• Aucun résultat trouvé

Characterization of cancer/testis antigen MAGE-A11 for immunotherapy of prostate cancer

N/A
N/A
Protected

Academic year: 2021

Partager "Characterization of cancer/testis antigen MAGE-A11 for immunotherapy of prostate cancer"

Copied!
100
0
0

Texte intégral

(1)

Characterization of Cancer/Testis Antigen MAGE-A11

for Immunotherapy of Prostate Cancer

Mémoire

Ehsan Dadvar

Maîtrise en microbiologie-immunologie

Maître ès sciences (M.Sc.)

(2)
(3)

Résumé

Les antigènes testiculaires du cancer sont des cibles idéales pour l’immunothérapie du cancer car ce sont des protéines immunogéniques dont l’expression est restreinte aux cellules germinales et au cancer. Le but de cette étude est d’évaluer le potentiel de MAGE-A11, un antigène testiculaire du cancer, comme cible pour développer un vaccin contre le cancer de la prostate. Pour ce faire, l’anticorps monoclonal 5C4 qui a la capacité de reconnaître la présence de MAGE-A11 dans les tissus fixés et inclus en paraffine a été produit. De plus, l’expression de MAGE-A11 a été analysée sur plusieurs lignées de cellules cancéreuses. Il a été démontré que MAGE-A11 est exprimé dans plusieurs types de cancers notamment dans le cancer du côlon et du cerveau. Finalement, nous avons identifié trois épitopes du CMH classe II HLA-DR1 dans la protéine MAGE-A11 confirmant ainsi l’immunogénicité de cet antigène et son potentiel comme cible pour l’immunothérapie du cancer.

(4)
(5)

Abstract

Cancer/testis antigens are ideal targets for cancer immunotherapy because of their limited expression in normal tissues, aberrant expression in malignancies and their immunogenic properties. The aim of this study was to evaluate the potential of cancer/testis antigen, MAGE-A11, as an immunotherapeutic target for development of a prostate cancer vaccine. To accomplish this, we produced the monoclonal antibody 5C4 that is capable of recognizing MAGE-A11 in formalin-fixed paraffin-embedded tissues. We also investigated the expression of MAGE-A11 in a wide variety of cancer cell lines to determine the scope of its expression in cancer. It was shown that MAGE-A11 is widely expressed in malignancies. The highest MAGE-A11 expression was observed in colon cancer and astrocytoma brain tumors. Finally, we identified three naturally processed MHC class II HLA-DR1 epitopes in MAGE-A11 protein, thus confirming its immunogenicity and its potential as a target for cancer immunotherapy.

(6)
(7)

Table of Contents

Résumé III

Abstract V

List of Tables IX

List of Figures XI

List of Abbreviations XIII

Acknowledgements XV

Chapter 1: Introduction 1

Prostate Cancer 2

Risk Factors 2

Screening for Prostate Cancer 3

Diagnosis and Staging 3

Management of Prostate Cancer 5

Immunotherapy 6

Antigen Recognition by T cells 7

Antitumor immunity 10

Immunotherapy of Prostate Cancer 14

Sipuleucel-T 14

Strategies for Immunotherapy of Cancer 16

Tumor-Associated Antigens 17

Cancer/Testis Antigens 19

MAGE-A Family 21

MAGE-A11 23

Hypothesis and Specific Aims 26

Chapter 2: Characterization of MAGE-A11 expression in cancer 27

Introduction 28

Material and Methods 30

Results 35

Discussion 38

Tables and Figures 41

Chapter 3: Identification of HLA-DR1-Restricted CD4+ T-Cell Epitopes in the

Cancer/Testis Antigen MAGE-A11 51

Contributions of Authors 52

Abstract 54

Introduction 55

Material and Methods 56

Results 59

Discussion 61

Tables and Figures 65

Chapter 4: Conclusion 73

(8)
(9)

List of Tables

Chapter 1

Table 1. Tumor node metastasis stage definitions for prostate cancer _____________________________________ 4 Table 2. List of selected known X- and non-X CT antigens _____________________________________________ 19 Chapter 2

Table 1. List of all the tumor cell lines screened for MAGE-A11 expression ________________________________ 41 Table 2. Expression of MAGE-A11 mRNA as detected by RT-PCR in cancer cell lines of various origins _________ 42 Chapter 3

Table 1. MAGE-A11 peptides with highest HLA-DR binding probability predicted by SYFPEITHI epitope prediction algorithm ____________________________________________________________________________________ 65 Table 2. Determination of the minimal epitope contained within p149-163 by aligning the overlapping peptides that induced a CD4+ T cell proliferation ________________________________________________________________ 68 Table 3. Confirmation of the minimal epitope contained within p149-163 by aligning the truncated peptides that induced a CD4+ T cell proliferation ________________________________________________________________________ 70

(10)
(11)

List of Figures

 

Chapter 1

Figure 1. Management of prostate cancer ___________________________________________________________ 6 Figure 2. The T-cell receptor resembles a membrane-bound immunoglobulin _______________________________ 7 Figure 3. The structure of MHC class I and MHC class II molecules _______________________________________ 8 Figure 4. Schematic representation of MHC class I pathway for antigen processing and presentation ____________ 9 Figure 5. Schematic representation of MHC class II pathway for antigen processing and presentation ___________ 10 Figure 6. Functional differentiation of Th cells _______________________________________________________ 11 Figure 7. The role of Th1 cells in modulating antitumor immunity ________________________________________ 12 Figure 8. Mechanism of action of sipuleucel-T _______________________________________________________ 15 Figure 9. Shared characteristics of germ cells and cancer cells _________________________________________ 21 Figure 10. Phylogenetic tree of MAGE-A proteins ____________________________________________________ 22 Figure 11. Modulation of AR transcriptional activity by MAGE-A11 _______________________________________ 24 Chapter 2

Figure 1. Antibody titer in the serum of mice immunized with the recombinant MAGE-A11 protein ______________ 43 Figure 2. Selection of mAbs specific to MAGE-A11 by ELISA ___________________________________________ 44 Figure 3. Selection of mAbs specific to MAGE-A11 by IHC _____________________________________________ 45 Figure 4. Selection of mAb 5C4 __________________________________________________________________ 46 Figure 5. Western blot analysis of the reactivity of mAb 5C4 with MAGE-A recombinant proteins _______________ 47 Figure 6. IHC analysis of the reactivity of mAb 5C4 with MAGE-A3 ______________________________________ 48 Figure 7. Antibody titer in the serum of mice immunized with the synthetic peptides _________________________ 49 Figure 8. Western blot analysis of the reactivity of the mouse #1 serum to MAGE-A recombinant proteins ________ 50 Chapter 3

Figure 1. CD4+ T cell recognition of MAGE-A11 peptides in proliferation assay _____________________________ 66 Figure 2. CD4+ T cell recognition of overlapping MAGE-A11 peptides in proliferation assay ___________________ 67 Figure 3. CD4+ T cell recognition of truncated MAGE-A11 peptides in proliferation assay _____________________ 69 Figure 4. Avidity of CD4+ T cell epitope p149-163 for HLA-DR01 ________________________________________ 71

(12)
(13)

List of Abbreviations

AF2: Activation function 2 AR: Androgen receptor

APC: Antigen-presenting cell BCR: B-cell receptor

BCG: Bacillus Calmette-Guérin BSA: Bovine serum albumin CT: Cancer/testis

CRPC: Castration resistant prostate cancer cDNA: Complementary DNA

CTL: Cytotoxic T lymphocyte

CTLA-4: Cytotoxic T-lymphocyte antigen 4 DRE: Digital rectal examination

DMSO: Dimethyl sulfoxide ER: Endoplasmic reticulum

ELISA: Enzyme-linked immunosorbent assay FFPE: Formalin-fixed paraffin-embedded

GM-CSF: Granulocyte-macrophage colony-stimulating factor HER2: Human epidermal growth factor receptor 2

HLA: Human leukocyte antigen HPV: Human papillomavirus

HIF-1α: Hypoxia-inducible factor-1α

PHD2: Hypoxia-inducible prolyl hydroxylase-2 IHC: Immunohistochemistry

iTreg: Induced regulatory T cell IFN: Interferon

IL: Interleukin

(14)

MHC: Major histocompatibility complex MAGE-A: Melanoma antigens-A

mAb: Monoclonal antibody

N/C interaction: N- and C-terminal interaction NK: Natural killer

PBMC: Peripheral blood mononuclear cell PBS: Phosphate buffered saline

PCR: Polymerase chain reaction PVDF: Polyvinylidene difluoride PSA: Prostate-specific antigen PAP: Prostatic acid phosphatase

RT-PCR: Reverse transcription-polymerase chain reaction Th: T helper

TCR: T-cell receptor

TIF2: Transcriptional mediator protein 2 TGF: Transforming growth factor

TAP: Transporter associated with antigen processing TBS: Tris-buffered saline

TNF: Tumor necrosis factor TNM: Tumor node metastasis TAA: Tumor-associated antigen

(15)

Acknowledgements

First and foremost, I would like to acknowledge my supervisor, Dr. Yves Fradet, for giving me the incredible opportunity of being a member of his amazing team. I am grateful to Dr. Hélène LaRue for her support and advice throughout my graduate studies. I would especially like to thank Dr. Alain Bergeron for his mentorship, encouragement and support. His generosity to share his skills and knowledge has meant a lot to me.

I additionally need to thank past and current lab members for providing technical support, scientific discussion and friendship.

Last, but not least, I could not be more thankful to my family for their unconditional love and mental support throughout this process. Without them, none of this would have been possible.

(16)
(17)
(18)

Prostate Cancer

Prostate cancer is the most commonly diagnosed male malignancy in North America [1, 2]. It is estimated that in 2013, approximately 23,600 new cases and 3,900 prostate cancer-related deaths will occur in Canada [2]. Prostate cancer is the third leading cause of cancer death in men, exceeded only by lung and colorectal cancer [1, 2]. It accounts for 25% of all new male cancer cases and 10% of male cancer-related deaths in Canada [2]. One in 7 men will develop prostate cancer during his lifetime and one in 28 will die of it [2].

Risk Factors

The exact etiology of prostate cancer is unknown. However, some factors were shown to increase the risk of developing it. The established risk factors are age, race and family history.

Age is the most significant risk factor for prostate cancer. The incidence of prostate cancer increases exponentially with age. In fact, 80% of all prostate cancers are diagnosed in men over 60 years old and 95% of men who die from the disease are in this age group [2].

Race also plays a significant role in the development of prostate cancer. African American men are 60% more likely to develop prostate cancer compared with white men and are twice as likely to die from the disease [3].

In a subset of men, genetics also plays an important role in the development of prostate cancer. Men with a first-degree relative with prostate cancer have a two-fold increased risk of developing the disease [4]. The risk is further heightened by early age at onset in relatives and multiple relatives with the disease. The risk of prostate cancer may also increase in men with a first-degree female relative with breast or ovarian cancer [5]. Linkage analysis suggests that mutations at the BRCA2 site are associated with higher risk in developing prostate cancer [6].

(19)

Screening for Prostate Cancer

Prostate cancer has no symptoms until it reaches advanced stage. However, it is possible to detect prostate cancer early by testing the amount of prostate-specific antigen (PSA) in a man's blood. PSA is a proteolytic enzyme contributed by the prostate to seminal fluid, some of which permeates into the bloodstream. A high PSA level can indicate cancer, but false positives can happen with PSA tests as there are other possible reasons for an elevated PSA level such as benign prostatic hyperplasia or prostatitis [3].

Another way to find prostate cancer is the digital rectal examination (DRE), in which the examiner inserts a finger into the rectum to check prostate’s size and shape and whether any lumps are present. Although PSA test has been shown to be more sensitive than DRE in detecting prostate cancer, up to 20% of men with clinical prostate cancer have a normal PSA level, thus emphasizing the importance of DRE [7].

Diagnosis and Staging

Patients suspected of having prostate cancer from an abnormal DRE or an elevated serum PSA undergo biopsy of the prostate. A biopsy is necessary to make a definite diagnosis of cancer. Once the diagnosis is made, the biopsy specimen is given a score, known as the Gleason Score, based upon its microscopic appearance. Cancers with poorly differentiated cells have a higher Gleason score and are more aggressive.

The stage of cancer is another important prognostic information. In fact, staging is one of the most important predictor of survival, and cancer treatment is primarily determined by this factor. The stage of prostate cancer is based on the size and extension of the primary tumor, its lymphatic involvement, and the presence of metastases (Table 1).

(20)

Table 1. Tumor node metastasis (TNM) stage definitions for prostate cancer (Adapted from Cancer Staging Manual (7th Edition) by the American Joint Committee on Cancer) [8].

(21)

Management of Prostate Cancer

Currently, at the time of diagnosis, more than 80% of prostate cancer cases present as localized disease and are treated by radical prostatectomy and/or radiation therapy with curative intent [9, 10]. However, approximately 15% of these men will experience treatment failure, manifested initially as an increasing serum PSA level, and ultimately develop metastatic prostate cancer (Figure 1) [11].

The standard treatment for metastatic prostate cancer is hormone therapy [10]. Hormone therapy works by depriving prostate cancer cells of androgen that they need for survival. This androgen deprivation can be accomplished surgically, through the removal of the testicles, or by using medication that prevents the production of androgen or blocks its effect on prostate cells. Despite excellent initial responses to hormonal castration in about 80% of patients with metastatic disease, prostate cancer cells eventually become castration resistant and the tumor continues to grow [12].

At this stage of the disease, the treatment options are limited and not very effective. Men with castration resistant prostate cancer (CRPC) have a median survival of 9-13 months [13]. The primary treatment for castration-resistant disease is docetaxel-based chemotherapy [10, 12]. However, chemotherapy is associated with severe side effects and only extends median survival by two to three months [14]. There are treatment options available for those patients who have failed docetaxel therapy, namely abiraterone and cabazitaxel [15]. Nevertheless, none of these treatments are curative; they merely provide a modest survival advantage [15]. Novel treatments for advanced prostate cancer are desperately needed.

(22)

Figure 1. Management of prostate cancer.

Immunotherapy

With an increased understanding of basic immunology, combined with the identification of various tumor-associated antigens (TAAs), immunotherapy has emerged as a promising new approach for the treatment of cancer. The aim of immunotherapy is to target the patients’ immune system to induce an antitumor response. This approach is based on the concept of immune surveillance – the ability of the immune system to search for and destroy transformed cells [16]. The idea that the immune system is capable of anticancer immunity is supported by the increased incidence of cancer in immunodeficient mice, as well as in immunocompromised individuals [17, 18].

(23)

Antigen Recognition by T cells

The key cells of the immune system for tumor surveillance are T cells, which are part of the adaptive immune response [19]. The adaptive immune response is comprised of B cells and T cells that use different, but structurally similar, molecules to recognize antigen (Figure 2) [20]. The antigen-recognition molecules of B cells, immunoglobulins, are made both as a cell-surface receptor, the B-cell receptor (BCR), and as secreted antibodies. In contrast, the antigen-recognition molecules of T cells, the T-cell receptor (TCR), exist only at the cell surface. Immunoglobulins and TCRs are highly variable molecules, with the variability concentrated in the antigen-binding site. Each B and T cell produces receptors of a single specificity that bind to one particular epitope.

Figure 2. The T-cell receptor resembles a membrane-bound immunoglobulin (Adapted from Janeway’s Immunobiology) [20].

(24)

Unlike BCR, however, TCR does not recognize an antigen in its native state. In fact, TCR can recognize only short peptide fragments of protein antigens, which are presented by proteins known as MHC molecules [21]. The MHC molecules are transmembrane glycoproteins encoded in the large cluster of genes known as the major histocompatibility complex (MHC). The human MHC, also known as the human leukocyte antigen (HLA) complex, codes for two classes of MHC molecules, MHC class I and MHC class II, that differ in both their structure (Figure 3) and in their expression pattern in the body.

Figure 3. The structure of MHC class I and MHC class II molecules (Adapted from Janeway’s Immunobiology) [20].

All nucleated cells, with the exception of certain immunoprivileged sites, express MHC class I molecules, which present short peptides of 8-10 amino acids derived from endogenous proteins that are degraded in the cytosol by the proteasome (Figure 4). The degradation products of such proteins are transported by the transporter associated with antigen processing (TAP) into the endoplasmic reticulum (ER) to be loaded onto newly formed MHC class I molecules, which are finally exported to the cell surface through the Golgi apparatus [22]. The MHC class I antigen presentation pathway enables CD8+ cytotoxic T lymphocytes (CTLs) to detect and eliminate transformed or infected cells displaying peptides from TAAs or

(25)

foreign proteins on their surface MHC class I molecules. HLA genes are extremely polymorphic and each MHC class I molecules can only bind peptides presenting specific binding motifs. It should, however, be noted that MHC class I molecules may significantly overlap in their peptide binding specificity and “promiscuous” peptides capable of binding several class I molecules have been identified [23]. These promiscuous peptides are ideal for vaccination as they could be used in patient populations expressing diverse MHC class I alleles.

Figure 4. Schematic representation of MHC class I pathway for antigen processing and presentation (Adapted from Antigen Processing by Sandberg et al.) [22].

MHC class II molecules, on the other hand, are predominantly expressed on antigen-presenting cells (APCs) [24]. Their function is to present peptides of 13-17 amino acids that are derived primarily from exogenous antigens to CD4+ T cells (Figure 5). In this pathway, exogenous proteins are taken up by APCs and degraded via the endocytic pathway. Newly synthesized MHC class II molecules

(26)

are then targeted to the resulting endocytic compartment where peptides generated from endocytosed proteins are loaded onto MHC class II molecules and transferred to the cell surface [22]. Similar to MHC class I molecules, promiscuous peptides capable of binding multiple MHC class II types exist [25]. These promiscuous peptides have been found to bind to HLADR0101, DR0401, -DR0701, and -DR1101, which are the most frequently found MHC class II alleles [26].

Figure 5. Schematic representation of MHC class II pathway for antigen processing and presentation (Adapted from Antigen Processing by Sandberg et al.) [22].

Antitumor immunity

CTLs are major players of antitumor immune responses, as they exhibit cytotoxic activity toward tumor cells expressing TAAs. TAAs are molecules that are abnormally expressed in tumor cells and have no or limited expression in normal tissues. CTLs kill targets that display the same tumor-associated peptide bound to MHC class I molecules that triggered their activation. This specificity of CTL

(27)

effector function ensures the destruction of cancer cells in primary or metastatic lesions with minimal collateral damage to normal cells. For optimal expansion and function of CTLs, CD4+ T helper (Th) cells are required [27, 28].

Th cells are central to the development of antitumor immunity as they orchestrate the immune response by activating and directing other immune cells. CD4+ T cells can be divided into Th1, Th2, Th17 and induced regulatory T (iTreg) cells based on their function and distinct cytokine secretion profile [29]. The fate and function of the activated CD4+ T cells are decided during the initial antigen encounter and is largely regulated by the local cytokine milieu (Figure 6) [29]. In contrast to other Th cell populations, Th1 cells and the cytokines that they produce are strongly associated with good clinical outcome for all cancer types [30].

Figure 6. Functional differentiation of Th cells (Adapted from Phenotypical and functional specialization of FOXP3+ regulatory T cells by Campbell et al.) [31]

(28)

Th1 cells secrete interleukin (IL)-2 and interferon (IFN)-γ and are responsible for cell-mediated immunity. These cells are critical in antitumor immunity as they enhance CTL response by activating APCs and by secreting IL-2, an essential cytokine in the maintenance of CTLs (Figure 7) [27]. Th1 cells activate APCs through CD40/CD40L engagement and secretion of IFN-γ [32]. The activation of APCs by Th cells is of crucial importance as the lack of properly activated APCs can induce tolerance rather than activation of CD8+ T cells [32]. Th1 cells can also induce antitumor effect independent of CD8+ T cells, by recruiting and activating innate immune cells such as natural killer (NK) cells and macrophages [33]. Furthermore, they mediate anti-angiogenic effects via their ability to secrete IFN-γ [34].

Figure 7. The role of Th1 cells in modulating antitumor immunity (Adapted from The role of MHC class II-restricted tumor antigens and CD4+ T cells in antitumor immunity by R. Wang) [32].

(29)

Th2 cells secrete IL-4, IL-5 and IL-13 and provide help to B cells enabling them to develop into antibody-secreting plasma cells. The role of Th2 cells in antitumor immunity is complex; Th2 response can either enhance tumor clearance or promote tumor growth depending on the cytokines combination involved [35]. In immunotherapy, Th2 response is generally avoided due to its ability to suppress Th1 arm of the immune response.

Th17 cells produce cytokines of the IL-17 family and are involved in mucosal immunity and inflammation. Similar to Th2-mediated immunity, there are contradictory results involving the role of Th17 cells in antitumor immune response [30]. TH17 cells have been reported to be associated with poor prognosis in colorectal, lung and liver cancer, while they have been reported to predict better survival in some esophageal and gastric cancers [30].

ITreg cells produce transforming growth factor (TGF)-β and IL-10, potent inhibitory cytokines with the ability to suppress immune responses. While important for the prevention of autoimmunity, iTregs can hinder antitumor immune responses. Their presence in tumors correlates with poor prognosis in cancer [36].

NK cells of the innate immune system also play an important role in antitumor immunity. NK cells directly kill targets that have downregulated MHC class I expression or upregulated activating ligands of NK cells (induced by cellular stress or infection). MHC class I downregulation is an important mechanism of immune evasion from CTL-mediated lysis [37], highlighting the importance of NK cells in tumor immunosurveillance. Furthermore, NK cells release large amounts of pro-inflammatory cytokines such as IFN-γ after stimulation. By producing IFN-γ, activated NK cells upregulate MHC class I and II antigen expression by APCs, help CD4+ T cell differentiation toward Th1 response and also induce CD8+ T cells to become CTLs [38].

(30)

Immunotherapy of Prostate Cancer

Several factors make prostate cancer an ideal target for immunotherapy. First, prostate cancer is a relatively slow-growing cancer, allowing ample time for an immunotherapy to induce an antitumor response [39]. Second, the prostate is a nonessential organ. Therefore, a tissue-specific immune response would not be expected to have significant negative consequences. Third, androgen ablation, the standard treatment for metastatic prostate cancer, enhances the efficacy of immunotherapy by mitigating CD4+ T cell tolerance to prostate-specific TAAs, and by increasing T cell and macrophage infiltration into the prostate gland [40]. Finally, prostate cancer is responsive to active immunotherapy, as evidenced by the clinical efficacy of sipuleucel-T vaccination [41-43].

Sipuleucel-T

Sipuleucel-T (Provenge®) is the first antigen-specific immunotherapy approved by

the U.S. Food and Drug Administration (FDA) for cancer treatment (approved in 2010). It is an autologous cellular immunotherapy for patients with asymptomatic or minimally symptomatic metastatic CRPC [41]. It is a personalized product that is individually manufactured for each patient (Figure 8).

Treatment begins with leukapheresis to isolate a patient’s peripheral blood mononuclear cells (PBMCs). These PBMCs are then activated ex vivo by a recombinant fusion protein composed of the full-length human prostatic acid phosphatase (PAP) and of the granulocyte-macrophage colony-stimulating factor (GM-CSF). The GM-CSF portion helps APCs to uptake the fusion protein and to mature, whereas the PAP, a prostate specific enzyme present in 95% of prostate cancer cells, is the antigen load to be processed [44]. Activated APCs are reinfused back into the patient to activate PAP-specific CD4+ and CD8+ T cells. These activated T cells are then thought to home to tumor lesions, mediating an antitumor response [43]. The process is repeated at two-week intervals for three treatments.

(31)

Treatment with the therapeutic cancer vaccine sipuleucel-T results in a 4.1-month improvement in median survival and an improvement in the rate of 3-year survival (32% for patients receiving sipuleucel-T, as compared with 23% for those receiving placebo) [45]. The benefits of sipuleucel-T, however, come at a high cost; sipuleucel-T therapy costs $93,000 per patient for a complete course of three doses [46]. Given the high price for a modest effectiveness, sipuleucel-T is unlikely to be cost-effective [47]. Nevertheless, the success of this treatment suggests that other immunotherapeutic approaches could be investigated targeting additional antigens.

Figure 8. Mechanism of action of sipuleucel-T (Adapted from Immunotherapy for the treatment of

(32)

Strategies for Immunotherapy of Cancer

Cancer immunotherapy is categorized into passive immunotherapy and active immunotherapy. Passive immunotherapy involves administration of immunotherapeutic agents that exert direct antitumor effects. No sustained, reproducible antitumor immune responses are generated. Monoclonal antibody (mAb) therapy is the most widely used form of passive cancer immunotherapy [48]. Monoclonal antibodies are used to target molecules expressed on the surface of tumor cells [49]. For example, the anti-human epidermal growth factor receptor 2 (HER2) mAb, trastuzumab (Herceptin®), has been successfully used to treat breast

cancer patients that overexpress the cell surface TAA HER2 [50]. Trastuzumab binds to the extracellular domain of HER2, which induces its downregulation via endocytosis and inhibits important signalling pathways, thereby blocking tumor cell-cycle progression [51].

A more recent application of mAb therapy is to block immune checkpoints, unleashing the full potential of the antitumor immune response [52]. Ipilimumab (Yervoy™), a monoclonal antibody that antagonises cytotoxic T-lymphocyte antigen 4 (CTLA-4), is the first of this class of immunotherapeutics to achieve FDA approval [52]. CTLA-4 is a key negative regulator of T cell responses, inhibiting recognition of self-antigens by T cells and has the ability to downregulate the antitumor immune response. Binding of ipilimumab to CTLA-4 blocks transmission of regulatory signal and induce the function of effector T cells [53]. Encouraging trial results of ipilimumab for treatment of advanced melanoma have bolstered interest in the use of ipilimumab to treat other types of cancer including advanced prostate cancer [54]. Currently, two phase III clinical trials are investigating the efficacy of ipilimumab therapy for metastatic CRPC [54, 55].

Active immunotherapy, on the other hand, stimulates the patient’s immune system to generate effector T lymphocytes capable of mounting a long-term antitumor response. Active immunotherapy can be classified into nonspecific therapy, where

(33)

the immunotherapeutic agent induces a generalized upregulation of the host immune system or specific immunotherapy, where immune activation is targeted toward a specific TAA.

An example of nonspecific active immunotherapy is the use of Bacillus Calmette-Guérin (BCG) for localized bladder cancer. BCG, a live attenuated form of

Mycobacterium bovis, is injected directly into the bladder, where it induces

generalized inflammatory immune responses that appear to correlate with antitumor activity [56].

Specific active immunotherapy is mediated through cancer vaccines. Unlike traditional vaccines, which are prophylactic in nature, these vaccines have been used predominantly for the treatment of established disease. This presents a much more formidable challenge as these vaccines need to overcome the mechanisms of tolerance that have already been established to allow the tumor to progress [57, 58]. A number of different types of cancer vaccines have been investigated for their ability to generate strong immune responses to treat cancer. These include peptide-based, dendritic cell, whole tumor cell, DNA, and viral vector-based vaccines [59]. Despite numerous attempts to utilize therapeutic cancer vaccines, so far sipuleucel-T is the only cancer vaccine to achieve FDA approval.

Therapeutic vaccination for cancer treatment depends on T cell response to TAAs. Thus, the first and most crucial step in developing a successful specific active immunotherapy is identification and characterization of TAAs.

Tumor-Associated Antigens

TAAs are antigenic molecules that are abnormally expressed in tumor cells. For TAAs to be potential immunotherapeutic targets, the antigen must be immunogenic i.e. recognized by the immune system and have no or highly restricted expression in normal tissues so that autoimmunity can be prevented.

(34)

Cancer antigens fall into at least five different categories:

1. Overexpressed or aberrantly expressed cellular proteins. Epidermal growth factor receptor, HER2, which is overexpressed in 30% of breast cancers, is an example of this group of tumor antigens [51].

2. Tissue differentiation antigens. These antigens are molecules expressed by one particular type, and also by cancer cells derived from that tissue-type. PAP, the target of sipuleucel-T, is a tissue differentiation antigen that has been utilized as an immunotherapeutic target with success.

3. Mutated antigens. Neoplastic transformation results from genetic alterations, some of which may lead to the expression of mutated self-antigens that are seen as non-self by the immune system [60]. Examples of mutated antigens are mutated Ras or p53 [60].

4. Viral antigens. Infection with certain viruses such as human papillomavirus (HPV) can cause cancer. Therefore, vaccines that target theses tumor-inducing viruses can prevent cancer. For example, Gardasil®, that targets

the HPV major capsid protein, L1, is capable of preventing certain types of cervical cancer [61].

5. Cancer/testis (CT) antigens. CT antigens are a unique group of proteins normally expressed in the testis but aberrantly expressed in several types of cancers [62]. Because germ cells do not express MHC molecules [63], CT antigens can be considered specific to tumor cells as far as the immune system is concerned.

(35)

Cancer/Testis Antigens

At present, there are more than 100 families and 200 members of CT antigens, with their functions largely unknown (Table 2) [64]. CT antigens are broadly grouped into two classes based on the chromosomal location of their genes [62]. The genes encoding X-CT antigens are located on the X chromosome and the genes encoding non-X CT antigens are located on the autosomes. X-CT antigens represent more than half of all CT antigens identified to date [65]. They constitute several families of homologous genes, organized in well-defined clusters along the X chromosome [65]. In normal testis, X-CT antigens are expressed primarily on the spermatogonia that are the proliferating germ cells [62]. X-CT genes are frequently co-expressed in cancer cells, suggesting common mechanisms for regulation of these genes [62]. The genes encoding non-X CT antigens, however, are distributed throughout the genome. In the testis, non-X CT antigens are expressed in the spermatocytes and many have roles in meiosis [62].

Table 2. List of selected known X- and non-X CT antigens (Adapted from The biology of cancer testis antigens: putative function, regulation and therapeutic potential by Fratta et al.) [66].

(36)

Studies on the expression of CT antigens have shown that epigenetic events, such as DNA methylation, are the primary mechanism regulating the expression of CT antigens in germ cells and transformed cells [66]. In normal somatic tissues, CT genes have methylated promoters and are not expressed [67]. However, during the epigenetic reprogramming that occurs in many tumors, CT gene promoters become hypomethylated, triggering their aberrant expression [68, 69]. The underlying mechanisms leading to DNA hypomethylation in cancer have not yet been clearly elucidated. The expression of CT antigens can be induced in tumor cells that do not express them by DNA methyltransferase inhibitors such as decitabine (5-aza-2'deoxycytidine) [66, 67].

While the functions of many of these CT antigens remain unknown, expression of CT antigens has been associated with advanced disease and poorer prognosis, suggesting a key role of CT antigens in tumorigenesis [70]. Given the similarities between germ cells and cancer cells (Figure 9), it seems likely that CT antigens have an important function in disease progression and could, therefore, be useful for prognosis and treatment of cancers [62, 70].

CT antigens are highly immunogenic [62]. In fact, many CT antigens have been identified as immune targets of an immune response in cancer patients by either T cell epitope cloning or analysis of serum antibody specificity [71]. In light of their limited expression in normal tissues, aberrant expression in cancer and their antigenic properties, CT antigens are ideal targets for cancer vaccines.

(37)

Figure 9. Shared characteristics of germ cells and cancer cells (Adapted from Cancer/testis antigens, gametogenesis and cancer by Simpson et al.) [62]

MAGE-A Family

The best-studied CT antigens are those of melanoma antigens-A (MAGE-As). The MAGE-A gene family is located near the end of the long arm of the X chromosome at Xq28 and is comprised of 12 family members called MAGE-A1 to MAGE-A12 (Figure 10) [72].

(38)

Figure 10. Phylogenetic tree of MAGE-A proteins. MAGE-A5, a truncated protein, and MAGE-A7, a pseudogene, are not shown.

MAGE-As are the first CT antigens to be discovered. In 1991, Boon and his colleagues reported the identification of MAGE-A1 as the target of a spontaneous CTL response in a melanoma patient with an unusually favorable clinical course [73]. Since then, this gene family has expanded and the MAGE-As have attracted attention as potential targets for immunotherapy [74]. The tumor expression of MAGE-As, however, is not restricted to melanoma. MAGE-As are now known to be highly expressed in a wide range of cancers including lung, breast, ovarian and bladder cancers [6, 75, 76].

Although the biological functions of MAGE-As in both germ cells and tumors are not known, recent studies provide experimental evidence that the expression of MAGE-As contributes to the malignant phenotype [75]. In one study, for example, the relationship between sensitivity to tumor necrosis factor (TNF) α and expression of MAGE-A1, A2 and A3 was examined in a range of human cancer cell lines [77]. It was found that cell lines that express at least one of the three MAGE-A genes were more resistant to TNF-α-mediated cytotoxicity. Other experiments have shown that overexpression of MAGE-A2 or -A6 genes leads to the acquisition of resistance to the widely used chemotherapeutic drugs paclitaxel and doxorubicin in human cancer cell lines [78]. Resistance to drugs such as these is typical of

(39)

aggressive cancer phenotypes. Moreover, it has been shown that MAGE-As could act as corepressors of p53 tumor suppressor gene. MAGE-A1, A2, A3 and A6 inhibit p53 transactivation function by recruiting transcriptional repressor histone deacetylase to sites of p53 interaction at promoters [79, 80]. Inhibition of p53 by these MAGE-As might explain the resistance of tumor cells expressing them to apoptosis.

MAGE-A antigens are considered as promising candidates for cancer immunotherapy, as they exhibit broad expression profiles among malignancies and are associated with disease progression and poor prognosis. Several clinical trials involving MAGE-As are ongoing, notably two phase III clinical trials that target MAGE-A3 in patients with melanoma and non-small cell lung cancer [65].

MAGE-A11

MAGE-A11 is a particularly fascinating CT antigen. Unlike the majority of CT antigens who have an unclear function in cancer, MAGE-A11 appears to directly contribute to prostate cancer progression by enhancing the activity of the androgen receptor (AR) (Figure 11) [81]. More specifically, MAGE-A11 binds to the AR N-terminal FXXLF motif and competitively inhibits the androgen-dependent N- and C-terminal (N/C) interaction as the same AR FXXLF motif that binds MAGE-A11 also binds activation function 2 (AF2) in the AR C terminus [82, 83]. Therefore, MAGE-A11 increases accessibility of AF2 for p160 coactivators’ recruitment and enhances the AR transcriptional activity. MAGE-A11 also increases the AR transcriptional activity through direct interactions with histone acetyltransferase p300 and transcriptional mediator protein 2 (TIF2), a p160 coactivator [83, 84].

(40)

Figure 11. Modulation of AR transcriptional activity by MAGE-A11. MAGE-A11 binds to the AR N-terminal FXXLF motif and inhibits the androgen-dependent N/C interaction. Therefore, MAGE-A11 increases accessibility of AF2 for p160 coactivators’ recruitment and enhances the transcriptional activity of the AR. (Adapted from Melanoma Antigen Gene Protein MAGE-11 Regulates Androgen

Receptor Function by Modulating the Interdomain Interaction by Bai et al.) [82].

During the transition to castration-recurrent growth, MAGE-A11 expression is upregulated, suggesting that stabilization of AR by MAGE-A11 is one mechanism to promote prostate cancer progression [85]. Furthermore, MAGE-A11 can interact with hypoxia-inducible prolyl hydroxylase-2 (PHD2) and inhibit its activity, leading to the stabilization of hypoxia-inducible factor-1α (HIF-1α) [86]. Hypoxia-inducible factors are responsible for tumor angiogenesis and activation of enzymes supporting anaerobic glycolysis and high-glucose consumption, permitting tumor cells to survive in low oxygen conditions that are characteristic of the tumor cell environment [86]. Another way MAGE-A11 appears to contribute to the malignant phenotype is by alteration of sensitivity of cancer cells to chemotherapy. In fact, the expression of MAGE-A11 is associated with a significantly poorer efficacy of various widely used chemotherapeutic agents, namely diamindichloridoplatin, cisplatin, 5-fluorouracil, docetaxel and paclitaxel [87]. Given that docetaxel is the

(41)

primary treatment option for CRPC, MAGE-A11 expression could be one of the mechanisms used by prostate cancer cells to grow during chemotherapy.

The expression of MAGE-A11 is not limited to CRPC; MAGE-A11 expression is also described in head and neck cancer, breast cancer, and non-small cell lung cancer [87-89]. A recent study by Lian et al. has shown that MAGE-A11 is expressed in more than 50% of breast cancer patients and that there is a negative correlation between MAGE-A11 expression and long-term survival of these patients [88]. These findings highlight the effect of MAGE-A11 on the aggressiveness of tumors and validate its potential as a target for treatment of cancer.

(42)

Hypothesis and Specific Aims

CT antigens are ideal targets for cancer vaccines because of their limited expression in normal tissues, aberrant expression in cancer and their immunogenic properties. The objective of my research project is to evaluate the potential of the CT antigen, MAGE-A11, as an immunotherapeutic target for the development of a prostate cancer vaccine. We hypothesize that MAGE-A11 can be used as an immunotherapeutic target for treatment of advanced prostate cancer.

The specific aims of my project are:

1. To characterize MAGE-A11 expression and prognostic value in prostate tumors by producing a monoclonal antibody reacting specifically with MAGE-A11 in fixed and paraffin-embedded tumors.

2. To analyze the immunogenicity of MAGE-A11 by the identification of promiscuous helper T cell (CD4+) epitopes.

(43)

 

(44)

 

Introduction

Although a lot is known about MAGE-A11 function and its role in the regulation of AR function and hypoxia, MAGE-A11 expression in cancer remains poorly characterized. The objective of the first part of this study is to characterize MAGE-A11 expression in different malignancies. We will first analyze MAGE-MAGE-A11 expression in various cancer cell lines to determine the scope of MAGE-A11 expression in cancer. Then, we will specifically look at expression of this antigen in prostate cancer to validate MAGE-A11 potential as an immunotherapeutic target for treatment of this disease.

There are a number of assays that can be used to validate the expression of antigens in tumor cells. Techniques most frequently used are reverse transcription-polymerase chain reaction (RT-PCR), immunoblotting (Western blotting) and immunohistochemistry (IHC).

Reverse transcription-polymerase chain reaction (RT-PCR)

In RT-PCR, total RNA is extracted from cells and used to make complementary DNA (cDNA) using reverse transcriptase. The cDNA product is then used as a template for PCR with gene-specific primers. Finally, the resulting PCR product is analyzed on an agarose gel to identify the presence of the transcribed gene in the cell. RT-PCR is the most sensitive technique for mRNA detection [90]. However, this technique only indicates the presence of gene expression and not protein translation, which can vary greatly between antigens [91].

Immunoblotting (Western blotting)

Immunoblotting is used to investigate the expression of a protein of interest in a cell culture or tissue culture homogenate. The first step of immunoblotting procedure is to separate the proteins by gel electrophoresis. After electrophoresis, the separated proteins are transferred onto a membrane typically made of nitrocellulose or polyvinylidene difluoride (PVDF). Next, the membrane is blocked

(45)

 

to prevent any nonspecific binding of antibodies to the surface of the membrane. The target protein is then identified using either a labeled antigen-specific antibody (direct method) but more frequently a labeled secondary antibody recognizing the antigen-specific antibody (indirect method). The detection of the bound antibodies is then realised using radioactive, colorimetric, chemiluminescent or fluorescent detection methods depending on the label that was used.

Immunohistochemistry (IHC)

IHC is the gold standard methodology for in situ analysis of protein expression [92]. In IHC, the expression and localization of a protein within a tissue section is determined by the binding of specific antibodies to tissue antigens. The first step of IHC procedure is sample preparation. To ensure the preservation of tissue architecture and cell morphology, after collecting the tissue sample from the patient, the sample usually undergoes a fixation procedure. The most common fixation technique in most health institutions is formalin fixation coupled with paraffin embedding (FFPE) [93]. Although fixation is essential for the preservation of tissue morphology, this process can have a negative impact on IHC detection. Fixation can alter the structure of tissue proteins such that the epitope of interest is masked and can no longer be recognized by the antibody [94]. There are number of antigen retrieval techniques such as heat-induced antigen retrieval that are used to restore the epitope-antibody binding. However, not all the epitopes within an antigen can be unmasked making it difficult to find antibodies that can be used to detect antigens in FFPE tissues using IHC. The final step of IHC procedure involves visualization of the antigen within the tissue section by the use of labeled antibodies directly reacting with antigens (direct method) or labeled secondary antibodies recognizing the antigen-bound primary antibodies (indirect method). The detection of the bound antibodies is then usually realised using colorimetric methods.

(46)

 

Experimental procedure

To characterize MAGE-A11 expression in prostate cancer, we planned to perform immunohistochemical analysis of 400 FFPE prostate cancer specimens (including 25 specimens of CRPC) that we have in our archives and correlate the results with clinical follow-up data to assess a possible association of MAGE-A11 expression with treatment failure, and overall and cancer specific survival of patients suffering from prostate cancer. To do so, we tested all the commercially available MAGE-A11-specific antibodies in IHC on FFPE tissues. However, none of the tested antibodies gave a MAGE-A11-specific signal in IHC on FFPE tissues (see example in Figure 4). As a result, given our expertise in antibody production, we decided to produce our own MAGE-A11-specific monoclonal antibody (mAb) capable of recognizing the antigen in FFPE tissues.

Material and Methods

Ethics statement

All experiments performed in this study were approved by the Ethics Committee of CHU de Québec/Hôpital L’Hôtel-Dieu de Québec.

Reverse transcription-polymerase chain reaction

Total RNA was extracted from cancer cell lines and maintained in a bio-freezer (-80°C) until analysis (work done by other members of the team). RT reaction was performed on 1 µg of DNAse-treated RNA using 100 ng of random hexanucleotide primers (Amersham BioSciences, Baie d'Urfé, Québec) and 200 U of M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA) in the presence of M-MLV-RT buffer, 0.5 mM of dNTP, 10mM of dithiothreitol and 40 U of protector RNase inhibitor (Roche Diagnostics, France) in a final volume of 20 μl. The integrity of the produced cDNAs was assessed by PCR amplification of β-actin transcripts. Expression of MAGE-A11 in cancer cell lines was verified by PCR amplification using MAGE-A11 specific primers. PCR primers for β-actin were

(47)

 

(TCATCACCATTGGCAATGAG) and (GATGTCCACGTCACACTTC) and those for

MAGE-A11 were (GAGAACCCAGAGGATCACTGGA) and

(GGGAAAAGGACTCAGGGTCTATC). PCR reaction conditions were as follows: 1 µl of RT product as template, 1X PCR buffer, 0.2 µM of each primer, 0.2 mM of dNTP, 2 mM of MgCl2 and 0.5 unit of Platinum Taq DNA Polymerase (Invitrogen,

Carlsbad, CA) in a 25 µl reaction volume. Thirty-two cycles of PCR were carried out: annealing at 54°C, 30 seconds; extension at 72°C, 30 seconds; denaturation at 95°C, 15 seconds; final extension at 72°C for 10 minutes. PCR amplification was performed on a Perkin Elmer GeneAmp PCR system 9600 (Waltham, MA).

Production and purification of recombinant MAGE-A11 protein

The MAGE-A11 cDNA was cloned using the Gateway Cloning Technology (Invitrogen, Carlsbad, CA). First, the entire coding region of MAGE-A11 cDNA

(GenBank Accession No. U10686) was amplified by PCR (from

pCMV-SPORT6/MAGE-A11) using primers containing attB recombination sequence extensions. Then, the PCR product was inserted into pDONR201 vector via the BP reaction. The resulting plasmid was used as the Entry clone. Ultimately, the MAGE-A11 cDNA was transferred from the Entry vector into pDEST17 expression vector by the LR reaction. The expression vector, pDEST17, allows the production of His6

-tagged recombinant proteins in Escherichia coli. The integrity of all constructs was verified by DNA sequencing (Plateforme de séquençage et de génotypage des génomes, Laval University, QC).

The recombinant MAGE-A11 protein was produced in BL21(DE3)pLysS E. coli

cells (Novagen, EMD Biosciences, WI). Briefly, transformed BL21(DE3)pLysS E. coli cells were cultured in 1 L of LB medium with 34 µg/ml chloramphenicol and 100 µg/ml 9EHA;ADDAF9Ll with shaking until the OD600 reached 0.4. At that point, the

bacterial culture was stimulated with 0.5 mM of isopropyl-1-thio-β-D-galactopyranoside (IPTG) (Fermentas life sciences) 9F< O9K AF;M:9L=< 9L l with shaking for 9 hours.

(48)

 

The recombinant MAGE-A11 protein was purified using the Thermo Scientific HisPur Ni-NTA resins (Pierce Biotechnology, Rockford, lL) under denaturing conditions following manufacturer’s instructions. The purified protein was extensively dialyzed against phosphate buffered saline (PBS) at 4°C and stored in aliquots at -20°C. Purity of the recombinant protein was assessed by SDS-PAGE followed by Coomassie Blue staining and the concentration was determined by the Bradford assay. The results were confirmed by Western blotting using anti-MAGE-A11 mAb (ab55439, Abcam, Cambridge, MA).

Peptide synthesis

The Immune Epitope Database Analysis Resource (tools.immuneepitope.org) was used to predict regions of MAGE-A11 protein that are likely to be recognized as epitopes in the context of a B cell. Out of all the predicted epitopes, two peptides, (SPDLIDPESFSQDILHDKIID) and (YIANANGRDPTSYPSL), were chosen for synthesis due to their uniqueness to MAGE-A11. The peptides were synthesized and conjugated to keyhole limpet hemocyanine (KLH) by GenScript (Piscataway, NJ).

Hybridoma production and selection

Balb/c mice were immunized subcutaneously 3 times with 20 μg of recombinant MAGE-A11 protein, or 10 μg of each KLH-conjugated synthetic peptide, plus 10 μg of Quil-A adjuvant (Cedarlane, Hornby, ON). The mice were immunized on days 0, 14 and 35. On day 45, a blood sample was withdrawn to analyze the antibody titer using enzyme-linked immunosorbent assay (ELISA). The mouse with the highest antibody titer was immunized intravenously with 20 μg of recombinant MAGE-A11 protein, or 10 μg of each KLH-peptide, on day 66. Two days later, the mouse was sacrificed and its spleen was collected. The splenocytes were isolated and were fused with SP2/0-Ag14 cells (mouse myeloma cell line) using a ratio of 3 splenocytes for 1 SP2/0-Ag14 cell. The immortalized antibody producing B cells (hybridomas) were selected using the Iscove’s Modified Dulbecco’s Medium rich in

(49)

 

IL-6 (1% PD388D1 conditioned medium) and selective agent HAT (hypoxanthine-aminopterin-thymidine) (Invitrogen, Carlsbad, CA). The culture medium also contained 50 μM of ß-mercaptoethanol, 100 U of penicillin, 100 U of streptomycin and 20% HyClone fetal bovine serum (Thermo Scientific, Waltham, MA).

After 10 to 15 days of growth, when hybridoma clones were ready to be screened, hybridoma supernatants were tested using ELISA for their reactivity against MAGE-A11. The hybridoma supernatants obtained from the mouse immunized with the full length recombinant MAGE-A11 protein were also tested for their inactivity against MAGE-A9, closest member of MAGE-A family to MAGE-A11 as a way to select MAGE-A11 specific mAbs. Hybridomas that were specific to MAGE-A11 were then tested in IHC on sections of FFPE human testis specimens for the final selection of clones with capacity to detect the antigens in FFPE tissues. Hybridoma cells producing the desired antibody were thereafter subcloned by limiting dilution at least 3 times to select hybridoma cells emanating from a single hybridoma, thus obtaining a mAb. Antibody isotypes were determined using an antibody isotyping kit (Sigma-Aldrich, St. Louis, MO) following the manufacturer's instructions.

Production of hybridoma supernatant

To further characterize the activity and the specificity of mAb 5C4, we produced large amounts of its hybridoma culture supernatant. To do so, the subcloned hybridoma cells producing mAb 5C4 were grown in 400 ml of Iscove’s Modified Dulbecco’s Medium containing 50 μM of ß-mercaptoethanol, 100 U of penicillin, 100 U of streptomycin, 10% fetal bovine serum and 0.5% P288D1 conditioned medium at 37°C and 5% CO2. After 7 days, the cell culture was centrifuged at

14000 rpm for 10 minutes and the supernatant was collected. The antibody concentration of the hybridoma supernatant (117.2 μg/ml) was determined by ELISA using a standard curve generated from dilutions of an antibody with a defined concentration.

(50)

 

Immunohistochemistry

Immunohistochemical analysis was performed on FFPE tissues. The tissues were cut 5 microns thick on a microtome and were placed on glass slides. The sections were then deparaffinized in Xylene and rehydrated. Next, the sections were subjected to antigen retrieval by heating in 10 mM citrate buffer pH 6.0 in a pressure cooker for 12 minutes. Following the antigen retrieval step, the sections were treated in H2O2 to block the endogenous peroxidase activity and incubated

with the primary antibody overnight. Bound antibodies were visualized using the IDetect Ultra HRP Detection System kit (ID Labs, London, Ontario).

Immunoblotting

Immunoblotting experiments were performed using purified recombinant MAGE-A proteins. Recombinant MAGE-A1, A4, A6 and A8 proteins were purchased from Proteintech (Chicago, IL) and recombinant MAGE-A2, A3, A9, A10, A11 and A12 proteins were produced and purified in our laboratory (work done by other members of the team, except for recombinant MAGE-A10 and A11 proteins that were cloned by me using the Gateway Cloning Technology). The quality of all the recombinant MAGE-A proteins were tested by Western blotting using the following commercial antibodies: mAb 6C1 recognizing MAGE-A1 A2, A3, A4, A6, A10 and A12 (Novocastra), mAb 57B recognizing MAGE-A1, A2, A3, A4, A6 and A12 (gift of Dr. G. Spagnoli), mAb 3F7 recognizing MAGE-A8 (Abnova, Taiwan), mAb 14A11 recognizing MAGE-A9 (produced in our laboratory [76]) and mAb ab55439 recognizing MAGE-A11 (Abcam, Cambridge, MA).

Purified recombinant proteins were separated by SDS-PAGE and transferred onto PVDF membranes. Then, the membranes were blocked with tris-buffered saline (TBS) containing 5% nonfat dry milk. After the blocking step, the membranes were incubated with our primary antibodies at room temperature for about 1 hour. Specific protein bands were visualized using goat anti-mouse horseradish peroxidase conjugated secondary antibody (1:10000) (Jackson ImmunoResearch

(51)

 

Laboratories, West Grove, PA) and revealed by chemiluminescence using Western Lightning ECL reagent (Perkin Elmer, Waltham, MA). Both primary and secondary antibodies were diluted in TBS with 1% nonfat dry milk.

Enzyme-Linked Immunosorbent Assay

Nunc MaxiSorp polystyrene 96 well ELISA plates (eBioscience, San Diego, CA) were coated with the desired antigen in PBS solution (0.1 μg/50 μl) overnight at 37ºC. The next day, the plates were blocked with PBS containing 1% bovine serum albumin (BSA) (100 μl per well) at 37ºC. After an hour, the plates were washed three times using PBS. The plates were then incubated with the primary antibody (50 μl per well) at 37ºC in a humid chamber for one hour. After incubation, plates were washed 6 times using PBS with 0.05% Tween and treated with anti-mouse horseradish peroxidase conjugated secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) at 1:5000 dilution (50 μl per well) at 37ºC in a humid chamber for one hour. Both primary and secondary antibodies were diluted in PBS with 0.2% BSA. Next, the plates were washed 6 times using PBS with 0.05% Tween and incubated with ABTS solution (Chemicon International, Temecula, CA) (50 μl per well) in the dark at room temperature for 15 minutes. The color reaction was stopped by adding 50 μl of ABTS Peroxidase Stop Solution per well. Finally, the absorbance at 405 nm was measured using the Infinite F50 ELISA plate reader (TecanGroup Ltd., Switzerland).

Results

Characterization of MAGE-A11 expression in cancer cell lines

MAGE-A11 expression in various cancer cell lines was determined by RT-PCR. Using this technique, MAGE-A11 mRNA was detected in a wide variety of cancer cell lines (Table 1). Most notably it was shown that MAGE-A11 mRNA is present in more than 85% of colon and brain cancer cell lines (Table 2). In prostate cancer cell lines, only 1 (LNCaP) out of 3 cell lines expressed MAGE-A11. We also verified

(52)

 

the expression of MAGE-A11 in normal tissues (data not shown). It was shown that normal tissues do not express MAGE-A11, as its mRNA was not detected in the tested normal tissues. The normal tissues that were tested included liver, muscle, heart, small intestine, prostate, ovaries, spleen, adrenal gland and uterus. These results validate MAGE-A11 potential as an immunotherapeutic target as its expression is limited in normal tissues and it is expressed in a wide variety of malignancies.

Production of anti-MAGE-A11 mAb using full-length MAGE-A11 protein as an immunogen

Full-length recombinant MAGE-A11 protein was produced in E. coli using the Gateway® Technology and used to immunize 5 Balb/c mice. The mouse with the highest anti-MAGE-A11 titre after 3 immunizations was identified using ELISA (Figure 1). Two days after the final boost its splenocytes were isolated and fused with SP2 cells to obtain immortalised antibody producing B cells (hybridomas). The fusion produced more than 2625 hybridoma clones. Hybridoma supernatants were tested using ELISA for their reactivity against MAGE-A11 and inactivity against MAGE-A9, closest member of MAGE-A family to MAGE-A11 (Figure 2). Hybridomas that were positive for MAGE-A11 and negative for MAGE-A9 were tested in IHC for the final selection. Of 192 clones tested, only 2 were reactive in IHC on FFPE tissues (Figure 3). To obtain antibody-producing cells emanating from a single hybridoma, the two clones underwent subcloning. Only one clone, 5C4, survived the six rounds of subcloning (Figure 4). Isotyping analyses showed that this antibody was an IgG1.

Analysis of specificity of anti-MAGE-A11 mAb 5C4

The specificity of anti-MAGE-A11 mAb 5C4 was analyzed in Western blot (Figure 5). It was shown that mAb 5C4 is not only reactive against MAGE-A11 but also recognizes MAGE-A3, A4, A6, A9 and A12. In IHC, mAb 5C4 reacts specifically with spermatogonia in testis tissue sections (Figure 4). Given the fact that

(53)

MAGE-  

A9 is expressed in spermatocytes [76], we can conclude that mAb 5C4 does not react with MAGE-A9 in IHC. We also investigated the reactivity of mAb 5C4 against MAGE-A3 in IHC (Figure 6). It was shown that mAb 5C4 does not react with MAGE-A3 in IHC. This result let us to suggest that mAb 5C4 would not react with MAGE-A6 either since MAGE-A3 and MAGE-A6 show 95% protein sequence homology and our western blot results shows that mAb 5C4 cross-react with MAGE-A3 and MAGE-A6 indicating that the 5C4 epitope is common to both proteins. Due to lack of availability of FFPE tissues expressing MAGEA4 and -A12, the reactivity of mAb 5C4 with these two proteins in IHC remains to be determined.

Production of anti-MAGE-A11 mAb using synthetic peptides as an immunogen

Given our unsuccessful attempt of producing an antibody capable of reacting specifically with MAGE-A11, we decided to change our immunization strategy by immunizing mice with synthetic peptides specific to MAGE-A11 instead of using the full-length recombinant protein as an immunogen. Two synthetic peptides were chosen based on their immunogenicity, accessibility and specificity to MAGE-A11 according to in silico analyses using prediction algorithms (see Material and Methods).

On day 45 of the immunization, a blood sample was withdrawn to analyze the antibody titer in the serum of immunized mice to identify the mouse with highest anti-MAGE-A11 titre (Figure 7). The specificity of the produced antibodies was also verified in Western blot using recombinant MAGE-A proteins to make sure that the generated antibodies do not react with any of the members of MAGE-A family except MAGE-A11 (Figure 8). Given the specificity of the produced antibodies, we proceeded with the fusion to obtain hybridomas. Hybridoma supernatants were tested using ELISA for their reactivity against MAGE-A11. Out of 2400 clones that were tested, less than 2% were reactive against MAGE-A11 in ELISA. The supernatant from the reactive clones were then tested in IHC. Unfortunately, none

(54)

 

of the tested supernatants contained an antibody capable of recognizing MAGE-A11 in IHC on FFPE tissue. The reactive clones were also tested in Western blot. Two clones, 5A1 and 18B3, were selected based on their reactivity and specificity to MAGE-A11 in Western blot and were subcloned to be used for detection of MAGE-A11 in this technique.

Discussion

Cancer/testis (CT) antigens are ideal targets for the development of therapeutic cancer vaccines because of their limited expression in normal tissues, widespread expression in malignancies and their antigenic properties [62]. CT antigen, MAGE-A11, is of particular interest in cancer treatment due to its role in tumor progression; MAGE-A11 increases sensitivity of prostate cancer cells to androgen contributing to resistance to hormone therapy [81], its expression in tumors is associated with resistance to widely used chemotherapeutic agents [87] and it activates the hypoxia response allowing the tumor cells to survive in low oxygen conditions [86]. In this study we investigated the expression of MAGE-A11 in a wide variety of cancer cell lines to determine the scope of its expression in cancer. We also developed a mAb capable of recognizing MAGE-A11 in FFPE tissues. Using RT-PCR, the expression of MAGE-A11 was analyzed in more than 70 cancer cell lines of different origins and it was shown that MAGE-A11 is widely expressed in cancer. We also investigated the expression of this antigen in normal tissues and confirmed that MAGE-A11 is not expressed in these normal tissues with the exception of the testis. The results obtained in this study are consistent with our current knowledge of CT antigens’ expression, as MAGE-A11 expression, like that of other CT antigens, is limited to the testis and malignancies.

Of all the tested cancer cell lines, the most frequent MAGE-A11 expression was observed in those of colorectal cancer. In fact, MAGE-A11 mRNA was detected in 7 out of 8 (87%) colorectal cancer cell lines. The high frequency of MAGE-A11 expression in colorectal cancer cell lines is not very surprising as the widespread

(55)

 

DNA hypomethylation, a frequent occurrence in this type of cancer, is associated with the derepression of CT antigens’ expression [95]. Colorectal cancer is the second leading cause of cancer death in both men and women, with an estimated 9,200 deaths in Canada in 2012 [2]. The overall survival rate of patients diagnosed with advanced colorectal cancer is less than 10% [96]. Immunotherapy is a promising new modality in colorectal cancer treatment [97] and MAGE-A11 could be an interesting immunotherapeutic target for development of vaccines against this disease. More research, however, is needed to fully characterize the expression of MAGE-A11 in this type of cancer.

In addition to colorectal cancer, it was shown that MAGE-A11 is also frequently expressed in astrocytoma1 (85%) and breast cancer (44%) cell lines. These results

correspond to two recent studies by Shan et al. that investigated the expression of MAGE-A11 in these cancers [88, 98]. In their studies, Shan et al. reported that MAGE-A11 is expressed in 56% (45/78) of glioma and 52% (39/75) of breast cancer specimens. The disparity between our results and those obtained by Shan

et al. could be explained by the difference in the sample sizes (Shan et al. had a

significantly larger sample size) and the different detection methods (RT-PCR versus IHC) and most importantly by the source of the tissues tested as we analyzed only established cancer cell lines while Shan et al. used clinical specimens of tumors which is more relevant. However, it should also be noted that Shan et al. employed a commercial MAGE-A11 rabbit polyclonal antibody that we proved to be not very specific to detect MAGE-A11 in FFPE tissues (result not shown).

In this study, we also reported the production of anti-MAGE-A mAb 5C4 that is capable of recognizing MAGE-A3, A4, A6, A9, A11 and A12 in Western blot. In IHC, mAb 5C4 appears however to be more specific; our results suggest that mAb 5C4 does not react with MAGE-A3, A6 and A9 in FFPE tissues. We could not verify

(56)

 

the reactivity of mAb 5C4 to MAGE-A4 and A12 in FFPE tissues due to lack of availability of tissues expressing exclusively these antigens. Further analyses are required to determine precisely the MAGE-A antigens recognized by mAb 5C4 in IHC. Although mAb 5C4 is not specific to MAGE-A11, it could still be a valuable tool to quickly screen specimens for the expression of MAGE-As, as it is capable of recognizing the majority of its members in Western blot.

MAb 5C4 was produced by immunizing mice with full-length recombinant MAGE-A11 protein. The same approach was used successfully to produce mAb 14MAGE-A11 against MAGE-A9 capable of recognizing MAGE-A9 in FFPE tissues [76]. We also attempted to produce a mAb specific to A11 capable of recognizing A11 in FFPE tissues by immunizing mice with synthetic peptides specific to MAGE-A11. We used this approach to produce the anti-MAGE-A3/A6 23D2 (unpublished results). Using this approach, we managed to produce antibodies that were very specific to MAGE-A11 in Western blot. However, none of the produced antibodies could recognize MAGE-A11 in FFPE tissues.

In conclusion, in this study we showed that MAGE-A11 is widely expressed in cancer and not expressed in normal tissues. These findings confirm that MAGE-A11 is an ideal immunotherapeutic target for development of cancer vaccines. We also developed an anti-MAGE-A mAb that can be used to rapidly screen specimens for expression of MAGE-As. The next step is to fully characterize mAb 5C4 reactivity in IHC, and use it to analyse the 400 FFPE prostate cancer specimens that we have in our archives.

(57)

 

Tables and Figures

Table 1. List of all the tumor cell lines screened for MAGE-A11 expression.

(58)

 

Table 2. Expression of MAGE-A11 mRNA as detected by RT-PCR in cancer cell lines of various origins.

(59)

 

Figure 1. Antibody titer in the serum of mice immunized with the recombinant MAGE-A11 full-length protein. Mouse #4 has produced the highest level of antibodies.

(60)

 

Figure 2. Selection of mAbs specific to MAGE-A11 by ELISA. 432 clones were tested, 192 clones were retained based on their reactivity to MAGE-A11 and inactivity to MAGE-A9 *.

(61)

 

Figure 3. 192 clones were tested in IHC; only 2 clones produced positive results (5A3 and 5C4). FFPE testis tissue sections were used as our positive control and FFPE normal prostate tissue sections were used as our negative control. On the left, the results obtained from a commercially available antibody (ab60043) sold for IHC use is shown. The rabbit polyclonal antibody ab60043 is shown to be not specific to MAGE-A11 in IHC as it cross-reacts with proteins expressed in the stroma of normal prostate tissue. Moreover, the staining pattern in the testis tissue section does not correlate with MAGE-A11 expression in the testis as MAGE-A11 protein is only expressed in the spermatogonia, the outermost layer of cell (indicated by arrow). On the right, the results obtained from mAb 5C4 are shown. Unlike ab60043, mAb 5C4 reacts with spermatogonia but not with the stroma nor the glands (not shown) of normal prostate.

(62)

 

Figure 4. Selection of mAbs specific to MAGE-A11 capable of recognizing the antigen in FFPE human testis specimen using IHC. Two clones had the desired reactivity but only one, clone 5C4, survived the subcloning step.

Figure

Figure 1. Management of prostate cancer ___________________________________________________________  6 Figure 2
Table 1. Tumor node metastasis (TNM) stage definitions for prostate cancer (Adapted from Cancer  Staging Manual (7th Edition) by the American Joint Committee on Cancer) [8]
Figure 1.  Management of prostate cancer.
Figure 2.  The T-cell receptor resembles a membrane-bound immunoglobulin  (Adapted from  Janeway’s Immunobiology) [20]
+7

Références

Documents relatifs

Monitoring tumor antigen specific T-cell responses in cancer patients and phase I clinical trials of peptide-based vaccination. Altman JD, Moss PA, Goulder PJ,

Early biochemical relapse after radical prostatectomy: which prostate cancer patients may benefit from a restaging 11C-choline PET/CT scan before salvage radiation therapy.. J

For a long time, the major focus in the use of in vitro transcribed mRNA was on development of cancer vaccines, using mRNA encoding tumor antigens to modify dendritic cells ex

La SA est ainsi uniquement réservée aux patients atteints d’un cancer localisé de la prostate et à faible risque de progression selon les critères de D’Amico, voire à

Constitutively active androgen receptor variants upregulate mesenchymal markers expression in prostate cancer. Félicie Cottard, Irène Asmane, Eva Erdmann,

Purpose: To estimate the  ratio of prostate cancer treated with external beam radiation only using a model of long term prostate specific antigen (PSA) dynamics.. Materials

For a long time, the major focus in the use of in vitro transcribed mRNA was on development of cancer vaccines, using mRNA encoding tumor antigens to modify dendritic cells ex

Purpose: To estimate the  ratio of prostate cancer treated with external beam radiation only using a model of long term prostate specific antigen (PSA) dynamics.. Materials