselainB, BeuzebocP,Magdalena H and Vielh P(1996) Sequential assessment of multidrug resistance phenotype and measurementof S-Phasefraction as predictive markers of breast cancer response toneoadjuvantchemotherapy. Cancer 77: 292-300 Endicott JA andLing V (1989) The biochemistry of P-glycoprotein-mediated
multidrugresistance. Annu Rev Biochem 58: 137-171
Flens MJ,IzquierdoMA, Scheffer GL, Fritz JM, Meijer CJL, Scheper RJ and Zaman GJR(1994)Immunochemicaldetection of the multidrug resistance associated protein MRP in human multidrug resistant tumor cells by monoclonal antibodies. Cancer Res 54: 4557-4563
Flens MJ, ZamanGJ, van derValk P,IzquierdoMA,Schroeijers AB, Scheffer GL, vander Groep P, de Haas M,Meijer CJ andScheper RJ (1996) Tissue distribution of themultidrug resistance protein. Am J Pathol 148: 1237-1247 Fojo AT, Ueda K, Slamon DJ, Poplack DG, Gottesman MM and Pastan 1 (1987)
Expression ofamultidrug-resistance gene in human tumors and tissues. Proc NatlAcad Sci USA 84: 265-269
GilbertL,ElwoodU,Merino M, Masood S,BarnesR,Steinberg SM, Lazarous DF, Pierce L,D'Angelo T, Moscow JA, Townsend AJ and Cowan KH(1993)A pilot study ofpi-classglutathione S-transferase expression in breast cancer:
correlation with estrogen receptor expression and prognosis in node-negative breastcancer.JClinOncol 11: 49-58
Gottesman MM andPastan 1(1993)Biochemistry of multidrug resistance mediated bythemultidrugtransporter.Annu RevBiochem62: 385-427
GottesmanMM, GoldsteinU, BruggemannE,Currier SJ, Galski H, Cardarelli C, ThiebautF,WillinghamMC andPastan 1(1989) Molecular diagnosis of multidrug resistance. Cancer Cells 7: 75-80
GregorcykS,Kang Y,BrandtD, KolmP, SingerG andPerry RP(1996) P-Glycoprotein expressionas apredictor of breast cancerrecurrence.
AnnSurgOncol 3: 8-14
HennequinE, DelvincourtC, Poumy C, Jardillier JC (1993) Expression of mdrl genein human breastprimarytumorsandmetastases.BreastCancer Res Treat 26: 267-274
HorikoshiT, Danenberg KD,StadlbauerTHW, Volkenandt M, Shea LCC, Aigner K, GustavssonB,LeichmanL,FrosingR,RayM, GibsonNW, Spears CP and Danenberg PV(1992) Quantitation of thymidylate synthase, dihydrofolate reductase,andDT-diaphoroasegeneexpressionin humantumorsusingthe polymerasechain reaction. Cancer Res 52: 108-116
IshikawaT,Akimaru K,KuoMT, PriebeWandSusuki M(1995)Howdoes the MRP/GS-X pump exportdoxorubicin?JNatlCancerInst87: 1639-1640 Jedlitschky G,LeierI,BuchholzU,CenterMandKepplerD(1994)ATP-dependent
transport ofglutathioneS-conjugates bythemultidrugresistance-associated protein.Cancer Res54:4833-4836
0 Cancer Research Campaign 1998 BritishJournalofCancer(1998)77(5), 694-702
Keith WN, Stallard S and BrownR(1990)Expression of mdrl and GSTpi in human breast tumours: comparison to in vitro chemosensitivity. Br J Cancer 61:
712-716
Kuo MT, Bao J,Curley SA, Ikeguchi M, Johnston DA and Ishikawa T (1996) Frequentcoordinated overexpressionof the MRP/GS-X pump and g-glutamylcysteine synthetase genes in human colorectal cancers.
Cancer Res 56: 3642-3644
Kruh GD, Gaughan KT,Godwin A and Chan A (1995) Expression pattern of MRP in human tissues andadult solidtumorcell lines. J Natl Cancer Inst 87:
1256-1258
Merkel DE, Fuqua SAW, Tandon AK, HillSM, Buzdar AU and M Guire WL (1989) Electrophoretic analysis of 248clinical breast cancer specimens for P-glyco- protein overexpression or geneamplification.JClin Oncol7: 1129-1136 Morrow SC and Cowan KH(1993)Antineoplastic drugresistance and breastcancer.
AnnNYAcad Sci698: 289-312
MorrowCS, CowanKHandGoldsmith ME(1989) Structure of the humangenomic glutathioneS-transferase-p gene. Gene 75: 3-11
Moscow JA,Townsend AJ, GoldsmithME, Whang-Peng J, Vickers PJ, Poisson R, Legault-Poisson S, Myers CE and Cowan KE(1988) Isolation of the human anionicglutathioneS-transferase cDNA and the relation of its geneexpression toestrogen-receptorcontentinprimarybreast cancer. Proc Natl Acad Sci USA 85: 65 18-6522
MoscowJA,Fairchild CR, Madden MJ, Random DT, Wieand HS, O'Brien EE, Poplack DG, Cossman J, MyersCE and Cowan KH (1989)Expression of anionicglutathione S transferase and Pglycoproteingenes inhuman tissues and tumors. Cancer Res49: 1422-1428
Muller M, Meijer C, Zaman GJR, Borst P, Scheper RJ, Mulder NH,DVries EGE and Jansen PLM(1994)Overexpression of the gene encoding the multidrug resistanceassociated protein results in increased ATP-dependent glutathione S-conjugate transport. Proc Natl Acad Sci USA 91: 13033-13037
Noonan KE, Beck C, Holzmayer TA,Chin JE, Wunder JS, Andrulis IL, Gazdar AF, Willman CL, Griffith B, V Hoff DD and Roninson IB (1990) Quantitative analysis of MDR1(multidrug resistance) gene expression in human tumors by polymerasechainreaction. Proc Natl Acad Sci USA 87: 7160-7164 Nooter K, Westerman AM,Flens MJ, ZamanGJR, Scheper RJ, V Wingerden KE,
Burger H,Oostrum R, Boersma T,SonneveldP,Gratama JW, Kok T, EggermontAMM, BosmanFT and Stoter G(1995)Expression of the multidrug resistance-associated Protein (MRP) gene in human cancers. Clin Cancer Res1: 1301-1310
NooterK, Brutel de laRiviereG,KlijnJ, Stoter G and Foekens J (1997)Multidrug resistanceprotein in recurrent breast cancer. Lancet349: 1885-1886 OzcelikH, Mousses S and Andrulis IL(1995) Low levels of expression of an
inhibitor ofcyclin-dependent kinases (CIPl/WAFl) in primary breast carcinomas with P53mutations. Clin Cancer Res 1: 907-912
Pastan Iand GottesmanM(1987)Multiple-drug resistance in human cancer. N Engl JMed316: 1388-1393
PetersWH, Roelofs HM,van PuttenWL, Jansen JB,Klijn JG and Foekens JA (1993) Response to adjuvant chemotherapy in primary breast cancer: no correlation withexpression of glutathione S-transferases.BrJCancer68:
86-92
RoJ, Sahin A, Ro JY, Fritsche H, Hortobagyi G and Blick M (1990)
Immunohistochemicalanalysis of P-glycoprotein expression correlated with chemotherapy resistance in locally advanced breast cancer. Hum Pathol 21:
787-791
SalmonSE, Grogan TM, Miller T, Scheper R and Dalton WS (1989) Prediction of doxorubicinresistance in vitro inmyeloma, lymphoma and breast cancer by P-glycoprotein staining. J Natl Cancer Inst 81: 696-701
Sanfilippo 0, Ronchi E, DeMarco C, DiFronzo G. and Silvestrini R (1991) ExpressionofP-glycoproteinin breastcancertissue and in vitro resistanceto doxorubicin and vincristine. Eur J Cancer 27: 155-158
SchneiderWN, Bak M, Efferth TH, Kaufmann M, Marten J and Volm M (1989) P-glycoprotein expression in treated and untreated human breastcancer.
Br J Cancer 60: 815-818
SheaTC,Clafin G, Comstock KE, SandersonBJS, Burstein NA, Keenan EJ, Mannervick B and Henner WD (1990)Glutathionetransferase activity and isoenzymecomposition in primary human breastcancers.Cancer Res 50:
6848-6853
Silvestrini R, Veneroni S, Benini E, DaidoneMG,LuisiA,LeutnerM,MaucioneA, KendaR, Zucali R and Veronesi U(1997)Expressionofp53 glutathioneS- transferase-pi, and Bcl-2 proteins and benefit from adjuvant radiotherapy in breast cancer. JNatl Cancer Inst 89: 639-645
Simon SM and Schindler M(1994) Cellbiologicalmechanismsofmultidrug resistance in tumors. Proc Natl Acad Sci USA 91: 3497-3504 SlovakML, Ho JP,Bhardwaj G, Kurz EU, Deeley RG and Cole SPC (1993)
Localization of a novelmultidrug resistance-associated gene in the HT1080/DR4 andH69AR human tumor cell lines. Cancer Res53: 3221-3225 Soule HD, Vazquez A, LongA, Albert S and Brennan M(1973)Humancell line
from a pleural effusion derived from a breast carcinoma. J Natl Cancer Inst 51:
1409-1413
Tew KD(1994) Glutathione-associated enzymes in anticancer drug resistance.
Cancer Res54: 4313-4320
vanKalken CK, Pinedo HM and Giaccone G (1991)Multidrug resistance from the clinicalpoint of view. Eur J Cancer 27: 1481-1486
Verrelle P, Messonier F, Fonck Y, FeillelV,DionetC, Kwiatkoswski F, PlagneRand ChassagneJ(1991)Clinical relevance of immunohistochemical detection of multidrug resistance P-glycoprotein in breast carcinoma. J Natl Cancer Inst 83:
111-116
Wallner J,Despich D, Hopfner M, Haider K, Spona J, LudwigHandPirker R (1991) MDR1 geneexpression and prognostic factors in primary breast carcinomas. Eur J Cancer 27: 1352-1355
WeinsteinRS, Kuszak JR,KluskensLFand CoonJS (1990) P-glycoproteins in pathology:themultidrugresistance genefamilyin humans. Human Pathol21:
34-48
Wishart GC, Plumb JA,Going JJ, M Nicol AM, M Ardle CS, Tsuruo P and Kaye SB (1990) P-glycoprotein expression in primary breast cancer detected by immunocytochemistry with two monoclonal antibodies. Br J Cancer 62:
758-761
ZamanGJR, Versantvoort CHM, Smit JJM, Eijdems EWHM, d Haas M, Smith AJ, Broxterman HJ,Mulder NH, d Vries EGE, Baas F and Borst P (1993) Analysis of theexpression of MRP, the gene for a new putative transmembrane drug transporter, in humanmultidrugresistantlung cancer cell lines. Cancer Res 53:
1747-1750
ZamanGJR, Flens MJ, V Leusden MR, D Haas M, Mulder NH, Lankelma J, Pinedo J,Scheper HM, Baas RJ, Broxterman HJ and BorstP(1994) The human multi- drug resistance-associated protein MRP is a plasma membrane drug-efflux pump. ProcNatl Acad Sci USA 91: 8822-8826
ZamanGJR,LankelmaJ, VTellingen0, BeijnenJ,Dekker H, Paulusma C, Elferink RPJO, Baas RJ and Borst P (1995) Role of glutathione in the export of compounds from cells by the multidrug-resistance-associated protein. Proc Natl Acad Sci USA 92:7690-7694
ZijlstraJG, D Vries EGE and Mulder NH (1987) Multifactorial drug resistance in an adriamycin-resistanthuman small cell lung carcinoma cell line. Cancer Res 47:
1780-1784