Saccharomyces cerevisiae ssp. boulardii sur l’immunité
intestinale et systémique du porc suite à une infection
expérimentale à Salmonella Typhimurium DT104
Résumé
Nous avons évalué chez le porcelet l’influence d’administrer une alimentation de base ou supplémentée avec PA et/ou SCB ou des antibiotiques sur l’immunité intestinale et la résistance lors d’une infection expérimentale avec Salmonella Typhimurium DT104 (ST). Les probiotiques ont été administrés quotidiennement par voie orale (lactation) et via l’alimentation (post-sevrage). À 43 jours d'âge, les porcs ont été infectés avec ST. Après 24 heures des échantillons de sang et d’intestins ont été recueillis pour évaluer la colonisation microbienne, la quantité d’IgA sécrétoire, l’expression de cytokines et les populations de cellules immunitaires des ganglions mésentériques (GM) et du sang. Les résultats obtenus ont démontré que l’administration de SCB seul ou avec PA module la concentration de certaines populations cellulaires du sang avant et suite à l’infection, cependant aucun effet n’a été observé sur la colonisation du pathogène, la sécrétion d’IgA, les populations cellulaires des GM ou l’expression des cytokines.
Title: Effects of Pediococcus acidilactici and Saccharomyces cerevisiae
subsp. boulardii on systemic and gut immunity in pigs challenged with
Salmonella Typhimurium DT104.
J.-P. Brousseau1,2, A. Lettelier3, F. Beaudoin1, K. Lauzon1, J.-F. Daudelin1, D. Roy2 and M. Lessard1*
1Dairy and Swine Research and Development Centre, Agriculture and Agri-Food Canada,
Sherbrooke, Québec, J1M 1Z3 Canada; 2Université Laval, Québec, Québec, G1V 0A6 Canada and 3Université de Montréal, Faculté de Médecine Vétérinaire, St-Hyacinthe, Québec, J2S 7C6 Canada Lévis, Québec, G6V 9V6 Canada.
*Corresponding author: Martin.Lessard@agr.gc.ca
Short Title: Effects of probiotics following a S. Typhimurium infection
Key Words: probiotic, Pediococcus acidilactici, Saccharomyces cerevisiae subsp. boulardii, pig, immunity, in-feed antibiotics, Salmonella Typhimurium DT104
Abstract
In this study, the influence of the probiotics Pediococcus acidilactici (PA) and Saccharomyces cerevisiae subsp. boulardii (SCB) on intestinal immune traits and resistance to Salmonella Typhimurium DT104 infection was evaluated in pigs. At birth, different litters of pigs were randomly assigned to one of the following treatments: 1) control group without probiotics or antibiotics (CTRL); 2) reference group in which chlortetracyclin and tiamulin were added to weanling feed (ATB); 3) PA, 4) SCB or 5) PA+SCB. Probiotics were administered daily during lactation (1×109 cfu) and after weaning. At 43 days of age, all pigs were orally challenged with S. Typhimurium DT104 strain, and a necropsy was performed 24 h post-challenge (24 hpc). Intestinal samples were collected to evaluate microbial colonization, secretory IgA production, mesenteric lymph nodes (MLN) cell populations and ileal cytokine expressions. Blood samples were collected before challenge (d39) and 24 hpc to analyze immune cell populations.
On d39, blood cell populations from the PA+SCB group showed a higher percentage of CD8+ T cells compared to ATB (P=0.045) and a higher percentage of CD8+high cells than CTRL (P=0.024) and ATB (P=0.016) groups. Moreover, the PA+SCB group had a lower percentage of macrophages compared to CTRL (P=0.024) and ATB (P=0.019). Finally, pigs from the SCB group showed a tendency to have more CD4+CD8+ T cells on d39 than CTRL (P=0.069) and ATB (P=0.072). On d44, the blood CD4+ cells from pigs of the SCB and PA+SCB groups had a tendency to be lower than the CTRL group (P=0.077 and P=0.060, respectively). The CD8+ cells tended to be higher in the blood of the ATB and PA+SCB groups than the CTRL (P=0.071 and P=0.058, respectively). Finally, on d44 piglets had a higher percentage of blood macrophages and CD4+CD8+ T cells than on d39 (P<0.0001 and P=0.008, respectively), while B cells percentage was decreased (P<0.0001). Neither the pathogen colonisation, IgA production, MLN cell populations nor the cytokine expressions analyzed in this study were modulated by the probiotic treatments. Nonetheless, the IL-4 expression in the ileum mucosa was lower in the ATB group compared to the CTRL (P=0.014).
In conclusion, even if the administration of SCB alone or in combinaison with PA are effective in modulating the concentration of some immune blood cell populations, neither of the probiotic treatments were able to influence the pathogen colonisation, MLN cell populations or cytokine expression 24 hpc. However, it does not mean that the probiotic effects highlighted in this study could not be a effective mechanism in reducing the time of the Salmonella infection or the duration of the shedding period, but more research is needed to confirm this hypothesis.
Introduction
In North America, antimicrobials are commonly added to the weaning diet of pigs to stimulate growth and to control or treat gastrointestinal infection (195). This practice is severely criticized due to the possible emergence of antimicrobial resistance in the pig’s microbiota. Among the alternatives, probiotics are considered good candidates because they have the potential to enhance intestinal barrier properties (234), modulate bacterial populations in the gut (94), stimulate the immune system (60) and the production of cytokines by enterocytes and immune cells (56, 296).
Probiotics such as Pediococcus acidilactici (PA) and Saccharomyces cerevisiae subsp. boulardii (SCB) are currently used in swine production and they have been shown to improve intestinal defenses against microbial infection and increase performance in different monogastric animals (105, 114). For instance, Pediococcus can inhibit Salmonella growth in vivo (145), whereas Saccharomyces has been reported to stimulate intestinal immunity and has the potential to link flagellated bacteria on its surface (30, 101). Our laboratory observed a decrease in bacterial translocation to mesenteric lymph nodes (MLN) in weaned pigs treated with PA, SCB or both, following an enterotoxigenic Escherichia coli O149:F4 (ETEC F4) challenge (172). We also showed that PA or SCB are effective in reducing attachment of ETEC F4 to ileal mucosa of weaned pigs but only PA modulated the expression of intestinal inflammatory cytokines (56). However, the positive effects of probiotic administration observed in those studies may not be the same with another type of enteropathogenic bacteria. Therefore, the influence of PA, SCB or both on the intestinal epithelial barrier and immunity in pigs after a Salmonella infection was evaluated. To do
so, we analysed pathogen colonization and translocation, the IgA production, the expression of intestinal cytokines and immune cell populations in blood and MLN.
Materials & methods
Animals and treatmentsThe animal use protocol was reviewed and approved by the Dairy and Swine Research and Development animal care committee and followed the principles established by the Canadian council on animal care (37). The experimental protocol has been already described previously (56), however a brief description is provided to facilitate understanding.
A total of 40 Yorkshire-Landrace gilts obtained from La Coop fédérée (Montreal, QC, Canada) and housed at Agriculture and Agri-Food Canada’s Dairy and Swine Research and Development Centre (Sherbrooke, QC, Canada) were used to carry out the experiment. Two batches of 20 gilts were constituted and each batch of gilts was used in two successive parities over a two-year period. Regu-Mate (Intervet Canada Ltd., Whitby, ON, Canada) was used to synchronize oestrus, and sows were inseminated twice with the same tested semen provided by the Centre d’insémination porcine du Québec inc. (St-Lambert-de- Lauzon, QC, Canada). Among an expected total of 80 litters, 40 were used as described below.
Twenty-eight days before parturition (day -28), pregnant sows were allocated to one of the five treatment groups using a complete randomized block design. Three groups of sows and their litters were assigned to one of the following treatments: Pediococcus acidilactici (strain MA18/5M, Lallemand Animal Nutrition, Blagnac, France), Saccharomyces cerevisiae subsp. boulardii (strain SB-CNCM I-1079, Lallemand Animal Nutrition), or P. acidilactici in combination with S. cerevisiae subsp. boulardii. The other two groups were used as reference and control groups respectively; piglets of the reference group received at weaning a diet supplemented with chlortetracycline and tiamulin antibiotics (ATB) and those of the untreated control group (CTRL) were fed weanling basal diet without ATB or probiotics. For both groups, sows and their litters remained untreated throughout the gestation and lactation periods. The antibiotics used in this study are
commonly used by pig producers in North America in weanling feed to improve performance and to prevent enteric and respiratory diseases. Therefore, the ATB group was considered as a reference group. The sows assigned to the probiotic treatments received 2.5 × 109 cfu from day -28 to day -14, 3.5 × 109 cfu from day -14 to day 0 (parturition), and 6 × 109 cfu from day 0 to day 21. In the P. acidilactici + S. cerevisiae subsp. boulardii group, both probiotics were simultaneously given at the indicated concentrations above. The probiotic doses were mixed with 500 g of feed and given to the sows before the morning meal. The daily feed ration given to the sows was 2.5 kg from day -28 to day -14, 3.5 kg from day -14 to day 0, and ad libitum during the lactation period (day 0 to day 21). The groups of sows were housed in different pens located in different sections of the gestation room to prevent cross-contamination between the treatments. One week before farrowing, the sows were transferred to rooms allocated to different treatments in the maternity section. From each batch of 20 gilts, 10 gilts and their piglets (two litters per treatment) were randomly chosen. Within the first 24 h after parturition, litter size was adjusted to 12 piglets and, if necessary, adoptions were carried out from litters assigned to the same treatment.
Table 1. Nutrient composition of the weaning diet (d21 to d44)
Nutrient Concentration Protein, % 21.5 Fat, % 7.52 Fiber, % 2.34 Calcium, % 1.00 Phosphorus, % 0.76 Sodium, % 0.2 Copper, mg/kg 128.17 Zinc, mg/kg 138.41 Vitamin A, IU/kg 11,500 Vitamin D, IU/kg 1,140 Vitamin E, IU/kg 56
Twenty-four hours after birth, the pigs started to receive orally the same probiotic treatment as their mother by means of disposable pipettes. In the probiotic groups, the daily dose of each probiotic was 109 cfu diluted in 2 mL peptone water. The pigs in the control and reference groups (CTRL and ATB, respectively) received 2 mL peptone water alone. The probiotics suspension or peptone water was given daily during lactation and after weaning at 21 days of age (d 21) until d 28. At weaning, all pigs were transferred to their respective pens to prevent cross-contamination. Pigs having received probiotics during the lactation were also fed a basal diet enriched with the same probiotic at 2 × 109 cfu/kg. The pigs in the ATB group received the same diet supplemented with chlortetracycline (110 ppm active ingredient/kg) and tiamulin (31.2 ppm active ingredient/kg). The basal diet was provided by La Coop fédérée (Table 1). Feed and water were available ad libitum to the weaned pigs.
Salmonella Typhimurium strain and experimental challenge
The Salmonella enterica serovar Typhimurium 4393 DT104 strain used in the challenge study was kindly provided by Dr. Ann Lettelier from the Faculté de médecine vétérinaire (Saint-Hyacinthe, QC, Canada) of the Université de Montréal. At 39 days of age, one pig from each litter was transferred to a level 2 biosecurity containment facility (Canadian Food Inspection Agency, Saint-Hyacinthe Laboratory, QC, Canada). The pigs were housed in groups (one pen per treatment group). Four days after transfer (d 43), the pigs were orally challenged with 5x108 cfu S. Typhimurium DT104 strain in 5 mL Nutritive broth (Difco Laboratories, Inc., Detroit, MI, USA). Inoculum was administered with a seringue directly in the throat of the pig. The pigs were evaluated for general appearance, attitude, dehydration, food and water intake, and presence of diarrhea, in accordance with the guidelines of the Canadian Council on Animal Care, and were euthanized 24 h post- challenge (hpc), on d44. Necropsies were performed and samples of mesenteric lymph nodes (MLN), ileal tissue and intestinal contents were collected always at the same location for all the pigs for further analysis.
Microbiological analysis of intestinal contents and MLN
Following euthanasia, intestinal contents from the ileum and proximal colon were sampled and serially diluted for enumeration of the probiotics and the S. Typhimurium DT104 challenge strain. Plates containing LAMVAB agar (125) were used for the detection of P.
acidilactici. The plates were incubated aerobically for 48 h at 37°C. Potato dextrose agar (BD Biosciences, Mississauga, ON, Canada) adjusted to pH 3.5 with sterile tartaric acid (10% solution), to inhibit bacterial growth, was used for the detection of S. cerevisiae subsp. boulardii. The yeast plates were incubated at 30°C for 48 h. To enumerate the S. Typhimurium DT104 strain in the intestinal contents, plate containing Hektoen Agar (Oxoid Company, Nepean, ON, Canada) supplemented with ampicillin at 200 μg/mL (Sigma-Aldrich Canada Ltd., Oakville, ON, Canada) were used. The plates were incubated aerobically for 24 h at 37°C.
For the detection of viable S. Typhimurium DT104 in ileocecal MLN, 200-300 mg of tissue, lightly washed in phosphate-buffered saline (PBS), was homogenized for 5 s using a Polytron homogenizer (Kinematica Inc., Bohemia, NY, USA) in 2-3 mL sterile PBS. Serial dilutions were done and then plated on Hektoen Agar supplemented with ampicillin at 200 μg/mL.
Measurement of secretory IgA in ileal mucosa
A 5 cm segment of ileum taken approximately 20 cm from the cecum was used for quantification of secretory IgA (sIgA). First, the mucosa from the segment was scraped and homogenized using microscope slide in 5 mL PBS. The sample was centrifuged for 10 min at 500 x g then passed on 0.2 μm filter and finally frozen at −20°C until analysis. The secretory IgA in the ileal mucosa was measured using a Pig IgA ELISA Quantitation Kit (Kit E100–102; Bethyl Laboratories Inc., Montgomery, TX) following manufacturer instructions.
Isolation of leukocytes from blood and MLN
Twenty-four hpc, jugular blood samples (10 mL) were collected from piglets on d44 using sodium heparin (143 USP units) Vacutainer® tubes (BD Biosciences, Mississauga, Ontario, Canada). A blood sample was also collected on d39 before the transfer of pigs for Salmonella challenge. Peripheral blood mononuclear cells were obtained by layering blood on Ficoll-Paque PLUS (GE Healthcare, Baie d’Urfe, Quebec, Canada) and processed as described by Lessard and colleagues (171). For cell labeling, 106 cells suspended in PBS containing 0.5% BSA were added to the wells of round-bottom 96-well microplates
(Corning Life Sciences, New York, NY). The cells were marked as described in the section Flow Cytometry Analysis.
After blood collection, pigs were anesthetised with ketamine (10 mg/Kg) and xylazine (Rompun®, 5 mg/Kg) before being euthanized with euthanyl (107 mg/Kg) (CDMV, St- Hyacinthe, Canada). Gastrointestinal tract was excised and mesenteric lymph nodes were collected and placed in cold Hank’s basal salt solution (HBSS; Invitrogen Canada Inc., Burlington, Ontario, Canada) supplemented with a solution of antibiotic and antimycotic (10 000 U penicillin, 10 000 ug streptomycin, 25 ug fungizone) (Invitrogen, Burlington, Ontario, Canada) for transportation. In the laboratory, MLN were minced with scissors in a Petri dish containing HBSS and pass into a 5-mL syringe. The suspension obtained was transfered into a 15 ml conical tube and tissue debris were left to settle for 5 min, thereafter, each cell suspension was carefully layered on Ficoll-Paque PLUS (GE Healthcare, Baie d’Urfe Quebec). Tubes were centrifuged at 750 × g for 40 min at 20°C, and the cells collected at the interface were washed 3 times in HBSS. Labelling was done using 106 cells suspended in PBS containing 0.5% BSA and added to the wells of round-bottom 96-well microplates (Corning Life Sciences).
Flow Cytometry Analysis
Mononuclear cells from the blood and MLN were labeled for flow cytometry according to the procedure described by Lessard et al. (171) to characterize CD4+, CD8+, double positive CD4+CD8+ and γδ-T lymphocyte populations, B-lymphocytes, monocytes, and macrophages. Ice-cold PBS containing 0.5% BSA was used to dilute antibodies. The different antibodies used and their cell specificity are presented in Table 2. Labeling of CD4+ T cells and γδ-T lymphocytes were done with mouse monoclonal antibodies, followed by their respective isotype of goat anti-mouse Ig conjugated to fluorescein (FITC; Southern Biotechnology Associates Inc., Birmingham, AL). The B lymphocytes were directly labeled with a goat anti-pig IgG conjugated to FITC (Jackson Immunoresearch Laboratories Inc., West Grove, PA) and with a mouse monoclonal antibody against swine CD21 followed by an anti-mouse IgG1 conjugated to phycoerythrin (rPE; Southern Biotechnology Associates Inc., Birmingham, AL). Labeling of CD8+ lymphocytes and monocytes/macrophages population were done with mouse monoclonal antibodies, the
second step of the staining was done with their respective isotype of goat anti-mouse Ig conjugated rPE. Double-labeling was used for CD4 and CD8 by incubating them with anti- CD4-FITC and anti-CD8-PE simultaneously. Finally, NK cells were labeled with a biotin conjugated anti-CD16 mouse monoclonal antibodies, followed by streptavidin PE-Cy™5 conjugate (BD Biosciences, Mississauga, Ontario, Canada). The cells were resuspended in PBS containing 1% formaldehyde and transferred to tubes. They were analyzed with an Epics XL-MCL flow cytometer using the Expo 32 Software (Beckman-Coulter, Mississauga, Ontario, Canada).
RNA extraction and cDNA synthesis
At necropsy, pieces from MLN and ileal slices taken approximatly 20 cm from the ileocecal junction were immediately frozen in liquid nitrogen and stored at -80°C until RNA extraction. Total RNA was extracted from MLN samples and ileal slices using a tissue RNA extraction kit (RNeasy Plus kit from QIAGEN Inc., Toronto, ON, Canada). Briefly, 60-100 mg of MLN or a ileal slice beetween 200-300 mg was homogenized 5 s in RLT buffer containing 2-Mercaptoethanol (Sigma-Aldrich Canada) using a Polytron Table 2. Swine-specific antibodies used to characterize different populations of leukocytes isolated from blood and mesenteric lymph nodes.
Specificity Clone name Source Type of cells identified Isotype
CD4 74-12-4 VMRD T cells IgG2b
CD8 PT36B VMRD T cells IgG1
IgG (H+L chain) Jackson Immun. Lab. B cells
CD21 BB6-11C9 VMRD B cells IgG1
SWC3 74-22-15A VMRD Monocytes and
macrophages IgG2b
CD16 FcG7 BD Biosciences NK cells Biotinated
homogenizer (Kinematica). Then an aliquot corresponding to 20 mg of tissue was used for total RNA extraction following the manufacturer’s recommendations. The RNA was eluted in 50 μL ultrapure water provided in the kit supplemented with SUPERase•In at 1 U/μL (Applied Biosystems Inc., Foster City, CA, USA). Total RNA was quantified using a NanoDrop spectrometer (NanoDrop Technologies, Inc., Wilmington, DE, USA) at a wavelength of 260 nm. The RNA integrity was confirmed by examination of the presence of the 18S and 28S ribosomal bands on agarose gels stained with ethidium bromide before proceeding to gene expression analysis. To eliminate possible contamination by genomic DNA, aliquots of 8 μg were treated with DNase I (Applied Biosystems/Ambion, Austin, TX, USA) following instructions. Total RNA was quantified again with a NanoDrop spectrometer (NanoDrop Technologies) and purity was assessed by determining the ratio of absorbance at 260 and 280 nm (A260/A280). All samples had a ratio between 1.8 and 2.0. A 1
μg aliquot of total RNA was reverse-transcribed with Superscript II reverse transcriptase (Invitrogen Canada) using oligo (dT)12-18 primer (Invitrogen Canada) in a final volume of 20 μL, according to the supplier’s instructions. The cDNA samples were diluted 1:15 in nuclease-free water and aliquots were stored at -20°C prior to real-time PCR analysis. Quantification of cytokine gene expression by real-time PCR
Real-time PCR was performed with a 7500 Fast Real-Time PCR System (Applied Biosystems) to evaluate the expression of the cytokines listed in Table 3. The PCR mixture was composed of the following: 5 μL Power SYBR Green Master Mix (Applied Biosystems), 0.1 μL AmpErase uracil-N-glycosylase (Applied Biosystems), each set of gene specific primers (Applied Biosystems) at the indicated concentrations (Table 3), 3 μL of diluted 1:15 cDNA and completed to a final volume of 10 μL with molecular grade water (Invitrogen Canada). The primers were designed using the IDT SciTools PrimerQuest software (IDT SciTools PrimerQuest Software, Integrated DNA Technologies, Inc.) and selected using the following criteria, when possible: (1) both forward and reverse primers encompass two consecutive exons; and (2) no more than two guanines or cytosines within the last five nucleotides in the 3’ termini. Moreover, the primer pairs used were optimised to have an efficiency variation lower than 10% between
them. With the primers used, the measured efficiency was between 81% and 91%. The PCR cycling conditions used were in accordance with the manufacturer’s protocol.
All the cDNA samples in this experiment were analyzed for the expression of three different reference genes: beta-actin (ACTB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and cyclophilin A (PPIA). These three reference genes are commonly used in in vivo experiments similar to that of our study (26, 45, 73). Statistical analyses were performed and results indicated that ACTB was the most stable reference gene for use in our experiment, as its expression was not altered by the treatments administered to pigs in contrast to the two other reference genes tested (data not shown).
Table 3. List of genes and sequences of the primers used for real-time PCR*. mRNA target1 Oligonucleotides (5' → 3')2 Product size (bp) Final concentration (nM)3 IL-4 F:GGTCTGCTTACTGGCATGTACC R:CTCCATGCACGAGTTCTTTCTC 117 150 150 IL-6 F:GGAAATGTCGAGGCTGTGCAGATT R:GGTGGTGGCTTTGTCTGGATTCTT 87 300 300 IL-10 F:GATATCAAGGAGCACGTGAACTC R:GAGCTTGCTAAAGGCACTCTTC 137 300 300 IFN-γ F:AGGTTCCTAAATGGTAGCTCTGGG R:AGTTCACTGATGGCTTTGCGCT 101 300 300 TNF-α F:CACTGACCACCACCAAGAATTGGA R:CATTCCAGATGTCCCAGGTTGCAT 94 300 300 ACTB R:GCGTAGAGGTCCTTCCTGATGT F:CTCTTCCAGCCCTCCTTCCT 104 300 300 *From Daudelin et al. (56).
1Definition of acronyms : IL = interleukin; IFN = interferon; TNF = tumor necrosis factor;
ACTB = β-actin.
2 F and R indicate forward and reverse primers, respectively. 3 Final concentration of forward (F) and reverse (R) primers.
The relative gene expression was assessed by the 2-ΔΔCT method (178), in which the PCR