Evaluation du stress mécanique de l’échantillon à l’angle magique : Validation

L’ébauche d’article, Molecular and physiological response of living cells to

mechanical stress by spinning motion HR-MAS fera l’objet d’une soumission dans NMR in biomedicine.

Avant de pouvoir réaliser des expérimentations sur les propriétés inhibitrices des hétérocycliques à azote angulaire, il convenait de s’assurer de la représentativité du modèle, c'est-à-dire procéder à l’évaluation du stress mécanique produit lors de l’étude d’un échantillon par HR-MAS et notamment la viabilité cellulaire. La lignée cellulaire considérée (THP-1) dans ce travail est finalement apparue comme viable pour une vitesse de rotation de 1,9 kHz pendant 15 min.

Toutefois, des changements ont été trouvés au niveau de la structure membranaire avec la méthode du bleue de trypan, du cycle cellulaire par la cytométrie en flux, de l’expression génétique et du métabolisme. Ceci montre l’importance d’une étude préliminaire précise du modèle cellulaire étudié par HR-MAS pour déterminer la vitesse de rotation et le temps d’étude afin d’éviter tout artéfact.

MOLECULAR AND PHYSIOLOGICAL RESPONSE OF LIVING

CELLS TO MECHANICAL STRESS BY SPINNING MOTION HR-MAS.

Sébastien Follot ^a,Thomas Poyot ^b, David Crouzier ^a, Christophe Delaunay ^c, Sandrine Richard ^b, Jacques Mathieu ^b, André Peinnequin ^b and Jean-Claude Debouzy ^a,*

a

CRSSA, Unité de Biophysique, BP82, 38702 La Tronche cedex, France.

b

CRSSA, Unité de Radiobiologie, BP82, 38702 La Tronche cedex, France.

c

CRSSA, Unité de Radiohématologie Expérimentale, BP82, 38702 La Tronche cedex, France.

* Corresponding author Fax : 33-(0)4-76-63-69-22 e-mail : jcdebouzy@crssa.net

Abstract

High resolution magic angle spinning (HRMAS) 1H NMR spectroscopy is used to access to cells metabolism. However, cells are subjected to high centrifugal forces that cause irreversible cell damage. It was of major interest of test the cell viability after spinning. Conditions have been defined to monitor and keep to minimum unwanted effects in HR-MAS spectra arising from the loss of cell integrity. The cell line considered in this work has shown a good resistance to spinning rotor at 1.9 kHz during 15 min. Thus, the NMR HR-MAS method is not deleterious for the cells and cells in the apoptotic pathway (more delicate). However, very important changes were found in membrane structure, cell cycle, molecular response and metabolism following the change of spinning duration.

.

Keywords: Mechanical stress / Apoptosis / Monocyte / Metabolic / Inflammatory / Nuclear

Abbreviations

HR-MAS: High Resolution-Magic Angle Spinning. MAPK: Mitogen-Activated Protein Kinase.

THP-1: Human acute monocytic leukemia cell line. TNF- α: Tumor Necrosis Factor-α.

TLR: Toll-like receptor. HSP: Heat Shock Proteins

RT-PCR: Real Time Polymerase Chain Reaction. IL-6: Interleukin-6.

IL-8: Interleukin-8.

NFĸB: Nuclear Factor kappa B. CSA: Chemical Shift Anisotropy.

INTRODUCTION

NMR studies of heterogeneous or viscous systems can provide high resolution information by the use of HR-MAS techniques (High Resolution Magic Angle Spinning). For example, in biological samples from plants and animals the HR-MAS can be used for establishing the metabolomics profile (Chauton et al., 2003; Righi et al., 2009; Tessem et al., 2008; Winning et al., 2009). This is achieved by high speed spinning (1 – 5 kHz) of the sample around an axis oriented at an angle of 54.7° with respect to the direction of the static magnetic field (Doty et al., 1998), thus resulting in an averaging to 0 of several interactions involved in line broadening in solids (CSA, QS….) (Cheng et al., 1996). The HR-MAS technique was also successfully used to obtain high resolution NMR spectra of living cell suspensions (Li et al., 2005). However, the effect of centrifugation impact is not well documented, e.g. the possible cell stress or perturbations related to the spinning itself. The MAS rates of 1 to 4 kHz results in relative centrifugal forces in the range of 8,000 to 130,000 g in a 3mm rotor (Aime et al., 2005). It was of major interest to test the structure and viability of the cells in the rotor under the scope of dynamic, metabolic or kinetic experiments in cells (Li et al., 2005). Hence, mechanical stresses activate many biological cellular functions such as cell shape, proliferation, growth, gene expression, inflammation (Ashida et al., 2003; Bandoh et al., 1997)… Early cellular responses to mechanical stress remain incompletely described and recent works evidenced that mechanical stress (vortex) could activate cytokine and chemokine expression, as well as biofunctional changes (Cell adhesion of THP-1) (Ashida et al., 2003; Ohki et al., 2002; Yamamoto et al., 2006). For instance, increase of mRNA expression of IL-6 (interleukin-6) and IL-8 (interleukin-8), tumor necrosis factor-α

(TNF-α) or Toll-like receptor (TLR) and heat shock proteins (HSPs) were detected for centrifugation forces between 48 and 280 g.

Among the different functions of TNF-α in the inflammation process during the acute phase, the leukocyte-endothelial cell adhesion occupies a special place (Magder et al., 2006).

(among various intra and extra cellular stimuli) activates Nuclear Factor kappa B (NFĸB), an ubiquitous transcription factor (Kim, 1999; Verstrepen et al., 2008).

Furthermore, a possible role of TLRs in the mechanical stress mediated cytokine production should be considered: TLRs are involved in various pathologies such as atherosclerosis and in the defense against both exogenous pathogens and endogenously generated inflammatory ligands (Heldwein et al., 2003; Liang et al., 2002). This is specially true for TLR2 which is significantly affected by mechanical stress (Kim et al., 2008).

Finally, HSP70 signaling via (or not) TLR pathway should be addressed. The heat shock response is defined by the rapid expression of a specific group protein of HSPs (Welch, 1992). The primary function of HSPs is to participate and assist in protein folding and maturation. As this phenomenon was first described in response to hyperthermia, it was appointed the heat shock response, although it was identified in various other forms of cellular stress (Ritossa, 1962). HSPs are typically showed as intracellular proteins, while they are also present in the extracellular compartment. Recently, it has become evident that HSP70 in human represents a nonspecific stress response (Aneja et al., 2006).

This study used a cell model (THP-1) submitted to a mechanical stress by HR-MAS related to the motion. The effect of MAS on cell viability was evaluated by different conventional methods (microscopy, flow cytometric analyze and RT-PCR), with the aim of assessing whether the metabolic degradation is correlated with cellular property.

RESULTS

Mechanical effects

High speed spinning of the sample is necessary to perform HR-MAS experiments. Obviously, this motion is heterogeneous, as a result of a solid phase (the rotor) and the cell preparation itself, with a viscous semi-solid phase (cells) and the containing aqueous buffer mixed as an unknown heterogeneous medium (Elbayed et al., 1999). However, centrifugal forces tend to collapse the sample against the internal wall of the rotor. This centrifugal pressure σc (MPa), can be classically described for the rotor (Elbayed et al., 2005) itself as a function of the angular frequency ωR (2Πf), the NMR samples density ρ (1.19 g cm^-3) and outer and inner rotor radii, R_a (2 mm) and R_i (0), respectively.

(

)

The equation 1 can also be used to estimate the centrifugal constraints applied on the NMR sample inside the rotor, i.e a sample spinning at 1.9 kHz undergoes a centrifugal pressure of

σc = 0.53 MPa (= 5.3 bar) at its outer circumference (cells position).

Metabolite analysis

To quantitation, the “Substract-Quest” procedure (Graveron-Demilly, 2006) was used. The relative amounts of various metabolites were estimated from the corresponding peak intensity contribution to the ¹H-NMR spectra of cells with spinning time between 0 and 60

(control) or after an activation using 7-ketocholesterol (7-keto, 10 µg/ml), a classical apoptosis inducing reagent for THP-1 cells (Berthier et al., 2005; Palozza et al., 2009). Minor non significant differences on metabolite contributions and repartitions with time were only observed on control samples, mainly on taurine and glutamine. Conversely, the activation by 7-keto induced a decrease of taurine contribution and an increase of choline contribution after 30 min of spinning at 1.9 kHz. After the rotor spinning experiment, the supernatant was taken and analyzed by NMR. HR-MAS was then applied and the amounts of metabolites similarly recorded on THP-1 cells (3) and the supernatant 0 and 15 min of spinning (1, 2). Figure 1-B shows examples of HR-MAS ¹H NMR spectra, recorded with water-presaturation and T2 filtered. After 75 minutes of spinning (time), the spectra (not shown) recorded on the supernatant of control cells showed metabolite contribution (lactate, creatine, phosphocholine and glutamate), compatible with only minor cell degradation. As before, after the activation by 7-keto the metabolites were detected in the supernatant after 20 min of spinning, indicating that shorter spinning times (15 min) do not affect significantly cell metabolism. Besides, cell viability and several gene regulation had also to be assessed.

Physiological analysis

To investigate the effects of spin rate on cell viability (membrane integrity), a sample of THP-1 cells was spun at 1.9 kHz at different times from 0 – 24 hours (Table 1). Trypan blue is a stain that is actively extruded from viable cells, but which readily enters and stains dead cells. A viability of 8 hours was observed for cells stored at 4°C in immobilized rotor while the cells stored at 4°C in the spinning rotor have a viability of 3 hours. Besides, THP-1 (control) cells response to mechanical stress during 15 min exhibited no morphological change characteristics of monocyte (Figure 2). The cells exhibited a round profile, even after

4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 A B 3 2 1 0 0,01 0,02 0,03 0,04 0,05 0,06 0,07

ACE ALA CHO CR GLU GSH GLY LAC M-INS PC TAU

Metabolites R e la ti v e a m p li tu d e ppm

Figure 1: A) Relative amplitude of metabolites determined by quantitation of ¹H-MAS NMR spectrum of cells at different time of spin duration 0 (●), 15 (□), 30 (▲), 45 (■), 60 (♦) min; B) Typical ¹HR-MAS NMR spectrum of cells (3) and the cell supernatant after 0 (1) and 15 (2) min of spin duration in rotor.

Spinning duration (hours)

Intact cells (4°C) HR-MAS cells (4°C)

% surviving cells % surviving cells

0 94 94

1 95 93

3 94 92

8 91 75

24 79 54

A B

Figure 2: Morphology of THP-1 cells before (A) and after 15 min (B) of rotor spinning at 1.9 kHz (Scale bars = 50 µm).

recultivation. No phenomena of cells adhesion were detected. Doubling time was also used to assess cell viability, by reflecting the capacity of proliferation of the cells (Figure 3). The cells stored at 4°C in immobilized rotor during 15 and 120 min showed a doubling time of 42 and 46 hours respectively. For the cells stored at 4°C in the spinning rotor during 15 and 120 min showed a doubling time of 49 and 91 hours respectively after 24 hours of recultivation. After 48 hours of recultivation, the doubling time for the cells stored of 4°C in the spinning rotor during 120 min was identical for the control.

The percentage of cells in each of the various cell cycle phases (G0/G1, S, or G2) was determined using flow cytometry (Table 2). The percentage of cells in the different cell cycle phases are shown with or without exposure to mechanical stress (spinning duration 60 min), but also with or without cells perturbations by external aggressions (LPS (Mackman et al., 1991), 7-keto). No significant change of the cell cycle even after by LPS activation (1 µg/ml and 24 hours activation) was observed. The cells in the presence of 7-keto (10 µg/ml and 24 hours activation) showed a higher proportion of cells in the G0/G1 phase of the cell cycle compared with controls. Similarly, the fraction of cells was significantly lower in S phase in 7-keto treated culture than in controls. However, activation by 7-keto with spinning rotor during 60 min showed a decrease of cells in the G0/G1 phase. The proportion of the cells in the S phase increased for the cells without spinning.

RNA and stress markers

The effect of mechanical stress on the evolution of 6 genes (IL-6, IL-8, TNF-α, TLR2, HSP70, NFĸB) after induction of inflammation by LPS (1 µg/ml) was studied (Figure 4). The expression of mRNA of IL-8, TNF-α, TLR2, NFĸB, HSP70 in THP-1 cells was detected after

Figure 3: Effect of spinning on doubling time. The evolution of doubling time of intact cells determined by method of Trypan blue, control (

●

30 40 50 60 70 80 90 100 24 48 72 96 120 Time (hours) D o u b li n g t im e ( h o u rs )

treatment Intacts cells HR-MAS cells (60 min spinning)

G0/G1 S G2 G0/G1 S G2

control 48.5 ± 1.4 36.8 ± 1.1 14.7 ± 1.7 47.7 ± 1.8 35.9 ± 1.3 16.4 ± 1.4 7-keto 62.2 ± 2.5 23.0 ± 1.2 14.8 ± 1.5 58.5 ± 1.5 28.1 ± 1.4 13.4 ± 1.1 LPS 50.7 ± 2.1 34.4 ± 1.6 14.9 ± 1.6 50.1 ± 1.9 35.4 ± 1.5 14.5 ± 1.1

Table 2: Effect of spinning rate after activation by LPS and 7-keto (24 hours) on cell cycle progression in THP-1 macrophage.

Figure 4: Experimental protocol of mRNA measurement. LPS sample 0 min 60 min Rotor preparation at 4°C 75 min 90 min HR-MAS cells Intact cells THP-1 incubation at 37°C Sto rag_e Spⁱⁿ ni^ng

a LPS activation (Figure 5). The level of NFĸB mRNA expression was slightly increased (even if not significant compared to control) after spinning rotor. Also, level of TNF-α mRNA was significantly increased after 15 min of mechanical stress (Figure 6). For IL-8, TLR2 and HSP70 no change significant was found. By way of contrast, the level of IL-6 mRNA expression in monocytes was not detected in the same condition (Figure 4).

0 0,4 0,8 1,2 1,6 2 IL-8 HSP70 TLR2 R e la ti v e U n it s

Figure 5: Effect of spinning on IL-8, TLR2 and HSP70 mRNA expression. Intact cells are

represented in white and HR-MAS cells in black (15 min spinning). Data are ± standard deviation (n = 10 for each group).

Figure 6: Effect of spinning on NF-kB and TNF-α mRNA expression. Intact cells are represented in white and HR-MAS cells in black (15 min spinning). indicate significant test with p<0.05. Data are ± standard deviation (n = 10 for each group).

0 0,4 0,8 1,2 1,6 2 NFkB TNF-α R e la ti v e U n it s

DISCUSSION

One way to determine the metabolomic profile in intact cells is using NMR HR-MAS. This method allows identification and the quantitation of metabolites in a given organism or a biological sample. However, deleterious effect of this method for the cells by the relative centrifugal forces was not investigated. The aim of this study was to show the effects of spinning as a mechanical stress on molecular response and metabolism in human monocytic cells THP-1.

The first unexpected result was the response of cells to mechanical stress which was different depending on cells activation (7-keto). Also, when cells were stressed metabolic changes and molecular response occurred more rapidly than for intact cells. The metabolic degradation was revealed by the metabolite liberation in the supernatant indicating that mechanical stress can play an important role in metabolic profile changes. However, the metabolic profiles can be considered stable if spinning experiments do not exceed respectively 75 min for healthy and 20 min for apoptotic cells. Thus, the membrane integrity was affected by HR-MAS ¹H-NMR spectroscopy due to spinning motion as previously observed (Aime et al., 2005; Taylor et al., 2003).

Another important observation was the change in cells physiology due to mechanical stress. Even if Trypan blue test confirmed that a 20 min spinning duration did not change the morphology and membrane integrity in intact cells, biological perturbations had occurred, as shown by the changes in the doubling time. This feature was also shown by flow cytometry. Indeed, cell cycle analysis showed a decrease of percentage of cells in the G0/G1 phase at 24 hours after activation by 7-keto. Such a decrease of percentage of cells in the G0/G1 phase

was related to spinning motion. The apoptotic pathway (7-keto activation) has induced the change of the membrane structure (Jourd'heuil et al., 1996; Phillips et al., 2001; Vejux et al., 2009). Thus, the membrane structure is more fragile and the centrifugal force shears the cell membrane with a production of cells fragment.

The results of the literature suggest interrelation between mechanical stress and gene expression of cytokine (IL-6, IL-8), HSPs, NFĸB, TNF-α and TLRs (Beeton et al., 2006; Suzuki et al., 2000). IL -6, IL-8, HSP70 and TLR2 genes were found stable in this work whereas increase significant of TNF-α gene was detected (Yuan et al., 2008). The response of cells to mechanical stress (15 min) induced TNF-α mRNA production from THP-1. In the literature, increase of TNF-α mRNA level contributes to the complex processes involved in activation of inflammation or atherogenesis (Yamamoto et al., 2003). A parallel between increase of level TNF-α mRNA and the slight increase of NFĸB mRNA production was observed. Indeed, the NFĸB is a transcription regulator that is activated by various intra and extra cellular stimuli including cytokines like TNF-α (Muller et al., 1993). This is coherent with development of first steps of stress reaction, which is generated by spinning motion.

In summary, the experiments show that for lower spinning duration at 20 min and spinning rate of 1.9 kHz, the HR-MAS has not visible impact of metabolomic profile for THP-1 cells. However, other methods reveal that a spinning duration than lower 20 min has consequence on cells viability, growth and regulation of gene expression. The first conclusion is that cells viability must be studied for each study HR-MAS. The second conclusion is that HR-MAS approaches for the study of living cells do not allow recuperation of sample for other experiments (Flow cytometric, RNA analysis...).

ACKNOWLEDGEMENTS.

This work was supported by grants from the French Service de Santé des Armées and Direction Générale de l'Armement (POR6 CT4, PEA n°010807). Thanks to Prof Amora Maill for helpful corrections.

EXPERIMENTAL

Cell culture and viability test

The human myelomonocytic cell line, THP-1 (ECACC 88081201; Sophia-Antipolis, France) was used. These non-adherent cells were grown in suspension in RPMI 1640 with Glutamax^TM-I (Gibco, Eragny, France) and antibiotics (100 U/mL penicillin, 100 µg/mL streptomycin) (Gibco), supplemented with 10% (v/v) heat-inactivated fetal calf serum (Gibco). The THP-1 cells were incubated at 37°C under a 5% CO₂/95% air atmosphere (v/v). For all experiments, the monocytes were stimulated with optimal dose (1 µg/ml) of bacterial LPS (lipopolysaccharide, Escherichia coli serotype O111:B4) and 7-ketocholesterol during 24 h (7-keto, 10 µg/ml).

The Trypan blue exclusion test was used to assess cell viability. The cell suspension was well mixed with an equal amount of 1% Trypan blue solution in PBS (Phosphate buffered saline). The solution was introduced in the Malassez cells (microscope). The cells viable were round shaped and bright, while dead cells looked completely blue due to the incorporation of Trypan through the damaged membranes. The viability test was performed immediately before experiment in the rotor and immediately after the removal from the rotor itself.

HR-MAS

All HR-MAS experiments were performed on Bruker AVANCE-DMX-400 (proton frequency 400.13 MHz) using a Bruker HR-MAS probe head. Samples were loaded in zirconium oxide 4 mm cylindrical rotor with spherical insert (internal volume of 50 µl). Samples were spun at 1900 Hz.

The 15 x 10⁶ cells in culture solution were taken at discrete times and centrifuged for 5 min at 400g to collect the THP-1. The cell pellet was washed three times with PBS D₂O and a final centrifugation. The semi-dry cell paste was resuspended in 30 µl of a PBS D2O TSP (3 mM Trimethylsilyl-2,2,3,3-tetradeuteropropionic acid sodium salt). The solution were rapidly placed in rotors with spherical insert. The rotors were immediately transferred into the HR-MAS probe and acquisition started after 3 min of temperature equilibrium

NMR experiments. 1H-NMR experiments were recorded 16 K digitization points. A

Carr-Purcell-Meiboom-Gill (CPMG) synchronized pulse sequence with an echo-time of 30 msec was used to reduce the lipid contributions. The interpulse delay was 345 µsec and water was presaturated during the relaxation delay of 2 s, 12 min were necessary for the acquisition of 256 transients .

It is important to know whether the temperature controller of the instrument used gives a correct reading of the actual temperature within the sample (4°C). The calibration was obtained by methanol, loaded in 4 mm ZrO2 cylindrical rotor with spherical insert (internal volume of 50 µl) with a spinning speed of 4000 Hz. The chemical shift difference between the OH proton and those of the methyl group is used for the calibration.

RNA preparation and real-time PCR

The primers were synthesized at Eurogentec (Saraing, Belgium). Primer design and optimization regarding to primer-dimer, selfpriming formation was done with MacVector software (Accelrys, San Diego, USA) as described previously (Peinnequin et al., 2004). Selected forward (FW) and backward (BW) primers are shown in Table 3. THP-1 mRNAs were isolated from one million cells samples with a MagnaPure LC mRNA Isolation Kit II

Primer set 5'-3' Primer sequence IL-6(NM_000600) FW BW CCACTCACCTCTTCAGAACGAATTG TGCCTCTTTGCTGCTTTCACAC IL-8(NM_000584) FW BW TGGCAGCCTTCCTGATTTCTG GGGGTGGAAAGGTTTGGAGTATG ALUSX FW BW TGAGGTCAGGAGTTCGAGACCAG CCTCCCGAGTAGCTGGGATTAC TNF-α(NM_000594) FW BW TCTTCTGTCTGCTGCACTTTGGAG GCTTGAGGGTTTGCTACAACATGG HSP70A1A(NM_005345) FW BW AGATCACCATCACCAACGACAAG TCGTCCTCCGCTTTGTACTTCTC TLR2(NM_003264) FW BW CATCAGCCTCTCCAAGGAAGAATC TCTGTGAGCCCTGAGGGAATG NF-κB(NM_020529) FW BW GAGACCTGGCTTTCCTCAACTTC GCAATTTCTGGCTGGTTGGTG

(Roche Applied Science, Mannheim, Germany) in a MagnaPure LC instrument according manufacturer’s instructions mRNAs were eluted in a 50 µl final volume. Reverse transcription was carried out in a 15 µl final volume from 6 µl of mRNA solution using the Reverse Transcriptase Core Kit (Eurogentec, Saraing, Belgium) with 50 µ M oligo(dT) primer and 20 U/µl RNase inhibitor according to the manufacturer’s instruction. Real-time PCRs were carried out with the LC Fast Start DNA Master SYBR Green kit (Roche Diagnostic, France), using : for IL-6 3 mM MgCl₂ and 0.4 µM primer, HSP70 – ALUSX 4 mM MgCl₂ and 0.4 µM primer, TLR2 - NF-kB – IL-8 4 mM MgCl2 and 0.5 µM primer. Quantitative PCR was performed using LightCycler (Roche Diagnostics) for 50 cycles at 95°C for 20 s, 53°C (NF-kB), 54°C (IL-8), 55°C (TLR2), 56°C (HSP70), 58°C (IL-6), 59°C (ALUSX), 60°C (TNF-α.) for 10 s, and 72°C for 10 s. Quantitation was achieved using Cycle threshold (CT) measured with the second derivate maximum method (LightCycler software v3.5, Roche Diagnostics). Specificities of the PCR amplification were documented with LightCycler melting curve analysis. Melting peaks obtained from RT product and from specific