Identification et détection d’une nouvelle espèce de
Fusarium pathogène sur la tomate de serre en Amérique
du Nord
Mémoire
Lauriane Moine
Maîtrise en biologie végétale
Maître ès sciences (M. Sc.)
Québec, Canada
Résumé
Récemment, un nouvel agent pathogène a causé d’importants dommages sur la tomate de serre dans un complexe au centre du Québec et au nord des États-Unis. À partir d’échantillons de plants infectés, des colonies produisant des macroconidies typiques de
Fusarium spp. ont systématiquement été isolées. Le séquençage des régions ITS et tef de
ces isolats, suivi de tests de pathogénicité, ont permis d’identifier Fusarium striatum comme l’agent pathogène. Il s’agit du premier rapport de cet agent pathogène au Canada. Suite à son identification, un test de dépistage moléculaire a été mis au point afin de détecter l’agent pathogène directement à partir des tissus végétaux. Les amorces développées ont été suffisamment spécifiques et sensibles pour détecter l’agent pathogène avant même l’apparition des symptômes. Nos résultats semblent indiquer que l’inoculum de F. striatum aurait été introduit dans les deux complexes de serre par les transplants provenant de leur fournisseur commun.
Table des matières
Résumé ... iii
Liste des tableaux ... vii
Liste des figures ... ix
Avant-propos ... xiii
INTRODUCTION GÉNÉRALE ... 1
CHAPITRE I ... 3
Revue de littérature ... 3
La culture de la tomate de serre ... 3
Les principales maladies provoquant des chancres sur la tomate de serre ... 3
Le genre Fusarium ... 4
Fusarium oxysporum f. sp. radicis-lycopersici ... 5
Fusarium solani ... 5
Méthodes d’identification moléculaire ... 6
Techniques de détection ... 6
Choix des gènes cibles ... 7
Hypothèses et objectifs de recherche ... 9
CHAPITRE II ... 11
Identification and detection of a new species of Fusarium pathogenic to greenhouse tomato in Northeastern America ... 11
Résumé ... 12
Abstract ... 13
Introduction ... 14
Materials and methods ... 15
Plant sampling and DNA extraction ... 15
Fungal strains and cultivation ... 16
DNA extraction ... 16
PCR reactions ... 17
Cloning and sequencing ... 18
Pathogenicity tests ... 18
Results ... 19
Disease symptoms ... 19
vi Fungal identification ... 22 Pathogenicity tests... 23 Specificity of PCR amplification ... 24 Source of F. striatum ... 26 Discussion ... 27 Acknowledgments ... 30 Literature cited ... 31 CONCLUSIONS GÉNÉRALES ... 35 BIBLIOGRAPHIE ... 39
Liste des tableaux
TABLE 1.SEQUENCES OF PRIMER SETS DERIVED FROM THE INTERNAL TRANSCRIBED SPACER REGION AND THE TRANSLATION ELONGATION FACTOR 1-... 17
TABLE 2.DETECTION OF F. STRIATUM IN DIFFERENT PARTS OF TOMATO PLANT RECEIVED
Liste des figures
FIGURE 1.REPRÉSENTATION DU GÈNE CODANT POUR LE FACTEUR D’ÉLONGATION 1-
(TEF) AMPLIFIÉ PAR LES AMORCES UNIVERSELLES EF1 ET EF2 ... 9
FIGURE 1.PHOTOGRAPHS OF DISEASED TOMATO PLANTS. ... 21
FIGURE 2.PHOTOGRAPHS AND LIGHT MICROGRAPHS OF SEXUAL AND ASEXUAL
STRUCTURES OF FUNGAL ISOLATES FROM DISEASED TOMATO PLANTS. ... 22
FIGURE 3.KOCH POSTULATES. ... 24
FIGURE 4.GEL ELECTROPHORESIS OF PCR-AMPLIFIED PRODUCTS (A. PRIMERS ITS-FU -F/ITS-FU-R AND B. PRIMERS TEF-FS4F/TEF-FS4R) ... 25
FIGURE 5.PCR AMPLIFICATION USING THE PRIMERS TEF-FS4F AND TEF-FS4R ON DNA EXTRACTED FROM CULTURES OF ISOLATES TESTED FOR THEIR PATHOGENICITY. .... 25
Remerciements
Mes remerciements s’adressent avant tout à mon directeur de recherche, Richard Bélanger, pour m’avoir fait confiance et pour m’avoir offert la chance de réaliser ce projet de maîtrise. Je lui suis très reconnaissante pour son appui, sa compréhension et sa disponibilité envers moi. Je le remercie également pour son soutien financier qui m’a permis de mener à terme ce projet.
Un immense merci à Caroline Labbé pour son inestimable contribution et sa grande patience. Caroline m’a grandement aidée à traverser plusieurs étapes majeures de ces deux dernières années par son grand cœur.
J’aimerais adresser mes remerciements à François Belzile pour m’avoir apporté ses connaissances en biologie moléculaire et m’avoir permis de réaliser des manipulations dans son laboratoire. Merci à Suzanne Marchand pour sa grande gentillesse, et pour m’avoir offert généreusement de son temps.
Je souhaite remercier Keith Seifert pour nous avoir aidé à identifier l’agent pathogène et pour sa contribution dans la rédaction de l’article.
Merci à François Lefebvre pour avoir enregistré mes séquences d’ADN dans GenBank. Je remercie Audrey Boulianne pour avoir fait appel aux services du laboratoire de Richard Bélanger, en vue de développer un outil de diagnostic contre ce nouvel agent pathogène présent dans les complexes de serres de Savoura. Je tiens à la remercier pour la confiance qu’elle m’a accordée pour ce projet.
Je tiens également à souligner la collaboration de Gérard Gilbert et de Nancy Shallow du MAPAQ.
Merci à Daniel Dostaler qui m’a donné l’opportunité d’être chargée de cours du Laboratoire de Phytopathologie. Cette première expérience en enseignement fut malheureusement trop courte mais très enrichissante.
Mes remerciements s’adressent aussi à toutes les personnes de mon équipe, qui ont contribué au dynamisme du laboratoire. Je remercie tout spécialement Valérie Guérin, pour sa pensée positive à toute épreuve.
xii
Je souhaiterais exprimer ma gratitude à Jade, pour son support moral, sa patience et sa compréhension. J’ai pu apprécier jour après jour sa grande générosité et tous nos éclats de rire.
Enfin, je tiens absolument à remercier ma précieuse famille, Susan, Dominique et Alison, pour leur amour, leurs constants encouragements et leur souci de me voir heureuse. Merci de croire en moi et d’accepter que je sois si loin de vous.
Avant-propos
Ce mémoire de maîtrise comprend une introduction générale, une revue de littérature (chapitre I), un article scientifique (chapitre II) et une conclusion générale. L’introduction générale est une mise en contexte du projet. La revue de littérature porte sur les principales maladies de la tomate de serre et les techniques de détection et d’identification de Fusarium spp. L’article intitulé « Identification and detection of a new species of Fusarium
pathogenic to greenhouse tomato in Northeastern America » décrit l’ensemble des travaux
effectués au laboratoire lors de ma maîtrise. Il est écrit en anglais en vue d’une soumission au périodique scientifique Plant Disease et a été rédigé en collaboration avec Caroline Labbé, Gerry Louis-Seize, Keith Seifert et Richard Bélanger. La dernière partie de ce mémoire offre une conclusion générale sur l’ensemble du projet.
INTRODUCTION GÉNÉRALE
Les producteurs serricoles sont généralement au fait des principales maladies qui prévalent dans leurs cultures. Afin de minimiser les risques d’apparition d’une maladie potentiellement dévastatrice, les producteurs optent pour des variétés résistantes à cette maladie particulière. C’est le cas notamment pour la fusariose causée par Fusarium
oxysporum f. sp. radicis-lycopersici chez la tomate, contre laquelle il est possible d’utiliser
du matériel résistant. D’autres maladies peuvent être réprimées par des pratiques culturales adéquates, des agents de lutte biologique ou des produits fongicides. Toutefois, nul ne sait quand un nouvel agent pathogène fera son apparition et réussira à contourner les moyens de lutte utilisés provoquant ainsi une infestation problématique.
Récemment, un nouvel agent pathogène de la tomate s’est déclaré très nuisible dans deux complexes de serres dont un est situé au centre du Québec et l’autre au Nord des États-Unis. Depuis son apparition, les dommages engendrés par cette nouvelle maladie n’ont cessé de croître. Les pertes de plants de tomate ont atteint les 20 %, pour l’année 2012, dans le complexe du Québec. Ces pertes compromettent la rentabilité de l'entreprise et monopolisent beaucoup d'énergie pour l'élagage des chancres, le suivi de la maladie, l'application des moyens de lutte et les mesures sanitaires.
Les premiers symptômes visibles de la maladie, à savoir un chancre brun et le flétrissement des feuilles, sont peu spécifiques et peuvent être aisément confondus avec la présence d’autres champignons pathogènes. En particulier les plants de tomate sont couramment l’hôte de F. oxysporum f. sp. radicis-lycopersici qui provoque des chancres très semblables. Néanmoins, le symptôme typique de cette nouvelle maladie est le brunissement de la moelle plutôt que des faisceaux vasculaires.
Le manque d’informations sur l’origine, le point d’entrée, ou encore sur l’identification de cette nouvelle maladie, compromet grandement la mise en place de stratégies de lutte. Conséquemment, la directrice de l’entreprise du complexe de serre située au centre du Québec a fait analyser des échantillons de tissus malades par le laboratoire de diagnostic du Complexe scientifique (MAPAQ). Le résultat communiqué était la présence systématique de Fusarium solani, menant à l’hypothèse que cet organisme fongique devait être
2
responsable du dépérissement observé. Cependant, sans la démonstration du pouvoir pathogène de F. solani via les postulats de Koch et le manque de documentation montrant
F. solani comme un agent pathogène de la tomate en Amérique, cette conclusion restait
spéculative. Cette incertitude et le manque d’information sur cet organisme fongique ont mené l’entreprise à faire appel aux services du laboratoire de biocontrôle. Le projet était d’identifier précisément l’identité de l’agent pathogène et mettre au point une technique qui permettrait de discriminer l’agent pathogène des autres organismes voisins, pathogènes ou non. Ces objectifs devaient se réaliser dans l’optique d’adopter une stratégie préventive en détectant la présence de l’agent pathogène avant l’apparition des symptômes.
CHAPITRE I
Revue de littérature
1 La culture de la tomate de serre
La tomate (Lycopersicon esculentum L.) occupe, dans de nombreux pays, l’un des premiers rangs de la production de légumes de serre. En effet, en Ontario, au Québec et en Colombie-Britannique, environ 60% de la production légumière totale en serre est constituée de tomates (Agriculture et Agroalimentaire Canada 2006). En 2011, au Québec, 90% des tomates sont produites sous serre. Dans la majorité des pays, cette culture est pratiquée de manière intensive, contraignant les producteurs à augmenter les rendements, élargir la période de production et améliorer la qualité des fruits. Cette intensification des cultures et l’augmentation des échanges mondiaux ont contribué à favoriser le risque d’apparition de maladies ou d’insectes ravageurs.
Les conditions environnementales des serres sont optimisées en fonction de la culture implantée, néanmoins les conditions favorables pour la plante le sont aussi pour les agents pathogènes. En effet, de nombreux producteurs utilisent aujourd’hui des substrats inertes tels que la laine de roche, pour des questions économiques et entre autres facteurs, une bonne rétention d’eau. En utilisant ces substrats dépourvus de micro-organismes (Postma et al. 2000), les agents pathogènes telluriques en absence de compétition, se développent plus facilement (Mihuta-Grimm et al. 1990; Punja et Parker 2000). Ainsi, comprendre les interactions entre la plante, les agents pathogènes et les facteurs environnementaux est essentiel pour gérer au mieux les maladies. Cependant, le contrôle des facteurs environnementaux (température, lumière, humidité, pH et apport en nutriments) n’est pas toujours suffisant pour la répression des maladies. L’utilisation de porte-greffes résistants est une solution à laquelle le producteur peut avoir recours pour limiter ou éviter le développement de diverses maladies (King et al. 2010; Lee 1994).
2 Les principales maladies provoquant des chancres sur la tomate de serre
Les chancres, chez la tomate de serre, peuvent être provoqués par de nombreux agents pathogènes. Les plus fréquents et problématiques sont le chancre de la tige causé par
4
Botrytis cinerea et le chancre bactérien causé par Clavibacter michiganensis subsp. michiganensis.
Le chancre de tige causée par B. cinerea, est une maladie à manifestation chronique qui affecte les cultures en serre à travers le monde. Le champignon peut attaquer toutes les parties de la plante : feuilles, tiges et fruits. Les symptômes débutent souvent à partir des blessures causées par l’effeuillage. La maladie se caractérise par des taches brunâtres accompagnées d'un duvet grisâtre suivi de taches pouvant évoluer en chancre de tige et des pétioles (Jarvis 1977).
Le chancre bactérien est l’une des maladies bactériennes des plus nuisibles au niveau mondial et se retrouve chez environ 55 familles botaniques dont les Solanacées. La bactérie responsable, C. michiganensis subsp. michiganensis, provoque le flétrissement unilatéral des feuilles, suivi d’un dessèchement total et éventuellement la mort de la plante. Une coupe de la tige permet de noter un brunissement du système vasculaire, particulièrement visible aux nœuds (de León et al. 2011; Gartemann et al. 2008).
3 Le genre Fusarium
Les champignons du genre Fusarium peuvent aussi être responsables de chancres chez la tomate (Jones et al. 1991; Lagopodi et al. 2002; Marlatt et al. 1996; Nakayama et Aoki 2010; Romberg et Davis 2007; Wheeler et al. 1999; Zhang et al. 2007). Les membres du genre Fusarium ont une distribution mondiale et se retrouvent sur une grande diversité de milieux. Ils peuvent provoquer des maladies aux plantes et aux humains (Booth 1971; Nelson et al. 1994; Nucci et Anaissie 2002). Le genre Fusarium est économiquement très important et regroupe de nombreuses espèces phytopathogènes susceptibles d’attaquer un grand nombre de plantes. Ce nombre de plantes-hôtes varie selon les espèces de Fusarium. Certaines espèces ont un nombre restreint d’hôtes tels que F. graminearum (Goswami et Kistler 2004) et d’autres tels que F. oxysporum et F. moniliforme en attaquent plusieurs (Bezuidenhout et al. 1988; Hsieh et al. 1977; Nelson et al. 1981).
D’autres espèces causent souvent des pertes économiques considérables telles que
F. oxysporum f. sp. cubense (Ploetz 1990) qui a quasiment provoqué la fin de l'industrie de
la banane dans les années 1960 et F. graminearum qui a entrainé la perte de plusieurs milliards de dollars par l'attaque des épis de blé et d'orge aux États-Unis (Windels 2000).
Par conséquent, de nombreuses recherches sont menées pour lutter plus efficacement contre ces champignons filamenteux.
3.1 Fusarium oxysporum f. sp. radicis-lycopersici
Fusarium oxysporum f. sp. radicis-lycopersici est responsable du flétrissement des
plants de tomate suite à la pourriture de la racine et du collet (Lagopodi et al. 2002; Ozbay 2004). Ce champignon envahit les plantes par les plaies et les ouvertures naturelles provoquées par la création de nouvelles racines. La propagation de l’agent pathogène s’effectue via le xylème, provoquant le brunissement des vaisseaux vers le haut, sans affecter la moelle (Benhamou 1992).
F. oxysporum f. sp. radicis-lycopersici a été rapporté pour la première fois au Japon en
1969 (Menzies et Jarvis 1994) et s’est rapidement répandu mondialement (Chérif et Benhamou 1990). Avant le développement de variétés et de porte-greffes résistants,
F. oxysporum f. sp. radicis-lycopersici était responsable de pertes économiques importantes
dans de nombreux pays (Benhamou et al. 1994; Lagopodi et al. 2002). 3.2 Fusarium solani
F. solani est impliqué dans diverses maladies opportunistes chez l’homme telles que la
kératite (Booth 1975; Zhang et al. 2006). Cet organisme filamenteux fait partie des champignons les plus dangereux pour les patients immunodéprimés après Aspergillus
fumigatus (Nelson et al. 1994). F. solani est un champignon ubiquiste se retrouvant dans les
forêts, les prairies, les marécages, les zones littorales, les zones côtières, et les milieux agricoles (Burgess et Summerell 1992; Jeschke et al. 1990; Kommedahl et al. 1988; Leslie et al. 1990). Au plan phytopathologique, F. solani est un agent pathogène qui cause des maladies sur de nombreuses plantes. En 1989, il est connu comme responsable de maladies sur une centaine de genres (Farr et al. 1989). Les hôtes prédominants sont la pomme de terre, le pois, le poivron et les membres des cucurbitacées (O’Donnell 2000). F. solani est aussi connu pour être un agent pathogène de la tomate mais à des niveaux épidémiologiques beaucoup plus restreints que ceux rapportés par les deux producteurs de tomate de cette étude (Nakayama et Aoki 2010; Romberg et Davis 2007).
F. solani est membre d'un clade monophylétique qui comprend environ 60 espèces
6
(Geiser et al. 2013; O’Donnell 2000; Zhang et al. 2006). Les noms des espèces biologiques individuelles (formae speciales, f. sp.) du FSSC sont principalement associés au nom de la plante hôte spécifique colonisée (ex. F. solani f. sp. pisi sur le pois et F. solani f. sp.
glycines sur le soya) (Geiser et al. 2013; Li et Hartman 2003; Matuo et Snyder 1973).
Les membres de ce complexe peuvent vivre dans des conditions environnementales extrêmes. En effet, F. solani a été retrouvé à l’intérieur d’une section hautement radioactive du réacteur nucléaire endommagé de Tchernobyl (Zhdanova et al. 2000). Ces champignons sont capables de croître dans les conditions anaérobiques du sol (Wainwright et al. 1994) et tolèrent de nombreux composés révélés comme toxiques pour d'autres champignons (Espinel-ingroff 1998). Leur capacité à s'adapter à un si grand nombre d’environnements différents, reflète leur plasticité génétique et leur diversité métabolique. Cette variabilité génétique s’avère un avantage particulièrement utile pour classifier et identifier rapidement les espèces de F. solani (O’Donnell 2000; Suga et al. 2000).
4 Méthodes d’identification moléculaire 4.1. Techniques de détection
La capacité d’identifier avec précision un organisme est fondamentale pour le diagnostic des champignons que ce soit dans le domaine de la science médicale ou de la pathologie végétale. L'identification basée sur des critères morphologiques a longtemps été utilisée et continue à l'être pour de nombreux organismes. Cette identification peut être plus ou moins complexe suivant l'origine du tissu infecté et le degré d'identification que l’on souhaite atteindre. Certains diagnostics peuvent être effectués rapidement lorsque la maladie est récurrente ou que les symptômes sont bien connus (ex. le chancre de la tige causé par B.
cinerea) (Jarvis 1977). Pour les autres maladies moins courantes, les agents pathogènes
peuvent être diagnostiqués, avec de l’expérience, sur la base de caractères morphologiques spécifiques. Une caractérisation morphologique précise requiert une culture du champignon sur des milieux appropriés pour que les caractères morphologiques de différenciation se développent. L’identification est ensuite basée sur la morphologie des colonies, la caractérisation des spores, la présence ou non de la forme téléomorphe et d’autres caractéristiques de culture. Ce diagnostic basé seulement sur ces critères est un long processus (Geiser et al. 2004; Nirenberg et O’Donnell 1998) qui n’est pas
systématiquement précis ou juste. En effet, les organismes difficiles à mettre en culture (McCartney et al. 2003) ou appartenant à un complexe d’espèces (Geiser et al. 2004; Jiménez-Fernández et al. 2011; O’Donnell 2000) rendent le diagnostic laborieux.
D’autres techniques ont par la suite été utilisées pour détecter, identifier et caractériser les champignons (Bruns et al. 1991; Lévesque 2001; White et al. 1990). Zuckerkandl et Pauling (Zuckerkandl et Pauling 1965) ont été les premiers à considérer les molécules biologiques comme des indicateurs de l'histoire évolutionnaire. L’intégration des méthodes moléculaires dans la taxonomie et l'identification de nombreux organismes a permis une avancée considérable (Benyon et al. 2000; Geiser et al. 2004; Nirenberg et O’Donnell 1998). La technique consiste à amplifier des régions génomiques polymorphes à l’aide de l’amplification en chaîne par polymérisation de l’ADN in vitro mieux connue sous le nom de « Polymerase chain reaction » ou PCR. Cette technique d'amplification génique permet de visualiser et manipuler ces régions plus aisément (Anderson et Cairney 2004; Seifert 2009). Contrairement aux méthodes plus conventionnelles, cette nouvelle méthode est très spécifique et peut être utilisée pour détecter des quantités infimes d'ADN fongique à partir d’échantillons de l'environnement (Kernaghan et al. 2003). Elle permet aussi de détecter et d’identifier un organisme spécifique dans un échantillon non pur. Cette approche a été utilisée avec succès dans l’étude de champignons sur un échantillon de sol et de plante (Hunt et al. 2004; Kernaghan et al. 2003; Silvar et al. 2005; Zhang et al. 2005).
4.2. Choix des gènes cibles
Le choix de la région à amplifier doit être guidé en fonction de trois facteurs. Les séquences doivent posséder des régions suffisamment conservées pour créer des amorces de PCR universelles (figure 1). Ensuite, ces mêmes séquences doivent posséder des régions suffisamment divergentes pour discriminer une espèce d’une autre. Et enfin, les bases de données publiques doivent contenir suffisamment de séquences afin de comparer la séquence obtenue avec les bases de données. Une fois la région choisie, il est nécessaire de trouver des amorces spécifiques à l’organisme à l’étude qui permettront d’obtenir un résultat positif pour cet organisme et pas un autre (Arif et al. 2012; Geiser et al. 2004).
L'ADN ribosomique (ADNr ou rDNA) est la région la plus souvent ciblée pour la caractérisation et l'identification moléculaires des champignons. Cette région est présente
8
chez tous les êtres vivants, participant aux mécanismes de traduction des ARNm en protéines. Plus de 100 000 séquences ITS (Internal Transcribed Spacer) de champignons sont déposées sur la base de données nucléotidiques internationales (NCBI) et sur d’autres bases de données (ex. Fusarium-ID), fournissant un matériel de référence conséquent pour l'identification des taxons fongiques (Gardes et Bruns 1993; Nilsson et al. 2009; White et al. 1990). Chaque copie est composée de trois unités transcrites en ARN ribosomique, une sous-unité 18S, 28S et 5.8S, et deux régions non transcrites, ITS1 et ITS2. Le grand nombre de copies d’ITS par cellule (Vilgalys et Gonzalez 1990) fait de cette région une cible attrayante pour le séquençage de substrats environnementaux, où la quantité d'ADN présente est faible. Les gènes, les régions conservées, sont ciblés pour créer des amorces universelles et ainsi amplifier tous les champignons. Pour leur part, les régions ITS sont plus variables, et permettent de créer des amorces spécifiques pour distinguer les espèces entre elles (O’Donnell 1992). Cependant, ces régions ne permettent pas de différencier toutes des espèces très proches génétiquement. En effet, la variabilité de ces régions n’est pas toujours suffisante et les copies de l’ITS2 ne sont pas orthologues chez toutes les espèces (Balajee et al. 2009). Par exemple, il n'est pas possible de différencier certains membres du complexe de F. oxysporum avec les ITS (O’Donnell et al. 1998; O’Donnell et Cigelnik 1997). Dans ces situations, il faut avoir recours à d'autres gènes, comme la β-tubuline et le facteur d'élongation-lα (Balajee et al. 2009; O’Donnell et al. 2000; O’Donnell 2000; Thon et Royse 1999).
Les gènes de la β-tubuline et du facteur d'élongation-lα (tef) sont des gènes très conservés. Les protéines pour lesquelles codent ces gènes sont essentielles à la survie des cellules. Ils possèdent tous des régions intra-géniques qui évoluent à des taux différents. Étant plus variables que l'ADNr, ils offrent de l'information additionnelle pour la distinction des espèces très proches. La région la plus intéressante pour identifier les souches Fusarium est le gène codant le gène tef. En effet, il comprend une portion importante en introns, il est présent seulement en une seule copie et montre un polymorphisme élevé entre les espèces étroitement liées (O’Donnell et Gray 1995; O’Donnell 2000; Seifert et Levesque 2004; Suga 2000). Ainsi, le gène tef est devenu un marqueur de choix pour l’identification de Fusarium (Geiser et al. 2004; Kristensen et al. 2005).
Figure 1 Représentation du gène codant pour le facteur d’élongation 1-α (tef) amplifié par les amorces universelles ef1 et ef2 (O’Donnell et al. 2008).
5 Hypothèses et objectifs de recherche
Dans le cadre de ce projet, nous avons formulé les hypothèses de recherche suivantes : Fusarium solani est responsable d’une nouvelle maladie émergente qui se
caractérise par des chancres au collet et sur la tige des plants de tomate de serre.
Une méthode moléculaire peut être développée pour détecter de manière précoce
la présence de l’agent pathogène.
Pour vérifier ces hypothèses, les objectifs de l’étude étaient :
Tester la pathogénicité des isolats recueillis sur les tissus malades et identifier
la souche pathogène.
Développer une méthode moléculaire permettant de discriminer l’agent
pathogène des autres organismes présents dans la culture de tomate.
A partir des tests PCR développés, trouver l’origine de l’inoculum dans les
CHAPITRE II
Identification and detection of a new species of
Fusarium pathogenic to greenhouse tomato in
Northeastern America
Lauriane M. Moine1, Caroline Labbé1, Gerry Louis-Seize2, Keith A. Seifert2 and Richard R. Bélanger1a
1Département de Phytologie, Faculté des Sciences de l'agriculture et de l'alimentation,
Centre de Recherche en Horticulture, Université Laval, Pavillon Paul-Comtois, Quebec, Qc, Canada, G1V 0A6.
2Biodiversity (Mycology and Microbiology), Agriculture and Agri-Food Canada,
Ottawa, ON, Canada K1A 0C6.
aCorresponding author: E-mail : richard.belanger@fsaa.ulaval.ca
12
Résumé
Récemment, une nouvelle maladie de la tomate de serre a été rapportée au Québec (Canada) et au Maine (USA). Les plantes malades portent des lésions brunes au point de greffe, ainsi qu’aux cicatrices laissées par l’effeuillage, entrainant la formation de chancres aux contours bien délimités. Quelques semaines après l’apparition des chancres, les plants flétrissent et meurent. Ces symptômes ressemblent à ceux provoqués par Fusarium oxysporum f. sp. radicis-lycopersici, mais diffèrent par le brunissement de la moelle et non des tissus vasculaires. L’espèce homothallique, systématiquement isolée des lésions, a été associée à F. striatum sur une base moléculaire. En effet, le séquençage de la région de l’espaceur transcrit interne (ITS) de l’ADN ribosomal et d’une partie du gène codant pour le facteur d'élongation 1-α, a permis cette identification. Les tests de pathogénicité ont démontré que les isolats de F. striatum reproduisaient des symptômes similaires à ceux rapportés dans les serres d’origine. Ces résultats sont les premiers à associer F. striatum à cette nouvelle maladie responsable de la pourriture du collet et de la tige des tomates de serre, en Amérique du Nord. Le développement d’une technique basée sur la PCR a permis la détection spécifique de F. striatum à partir de mycélium, de tissus végétaux malades et aussi de tissus asymptomatiques. Cet outil a rendu également possible la détection de F. striatum sur les jeunes plants fournis par la pépinière commune aux deux producteurs. Ce résultat suggère que les transplants sont à l'origine de l'inoculum dans les deux complexes de serre.
Abstract
Recently, a new disease was reported on greenhouse tomato plants in both Quebec, Canada and Maine, USA. Symptomatic plants bore brown lesions at graft points and pruning sites, resulting in expanding cankers with clearly delineated margins. Diseased plants eventually wilted and died within a few weeks following the appearance of the first symptoms. The symptoms are reminiscent of infection by Fusarium oxysporum f. sp. radicis-lycopersici, with the notable difference of a discoloration of the pith area rather than the vascular tissues. A homothallic Fusarium sp. was consistently recovered from these lesions. Sequencing of the internal transcribed spacer and the partial translation elongation factor 1-gene identified the species as Fusarium striatum. Pathogenicity tests with F. striatum isolates from diseased tissues reproduced disease symptoms in tomato similar to those observed on tomato plants in the greenhouses. Specific detection of F. striatum from mycelia, diseased and disease-free plant tissues was achieved by developing a PCR-based test. These results establish, for the first time, that the species F. striatum is the cause of crown and stem rot affecting tomato in North America. In addition F. striatum was detected from all sampled tissues of plants delivered by the nursery common to both growers, suggesting that the transplants would be the source of the inoculum.
14
Introduction
Greenhouse tomato (Solanum lycopersicum) is one of the most economically important vegetable crops of North America. However, the warm and humid environment, and high plant density of greenhouse crops is conducive to the establishment and spread of fungal diseases such as gray mold, caused by the fungus
Botrytis cinerea, powdery mildew, caused by Oidium neolycopersici and Fusarium
crown and root rot, caused by Fusarium oxysporum f. sp. radicis-lycopersici (16). Fortunately, the majority of these diseases can be controlled by optimal manipulation of environmental conditions, fungicides, or use of resistant varieties (12,14,17,20). Nevertheless, when a new disease emerges, it becomes very difficult to find a control solution if the pathogen agent is not properly identified.
In 2006, a new disease was observed in commercial greenhouses located in Quebec, Canada and Maine, USA and no curative or preventive treatment successfully delayed its spread. Since its first appearance, the percentage of affected plants has steadily increased and reached 20% by 2012.
Based on initial observations, F. oxysporum f. sp. radicis-lycopersici (13,16) was believed to be the causal agent, but the lack of discoloration of vascular tissues suggested that an unknown pathogen was responsible for the observed symptoms. Nevertheless, morphological observations of the putative pathogen revealed the presence of macroconidia and phialids typical of the F. solani species complex (FSSC) (9,29,40).
Implementation of appropriate disease management and measures needed to prevent and/or control a disease requires a reliable identification and detection of the pathogen. Molecular biology techniques, especially those involving the polymerase chain reaction (PCR), have provided an alternative and sensitive approach for the detection and identification of plant pathogens and many soilborne pathogenic fungi (26,35). Several regions such as the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA) and particularly, the translation elongation factor 1-α (tef) gene, are useful to identify and discriminate Fusarium species (10,27,34).
Distinct species of the FSSC can be ubiquitous and saprophytic, but some can also be pathogenic to specific plants, causing considerable economic impact mainly on horticultural plants (5,18). In fact, some members of the FSSC, including Fusarium
solani f. sp. eumartii, were found to cause disease on tomato plants (22,30), emphasizing
the importance of accurate identification of the causal agent.
The objectives of the present study were (i) to isolate, identify and evaluate the pathogenicity of fungal isolates recovered from diseased tomato tissues in two commercial greenhouses in Quebec and Maine; (ii) to develop a species-specific PCR protocol to discriminate the causal agent from other related fungi, in artificially and naturally contaminated samples of tomato plants, and (iii) to find the source of the inoculum.
Materials and methods
Plant sampling and DNA extraction
Diseased tomato plants were obtained from commercial greenhouses located in central Quebec and northeastern United States. A total of 55 samples (50 from Quebec and five from Maine greenhouses) were collected, consisting of plants bearing typical cankers. Tissue sampling (5 mm x 10 to 20 mm) was made from the margin of cankers with a sterile scalpel. The samples were immediately surface-disinfected in 0.05 % NaOCl (3 min), 70% ethanol (3 min) and rinsed twice for 5 min in sterile distilled water. After drying on sterile absorbent paper, collected cleaned tissues were halved. One half was frozen at -80°C then lyophilized, and stored at -15°C for further DNA extraction. The other part was sliced into small pieces and was used for fungal isolation. Samples for control tests were obtained from stems of plants exempt of disease symptoms. These samples were surface-disinfected and stored as above.
In order to determine if the transplants were carriers of inoculum, young tomato plants coming from the growers’ common nursery were also sampled. Briefly, 2-cm pieces were sampled from the stems, graft points, above and under the graft points, and root tissues. Samples were frozen at -80°C then lyophilized, and stored at -15°C for further DNA extraction.
16
Fungal strains and cultivation
Control strains. Fusarium oxysporum, F. graminearum, F. sambucinum and F. oxysporum f. sp. radicis-lycopersici were kindly provided by Dr. Russell Tweddell,
Université Laval, Canada, and used as control strains. F. striatum was kindly provided by Mr. Gérard Gilbert from the Laboratoire de diagnostic en phytoprotection (MAPAQ, QC, Canada). All cultures were grown on synthetic low nutrient agar (SNA) (25) at 24°C for five days and stored at 4°C for the duration of the experiment.
Fungal isolates. Surface sterilized pieces (see above) from diseased tomato plants
were immediately plated on Petri dishes filled with potato dextrose agar (PDA) amended with antibiotics (chloramphenicol 80 mg/liter and streptomycin sulfate 80 mg/liter). The plates were then incubated for 4 to 5 days at 28°C. Colonies were exposed under UV light and examined after 72h. In addition, the isolates were maintained on SNA at 4°C.
Two representative isolates were deposited in the Canadian Collection of Fungal Cultures as DAOM 242301 and 242302 (AAFC, Ottawa).
DNA extraction
Fungal DNA. A minimal liquid culture medium was suitable to obtain a high titer of
microconidia during cultivation of Fusarium strains, and this material was used for DNA extraction. Briefly, 1-cm mycelial plugs were collected from the edge of actively growing colonies. For each isolate, five pieces of mycelium were transferred into a 250-ml erlenmeyer flask containing 50 250-ml of the following medium: (NH4)2SO4 1 g/liter,
KH2PO4 1 g/liter, MgSO4·7H2O 0.5 g/liter, FeSO4.7H2O 0.01 g/liter, in citrate buffer
50 mM (sodium citrate dihydrate 12.85 g/liter, citric acid 1.21 g/liter), amended with 10 g/liter dextrose and 3 g/liter yeast extract BACTO (BD and Co.). All salts were of technical grade. Cultures were grown for 4 days at room temperature on a rotary shaker set at 150 rpm.
For total DNA extraction, 2-ml aliquots of conidia were harvested by centrifugation (5000 g for 10 min). The fungal cell pellets were extracted using the EZNA Plant DNA Kit (OMEGA bio-tek), according to the manufacturer’s instructions. DNA concentration was determined with a spectrophotometer NanoView (GE Healthcare) and the final
DNA concentration was adjusted to 50 ng/μl in sterile water for further use in PCR reactions. DNA extracts were kept at -15°C for storage.
Plant DNA. All plant samples were pulverized with a bead mill TissueLyser (Qiagen)
as follows: 3 min at 30 Hz with 3-mm beads (35). The genomic DNA was extracted from 50-mg aliquots using the EZNA Plant DNA Kit (OMEGA bio-tek), following the manufacturer’s instructions. Plant DNA was diluted to 50 ng/μl in sterile water for use in PCR reactions.
PCR reactions
Primers. The markers used for the identification of fungi were the ITS region of
rDNA and the translation elongation factor 1-α gene (tef). The ITS region was amplified with two sets of primers. The first combination, ITS1F (8) and ITS4 (37), was specific to fungal ITS. The second set, ITS-Fu-f/ITS-Fu-r, was specific to Fusarium spp. (1). The
tef region amplification was performed with universal primers, ef1 and ef2 (29). The
second tef primer set, TEF-Fs4f and TEF-Fs4r (4), was used to discriminate the
Fusarium sp. isolated from infected tomatoes from the other Fusarium species. Full
sequences for the primers and PCR conditions are provided at Table 1.
Table 1. Sequences of primer sets derived from the internal transcribed spacer region and the translation elongation factor 1-α
Primers and
sequences (5’-3’) Target DNA Expected size of fragments (bp) Specificity PCR conditions
ITS1F
CTTGGTCATTTAGAGGAAGTAA ITS4
TCCTCCGCTTATTGATATGC
ITS ~605 Fungi 30 cycles; 30 s @ 94˚C, 1m @ 59˚C, 1 m @ 72˚C ITS-Fu-f CAACTCCCAAACCCCTGTGA ITS-Fu-r GCGACGATTACCAGTAACGA ITS ~400 Fusarium spp. 35 cycles; 30 s @ 94˚C, 30 s @ 59˚C, 30 s @ 72˚C ef1 ATGGGTAAGGARGACAAGAC ef2 GGARGTACCAGTSATCATGTT
tef ~733 Fungi 30 cycles; 30 s @ 94˚C, 30 s @ 60˚C, 1.5 m @ 72˚C TEF-Fs4f ATCGGCCACGTCGACTCT TER-Fs4r GGCGTCTGTTGATTGTTAG tef 650 F. solani/ F. striatum 35 cycles; 30 s @ 94˚C, 30 s @ 59˚C, 30 s @ 72˚C
18
PCR amplification. DNA amplification was performed in 20-µl mixture that
contained 0.2 mM of dNTP (Life Technologies), 0.8 µM of each primer (Life Technologies), 0.1 U of Taq DNA Polymerase (New England Biolabs), 1x of TAQ buffer, given with the enzyme, and 1 µl of genomic DNA (50 ng/µl). For reactions involving DNA extracted from the plant tissues, 5% DMSO was added in the PCR mixture; 20-µl volumes were completed with sterile water. Negative controls that excluded the DNA template were included in every experiment. Amplification was carried out with a thermal cycler Mastercycler (Eppendorf), programmed differently for each primer set (Table 1). PCR products were analyzed on 0.8% agarose gel in tri-boric acid EDTA buffer (TBE) at 120 V for 35 min. Agarose gels were stained with ethidium bromide and photographed under UV light.
Cloning and sequencing
The ITS and tef PCR products, generated using the primer pairs ITS1F/ITS4, ef1/ef2 and TEF-Fs4f/TEF-Fs4r, were purified using the EZNA Cycle-Pure kit, (OMEGA bio-tek). The PCR products were cloned using the pGEM-T Easy Vector System I (Promega) according to the manufacturers’ instructions. Escherichia coli TOP 10 chemically competent cells were used to amplify the transformed plasmids. Plasmid DNA from white colonies was purified by kit (EZNA Plasmid Mini kit I, OMEGA bio-tek) and analyzed on agarose gels. Positive clones were sent to sequencing at Plate-Forme génomique du CHUL (Université Laval, www.sequences.crchul.ulaval.ca). Sequencing was performed using the M13 sequencing primer-binding sites.
Pathogenicity tests
Culture conditions. Seeds from three cultivars, Trust, Yellow and Multifort, were
sown individually in 15-cm pots containing pasteurized Promix (Premier Tech). Tomato plants were grown in greenhouse for 5 weeks at 25°C/20°C with 70% relative humidity and a 14-h photoperiod prior to inoculation. Plants were watered daily and fertilized weekly (20-20-20: 6 mg/liter of water).
Pathogen inoculation. Seven isolates previously purified from diseased tomato
tissues, including three isolates from Quebec, two from Maine and two isolates of
PDA for 8 days at 28°C to yield a good microconidia titer. One-centimeter incisions were made on the plant stems, just under the petiole of the middle leaf, with a sterile scalpel. The inoculum was collected by scraping the surface of a fungal colony with a sterile scalpel. The inoculum was then inserted into the incision. Control plants were inoculated with sterile PDA. The inoculated areas were protected with strips of aluminum foil. Each isolate was tested on all cultivars in three replicates. Tomato plants were transferred to a growth chamber at 25°C/20°C with 80% RH and a 16-h photoperiod and observed daily for disease progression. Fungal colonies, isolated from stem cankers, as well as collected necrotic plant tissues surrounding cankers, were submitted to PCR analysis to confirm the identity of the pathogen.
Results
Disease symptoms
Tomato plants dying from unspecified causes were reported from commercial greenhouse operations in central Quebec and Northeastern United States. Symptomatic plants had brown cankers at graft points (Fig. 1A) and at sites of pruning lesions (Fig. 1B). The cankers were flat and depressed with a clear delineation from the stem. A longitudinal section of the stems showed a dark brown discoloration of the pith area while the vascular tissues were seemingly untouched (Fig. 1C). Orange red to dark-red perithecia were observed on necrotic tissues and directly on rockwool slabs (Fig. 1D). Diseased tomato plants died in less than two months if the cankered area was not removed within two weeks following the observation of the first symptoms.
Collection sample and fungal description
From the 55 samples collected and received, 53 isolates were recovered from the cankers collected in Quebec and five from the United States. Surface disinfection and fragmentation of the diseased tissues in small pieces before plating allowed the consistent isolation of one fungus with uniform morphology in culture, producing cottony, cream to yellowish colonies on PDA (Group 1) (Fig. 2A and B). In fact, only three isolates collected in Quebec presented a different morphology in culture and developed salmon colored colonies (Group 2) (data not shown). Microscopic
20
observations revealed that all isolates formed conidiophores, microconidia and macroconidia typical of the genus Fusarium (Fig. 2C and D).
Perithecia were formed by all cultures of Group 1 isolates on SNA under UV while single-spore cultures recovered from Group 2 isolates did not form perithecia. The morphology of perithecia and ascospores (Fig. 2E and F) was similar and compatible with descriptions of the Haematonectria sexual states of the FSCC (31). Ascospores (eight per ascus) were arranged within cylindrical asci.
Figure 1. Photographs of diseased tomato plants. A. brown canker at graft point; B. brown canker at site of a pruning lesion; C. dark brown discoloration of the pith area; D. orange red to dark-red perithecia at the base of a diseased tomato plant.
22
Figure 2. Photographs and light micrographs of sexual and asexual structures of fungal isolates from diseased tomato plants. A. top view of a typical colony growing on Potato Dextrose Agar; B. bottom view; C. phialids; D. microconidia and macroconidia ; E. perithecia identified as typical of F. striatum produced from a single-spore culture on SNA medium; F. ascospores contained within asci, obtained from perithecia of F.
striatum.
Fungal identification
PCR genetic analysis was performed on seven randomly selected isolates, five from Group 1 (08A, 12A, 23A, 24A and 45A) and two from Group 2 (14A, 19A). Using fungi-specific primers ITS1F and ITS4, 605-bp amplicons were generated, cloned and sequenced. Comparison of the sequencing results with GenBank indicated that the 605-bp fragment amplified from Group 1 isolates was 99% identical to F. striatum
(accession number AF178398) (26) while fragment from Group 2 had 100% homology with F. oxysporum (accession EU839403).
A second PCR analysis was performed using fungi-specific tef primers ef1/ef2. A 733-bp amplicon was obtained for the seven strains. Sequences of Group 1 yielded a 99.9% homology with the tef sequence of F. striatum NRRL 52699 (accession number JF740782) (28) and with F. striatum MAFF237668 (GenBank accession AB513844), isolated from tomato in Japan (22). The same isolates had 98% homology with F. solani f. sp. eumartii recovered from Japan and California (AB498980 and DQ164848, respectively) (22). Sequencing of the tef region of the two isolates from Group 2 confirmed their belonging to F. oxysporum species (accession number JF794779).
The sequences obtained from Group 1 isolates have been deposited in the NCBI Genbank, as KF483867 (23A), KF483868 (24A), KF483869 (08A), KF483870 (12A), and KF483871 (45A).
Pathogenicity tests
Inoculation of healthy tomato plants with the Group 1 randomly selected isolates identified previously as F. striatum resulted in lesions identical to those observed in diseased plants (Fig. 3B and C). Indeed, a typical brown discoloration of the stem was visible within 2-3 days on all inoculated plants. After one week, wilting symptoms were observed, as cankers expanded from the inoculation point. A longitudinal section of the stems of diseased plants revealed dark brown pith with no apparent coloration of the vascular tissues (Fig. 3C), matching the symptoms originally observed on greenhouse plants (Fig. 1C). Tissue sampling at the margins of advancing cankers yielded fungal isolates that were re-identified as F. striatum by sequencing of the tef region, thus completing Koch’s postulates. The isolates identified as F. oxysporum from our initial sampling were non-pathogenic on tomato plants (Fig. 3D) and control plants were symptomless (Fig. 3A).
Although all three cultivars developed cankers following inoculation with isolates of
F. striatum, they did not respond with the same intensity. Based on lesion spread and
symptomology, cv. Yellow was found to be more susceptible than Trust and Multifort (data not shown).
24
Figure 3. Koch postulates. A. control plant inoculated with agar medium; B. canker on a plant inoculated with Group 1 isolates (F. striatum); C. longitudinal section of the canker obtained in B; D. longitudinal section of a plant inoculated with Group 2 isolates (F. oxysporum). Photographs were taken 8 days after inoculation.
Specificity of PCR amplification
Primer specificity on purified fungal genomic DNA. Using the Fusarium species
specific primers (ITS-Fu-f/ ITS-Fu-r), PCR products were generated from all the pure cultures of Fusarium isolates studied, including F. oxysporum f. sp. radicis-lycopersici,
F. oxysporum, F. sambucinum and F. graminearum (Fig. 4A). However, when
specifically optimized primers TEF-Fs4f/TEF-Fs4r (Table 1) were used, only Fusarium strains isolated from diseased tomato plants displayed a single and uniform amplification product of 650 bp (Fig. 4B). Subsequent analysis of the five isolates from Group 1 and the two isolates from Group 2 used for pathogenicity test confirmed the specificity of the primers toward F. striatum (Fig. 5). As a matter of fact, all 55 isolates from Group 1, gave single amplification products using the primers TEF-Fs4f and TEF-Fs4r while no amplification occurred when these specific primers were tested on the three isolates of Group 2 (results not shown).
Detection directly from plant tissue DNA. A 650-bp PCR product was amplified
DNA fragment was amplified from control plants (Fig 6). PCR amplification was performed twice for each DNA extract with similar results.
Figure 4. Gel electrophoresis of PCR-amplified products (A. primers ITS-Fu-f/ITS-Fu-r and B. primers TEF-Fs4f/TEF-Fs4r) from the following strains. Lane 1, F. oxysporum f. sp. radicis-lycopersici; lane 2, F. oxysporum spp.; lane 3, F. graminearum; lane 4, F.
sambucinum; lanes 5 to 8, Group 1 isolates from diseased tomato plants.
Figure 5. PCR amplification using the primers TEF-fs4f and TEF-fs4r on DNA extracted from cultures of isolates tested for their pathogenicity. Lanes 1 to 5, five
F. striatum isolates used in pathogenicity tests (08A, 12A, 23A, 24A and 45A); lanes 6
26
Figure 6. Detection of F. striatum in plant DNA extracts using the set of primers TEF-fs4f and TEF-fs4r. Lane 1, DNA from a healthy plant (negative control 1); lane 2, purified mycelium of F. oxysporum isolate (negative control 2); lane 3, purified mycelium of F. striatum isolate (positive control); lanes 4 to 6, tissues from three randomly selected cankers.
Source of F. striatum
All samples of stems, graft points, above and under the graft points and roots from nursery-plants tissues, gave a single PCR product of about 400 bp using primers ITS-Fu-f/ITS-Fu-r (data not shown) and 650 bp using primers TEF-Fs4f/TEF-Fs4r (Table 2).
The tef DNA sequences of two randomly selected samples (LMA61, LMA75) were 100% identical to those of F. striatum isolated from cankers, confirming that the PCR products amplified with TEF-Fs4f/TEF-Fs4r were from F. striatum (Table 2). Sequences from those two isolates were deposited in the NCBI Genbank as KF483872 (LMA61) and KF483873 (LMA75).
Table 2. Detection of F. striatum in different parts of tomato plant received from the nursery, with the set of primers TEF-Fs4f/TEF-Fs4r.
Sample category Tissues samples Positive PCR amplification Plants from the
nursery
Stem 6/6
Graft point 6/6
Above graft point 6/6 Under graft point 6/6
Roots 6/6
Control plant Stem 0/3
Discussion
This study highlighted the presence of Fusarium striatum as the causal agent of crown and stem rot and wilt of greenhouse tomato plants in North America. We were further able to develop specific primers that allowed the discrimination of F. striatum from other closely related Fusarium species.
Although Fusarium spp. are significant plant pathogens affecting a large variety of hosts, their identification at the species level remains complex (2,10,18). Accurate identification of this new tomato pathogen represented a unique challenge because of the prevalence of Fusarium spp. attacking tomato plants (19,22,36,39) and the taxonomic complexity related to FSSC (40). By morphological observations, the disease agent was initially identified as F. solani. In the taxonomic system of Nelson et al. (23), F. solani was considered a single morphologically defined species, although the occurrence of host specific formae speciales and seven distinct mating populations was long recognized (21). Since then, many phylogenetic species have been described, including
28
several species of F. solani responsible for the sudden death of soybean plants (3). Subsequent multigene analyses revealed the existence of over 60 phylogenetic species within the FSSC, divided into three large clades (7,9).
Some species of the FSSC are morphologically distinct but in general they are most easily recognized by specific pathogenicity combined with diagnostic DNA barcodes, generally partial sequences of translation elongation factor 1-α (tef) (10,15). The general fungal barcode for fungi, the internal transcribed spacer (32) is often not diagnostic to the species level in Fusarium, but is sometimes informative. The tef sequences of our five strains isolated from diseased tissues had 99.9% homology with MAFF237668, identified as F. striatum (GenBank accession AB513844) and isolated from tomato plants in Japan (22). Analysis of the ITS region led to the same identification. As with the strain from Japan, our strains were homothallic, producing perithecia on SNA. Moreover, our morphological observations were consistent with those of Sherbakoff (33) and Rossman et al. (31).
Fusarium striatum was described by Sherbakoff (33) from potato tubers collected in
Colorado; it caused a ―striate rot‖ when inoculated into potatoes. Wollenweber and Reinking (38) considered Sherbakoff’s species a variety of F. solani, and it was subsequently subsumed completely into the broad morphological concept of that species until Nirenberg & Breilmaier-Liebetanz (24) associated it with a sexual state, then called Haematonectria ipomoeae (31).
Fusarium striatum was systematically isolated from the samples collected in central
Quebec and Maine and pathogenicity tests of all selected isolates were positive. By contrast, the F. oxysporum isolates that were also obtained from a few cankers yielded negative results when assayed against tomato. Because F. striatum was re-isolated from the plant tissues and re-identified, pathogenicity was irrefutably established according to Koch’s postulates. Interestingly, symptoms caused by F. solani f. sp. eumartii, recently described as the agent of foot rot in tomato plants in Japan, were very similar to those observed with F. striatum and a high homology (>98%) was found between their tef sequences. A distinguishing feature appears to be the heterothallism of F. solani f. sp.
The tef region is an attractive marker enabling one to choose species-specific primers to detect and discriminate the pathogen, as variability occurs among sequences of closely related Fusarium species (10,22). Indeed, detection of F. striatum using the specific primers TEF-fs4f and TEF-fs4r was positive for all plants expressing symptoms. As expected, these primers did not amplify F. oxysporum, isolated from tomato plants, nor Fusarium oxysporum f. sp. radicis-lycopersici, which causes similar wilt-like symptom. As Henson and French (11) demonstrated, the PCR-based detection technique is rapid, reliable and accurate as the causal agent can be immediately detected in mixed samples that contain other morphologically similar fungi. However, in silico comparisons of the primer sequences against GenBank show that our assay does not distinguish among many of the component species of the FSSC, restricting its utility for screening, for example, soil or potting mixtures where other members of this species complex can be expected to occur. Under such cases, sequencing of the amplicons would be necessary for discrimination.
Based on our results combining the PCR assay with sequencing of the amplicons, we confirmed the presence of F. striatum in plant samples with no disease symptoms. These plants were obtained from the nursery supplying the greenhouse growers in Quebec as well as in The Maine. This suggests that the inoculum was brought in by the nursery plants given that F. striatum was recovered from all tissues sampled. As a first prophylactic measure, the PCR assay provides a preventive approach alerting the nursery and greenhouse growers to make sure that the plants are exempt from contamination when entering the greenhouse.
Another fortuitous observation regarding cultivar susceptibility to the disease could be exploited as a control method (6,14,41). Although our objective was to test the pathogenicity of F. striatum, we noted that the pathogen did not develop as rapidly in cvs. Multifort and Trust than in cv. Yellow. These observations indicate that genotypic differences exist among these cultivars, so further investigations might enable the development of cultivars with a higher resistance to F. striatum.
In conclusion, we report the presence of F. striatum as the causal agent of crown and stem rot of greenhouse tomato in both Canada and the USA. Moreover, we have shown
30
that PCR-based technique developed is a valuable tool to the rapid detection of this new tomato pathogen. At this stage, screening of nursery plants entering the greenhouse for the presence of F. striatum is considered the most sensible method to prevent spread of the disease.
Acknowledgments
This research was supported by the Innovative Agri-Food Sector Support Program offered by the province of Quebec and the grant from the Canada Research Chairs Program to R.R. Bélanger
We thank Audrey Boulianne and ―Les Serres du St-Laurent Inc.‖ staff for essential contribution toward obtaining the collection of tomato crown and stem rot samples from Quebec. The authors would like to thank Nancy Shallow and Gérard Gilbert from the Laboratoire de diagnostic, MAPAQ, for helpful discussions.
Literature cited
1. Abd-Elsalam, K. A., Aly, I. N., Abdel-Satar, M. A., Khalil, M. S., and Verreet, J. A. 2003. PCR identification of Fusarium genus based on nuclear ribosomal-DNA sequence data. Afr. J. Biotechnol. 2:82–85.
2. Aoki, T., O’Donnell, K., Homma, Y., and Lattanzi, A. R. 2003. Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex — F. virguliforme in North America and F. tucumaniae in South America. Mycologia. 95:660–684.
3. Aoki, T., O’Donnell, K., and Scandiani, M. M. 2005. Sudden death syndrome of soybean in South America is caused by four species of Fusarium: Fusarium
brasiliense sp. nov., F. cuneirostrum sp. nov., F. tucumaniae, and F. virguliforme.
Mycoscience. 46:162–183.
4. Arif, M., Chawla, S., Zaidi, N. W., Rayar, J. K., Variar, M., and Singh, U. S. 2012. Development of specific primers for genus Fusarium and F. solani using rDNA sub-unit and transcription elongation factor (TEF-1α) gene. Afr. J. Biotechnol. 11:444– 447.
5. Booth, C. 1971. The genus Fusarium. Commonwealth Mycological Institute, Kew, UK.
6. Bournival, B. L., Scott, J. W., and Vallejos, C. E. 1989. An isozyme marker for resistance to race 3 of Fusarium oxysporum f. sp. lycopersici in tomato. Theor. Appl. Genet. 78:489–494.
7. Coleman, J. J., Rounsley, S. D., Rodriguez-Carres, M., Kuo, A., Wasmann, C. C., Grimwood, J., Schmutz, J., Taga, M., White, G. J., Zhou, S. G., Schwartz, D. C., Freitag, M., Ma, L. J., Danchin, E. G. J., Henrissat, B., Coutinho, P. M., Nelson, D. R., Straney, D., Napoli, C. A., Barker, B. M., Gribskov, M., Rep, M., Kroken, S., Molna´r, I., Rensing, C., Kennell, J. C., Zamora, J., Farman, M. L., Selker, E. U., Salamov, A., Shapiro, H., Pangilinan, J., Lindquist, E., Lamers, C., Grigoriev, I. V., Geiser, D. M., Covert, S. F., Temporini, E., VanEtten, H. D. 2009. The genome of
Nectria haematococca: Contribution of supernumerary chromosomes to gene
expansion. PLoS Genetics 5:e1000618.
8. Gardes, M., and Bruns, T. D. 1993. ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Mol. Ecol. 2:113–118.
9. Geiser, D. M., Aoki, T., Bacon, C. W., Baker, S. E., Bhattacharyya, M. K., Brandt, M. E., Brown, D. W., Burgess, L. W., Chulze, S., Coleman, J. J., Correll, J. C., Covert, S. F., Crous, P. W., Cuomo, C. A., De Hoog, G. S., Di Pietro, A., Elmer, W. H.,
32
Epstein, L., Frandsen, R. J. N., Freeman, S., Gagkaeva, T., Glenn, A. E., Gordon, T. R., Gregory, N. F., Hammond-Kosack, K. E., Hanson, L. E., del Mar Jiménez-Gasco, M., Kang, S., Kistler, H. C., Kuldau, G. A., Leslie, J. F., Logrieco, A., Lu, G., Lysøe, E., Ma, L. -J., McCormick, S. P., Migheli, Q., Moretti, A., Munaut, F., O’Donnell, K., Pfenning, L., Ploetz, R. C., Proctor, R. H., Rehner, S. A., Robert, V. A. R. G., Rooney, A. P., bin Salleh, B., Scandia, M. M., Scauflaire, J., Short, D. P. G., Steenkamp, E., Suga, H., Summerell, B. A., Sutton, D. A., Thrane, U., Trail, F., Van Diepeningen, A., VanEtten, H. D., Viljoen, A., Waalwijk, C., Ward, T. J., Wingfield, M. J., Xu, J. -R., Yang, X. -B., Yli-Mattila, T., and Zhang, N. 2013. Letter to the editor: One fungus, one name: Defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology. 103:400–408.
10. Geiser, D. M., Jimenez-Gasco, M. M., Kang S., Makalowska, I., Veeraraghavan, N., Ward, T. J., Zhang, N., Kuldau, G. A., and O’Donnell, K. 2004. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. Eur. J. Plant Pathol. 110:473–479.
11. Henson, J. M., and French, R. C. 1993. The polymerase chain reaction and plant disease diagnosis. Annu. Rev. Phytopathol. 31:81–109.
12. Jarvis, W. R. 1989. Managing diseases in greenhouse crops. Plant Dis. 73:190–194. 13. Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 1991. Compendium of tomato
diseases. American Phytopathological Society Press St. Paul, MN.
14. King, S. R., Davis, A. R., Zhang, X., and Crosby, K. 2010. Genetics, breeding and selection of rootstocks for Solanaceae and Cucurbitaceae. Sci. Hortic. 127:106–111. 15. Kristensen, R., Torp, M., Kosiak, B., and Holst-Jensen, A. 2005. Phylogeny and
toxigenic potential is correlated in Fusarium species as revealed by partial translation elongation factor 1 alpha gene sequences. Mycol. Res. 109:173–186.
16. Lagopodi, A. L., Ram, A. F., Lamers, G. E., Punt, P. J., Van den Hondel, C. A., Lugtenberg, B. J., and Bloemberg, G. V. 2002. Novel aspects of tomato root colonization and infection by Fusarium oxysporum f. sp. radicis-lycopersici revealed by confocal laser scanning microscopic analysis using the green fluorescent protein as a marker. Mol. Plant Microbe In. 15:172–179.
17. Lee, J. M., Kubota, C., Tsao, S. J., Bie, Z., Echevarria, P. H., Morra, L., and Oda, M. 2010. Current status of vegetable grafting: Diffusion, grafting techniques, automation. Sci. Hortic. 127:93–105.
18. Leslie, J. F., and Summerell, B. A. 2006. The Fusarium laboratory manual. Blackwell Publishing, Ames, IA.
19. Marlatt, M. L., Correll, J. C., Kaufmann, P., and Cooper, P. E. 1996. Two genetically distinct populations of Fusarium oxysporum f. sp. lycopersici race 3 in the United States. Plant Dis. 80:1336–1342.
20. Marois, J. J., and Mitchell, D. J. 1981. Effects of fumigation and fungal antagonists on the relationships of inoculum density to infection incidence and disease severity in
Fusarium crown rot of tomato. Phytopathology. 71:167–170.
21. Matuo, T., and Snyder, W. C. 1973. Use of morphology and mating populations in the identification of formae speciales in Fusarium solani. Phytopathology. 63:562– 565.
22. Nakayama, K., and Aoki, T. 2010. Foot rot of tomato, a new disease in Japan, caused by Fusarium solani, f. sp. eumartii. Jpn. J. Phytopathol. 76:7–16.
23. Nelson P. E., Toussoun T. A., and Marasas, W. F. O. 1983. Fusarium species: An illustrated manual for identification. Pennsylvania State University, University Park 24. Nirenberg, H. I., and Brielmaier-Liebetanz, U. 1996. Nectria ipomoeae Halst.,
Anamorph: Fusarium striatum Sherb. an Passiflora edulis Sims. Nachrichtenbl. Deut. Pflanzenschutzd. 48:270–275.
25. Nirenberg, H. I., and O’Donnell, K. 1998. New Fusarium species and combinations within the Gibberella fujikuroi species complex. Mycologia. 90:434–458.
26. O’Donnell, K. 2000. Molecular phylogeny of the Nectria haematococca-Fusarium solani species complex. Mycologia. 92:919–938.
27. O’Donnell, K., and Gray, L. E. 1995. Phylogenetic relationships of the soybean sudden death syndrome pathogen Fusarium solani f. sp. phaseoli inferred from rDNA sequence data and PCR primers for its identification. Mol. Plant Microbe In. 8:709– 716.
28. O’Donnell, K., Humber, R. A., Geiser, D. M., Kang, S., Park, B., Robert, V. A. R. G., Crous, P. W., Johnston, P. R., Aoki, T., Rooney, A. P., and Rehner, S. A. 2012. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST. Mycologia. 104:427–445.
29. O’Donnell, K., Sutton, D. A., Fothergill, A., McCarthy, D., Rinaldi, M. G., Brandt, M. E., Zhang, N., and Geiser, D. M. 2008. Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the
Fusarium solani species complex. J. Clin. Microbiol. 46:2477–2490.
30. Romberg, M. K., and Davis, R. M. 2007. Host range and phylogeny of Fusarium
