Chapter IV : General discussion and perspectives
Chapitre IV. General discussion and perspectives
The aim of this thesis was to study the transcriptome of thyroid carcinomas in order to give a better understanding of the molecular mechanisms that lead to the development and progression of these tumors.
Hybridization of 26 papillary thyroid carcinomas (PTCs) on Agilent microarray slides enabled us to generate tremendous amounts of data which were used to find signatures between different subtypes of PTCs. Interests of these signatures are multiple, and include correlation between the molecular and biological phenotypes, leading to a better understanding of the subtypes of these tumors, identification of potential therapeutic targets specific to a variant and discovery of new diagnostic or prognostic markers. The first question we asked was to know if it was possible to separate radio-induced and sporadic PTCs. We found that on a global scale, transcriptomes of sporadic and post- Chernobyl PTCs were similar, which confirmed a previous study of our laboratory based on a smaller number of genes and samples
173. Nevertheless, although both types of tumors represent the same disease, we found that they could be accurately separated, with a more subtle analysis, using a multi-genes signature. Two other independent gene expression signatures were also able to separate post-Chernobyl and sporadic PTCs, one related to their presumed respective etiological agents (radiation vs. H
2O
2), the other related to the homologous recombination DNA repair mechanism. We interpreted these results as evidence for different and detectable cancer susceptibility factors between both types of tumors. Different additional experiments should be done to give weight to this hypothesis. Indeed, the susceptibility signature is weak, maybe due to the fact that each tumor is compared to its adjacent tissue, which could attenuate the signal. Therefore, direct comparison of post-Chernobyl and sporadic PTCs on Affymetrix slides could lead to a stronger signature. We have already performed these experiments and analyses are still ongoing. In addition, our study does not formally rule out potential confounders, such as age or ethnic factors which are clearly different between both types of tumors.
Thanks to our collaboration with the Chernobyl Tissue Bank, our laboratory has planned
to collect thyroid tumors from young Ukrainian patients born after the Chernobyl
explosion and to compare them with the radio-induced tumors. Finally, our potential radiation signature should normally also be found in healthy tissues. Therefore, our laboratory is trying to obtain blood from Ukrainian patients with radio-induced or sporadic PTC in order to see if the susceptibility signature is present in these cells as well.
In the long-term, a radiation susceptibility test could be set up.
Microarray analyses also enabled to identify a signature composed of 54 genes associated to the classical variant of PTCs. Analysis of this gene list by the DAVID software enabled us to relate, at least partially, this signature to the most important remodeling of the classical subtype compared to the other histological variants. This includes the uPA system (uPAR and uPA) which was overexpressed in the classical variant at the mRNA level. Confirmation of their regulation at protein level should allow to confirm the major role of this system in the remodeling of PTCs. A weakness of this study is the imbalance between the classical (n=17) and the other variants of PTC (n=9). Additional gene expression profiles of non-classical variants of PTCs could lead to a stronger signature, possibly with more genes.
RET/PTC rearrangements and activating BRAF mutations are the two most common
genetic alterations in PTCs. They both lead to the constitutive activation of the MAPK
ERK1/2 signaling pathway, considered as the primary event leading to papillary
carcinogenesis. Nevertheless, while BRAF only activates the ERK1/2 cascade, receptors
tyrosine kinase like RET are able to activate other cascades like the PI3K signaling
pathway. Therefore we would expect, at least partially, a different molecular profile
between tumors harboring the BRAF mutation and those harboring RET/PTC
rearrangements. Nevertheless, we did not succeed to find a signature between both types
of tumors with a supervised method (SAM) using Agilent slides. In accordance with our
data, Frattini et al showed that PTCs with RET/PTC or BRAF mutation were associated
with a similar gene expression profile
174. Nevertheless, they showed subtle differences
existing between both types of tumors using supervised methods. These small differences
between their and our results could be explained by sample size, different DNA
microarray platforms and genetic or environmental differences in their Italian patients
compared to our French and post-Chernobyl patients. More surprisingly, Giordano et
harboring the different gene alteration (including RAS mutation) based on their global gene expression. This large discrepancy between Frattini and our results, compared to those of Giordano is difficult to explain. We postulated that these discordant results occured from the fact that Frattini et al and we used dual channel microarrays while Giordano et al used the one channel Affymetrix technology. Consequently, Giordano et al directly compared tumors without substraction of the adjacent tissue, which was not the case in the two other studies. Nevertheless, our last study of PTCs analyzed on Affymetrix slides did not support this hypothesis. Explanation of this large discrepancy still remains unknown.
Deriving a reference gene list from our study on Agilent microarray slides and two other studies
176,177enabled us to identify many genes consistently regulated through PTCs compared to their adjacent tissue. This gene list was based on 50 tumors derived from patients of different ages presenting various histological variants and genetic alterations, and therefore constitutes the common molecular phenotype of the majority of PTCs.
Analysis of this regulated gene list with statistical tools led to several conclusions, including the identification of genes related to the lymphocytic infiltration of these tumors, a general uncompensated downregulation of immediate early genes and a correlation between the molecular phenotype and the probable collective migration mode of PTCs.
We also observed a regulation of many ECM proteins, proteases and proteases inhibitors consistent with the important remodeling of these tumors. Moreover, identification of a signature with a larger overexpression of proteases in the classical subtype compared to the other variants adds weight to the involvement of these genes in the remodeling.
We also investigated the regulation of the three major MAPK signaling pathways
ERK1/2, p38 and JNK. Contrary to the ERK1/2 and p38 cascades, the JNK was
statistically differentially activated by overexpression of their components. This result is
in accordance with a previously published immunohistochemistry study
178. The JNK
cascade is commonly activated by cytokines and we could therefore imagine that the
general overexpression of cytokines as observed in our gene list leads to activation of this
pathway. Nevertheless, its role in tumor development remains controversial
179. A role for
the JNK pathway in tumorigenesis is supported by the high levels of JNK activity found in several cancer cell lines
179. Moreover, it has been shown that oncogenic Raf and JNK cooperate to induce massive hyperplasia in the eye of a Drosophila model
180. In humans, a role for JNK in tumorigenesis has been reported in liver, where JNK was shown to promote chemically induced hepatocarcinogenesis
181. This pro-oncogenic role of JNK may be related to its own ability to promote proliferation. In contrast, other studies have linked JNK to tumor suppression
179. One mechanism of tumor suppression is mediated by a role for JNK in tumor surveillance by the immune system
182. Tumor suppression may also be mediated by the pro-apoptotic effects of JNK activation
179. Together, these data suggest that JNK may play a context-dependent role in tumorigenesis. In PTC, the role of the JNK pathway activation is not yet investigated and the study of this cascade in thyroid cell cultures stimulated by EGF/serum, a treatment that mimic papillary thyroid carcinogenesis
163, could therefore lead to a better understanding of this signaling pathway in PTC.
Analysis of the regulated gene list also showed a statistically significant overexpression of the components involved in the EGF signaling pathway, among which several EGF ligands, which can supplement the genetic alterations commonly found in PTCs for the activation of the ERK1/2 cascade. Interestingly, while genetic alterations activate this cascade only in cells harboring these mutations, the EGF ligands can potentially also induce proliferation of neighbouring cells, by paracrine stimulations. This could explain the reported heterogeneity of some PTC, where only a small subset of cells harbor RET/PTC rearrangement
117,183. Hypothesis of paracrine stimulations (EGF or other) from rearranged cells inducing proliferation of adjacent, non-rearranged thyrocytes, was therefore tested in vitro. Unfortunately, our results were negative, although many reasons can explain this, as discussed in §V of the results chapter. Nevertheless, activation of the EGF signaling cascade is also present in RET/PTC rearranged mice (Burniat et al, in preparation) and its role in papillary thyroid carcinogenesis should therefore be investigated in this model.
During the last year of the thesis, we decided to assess the gene expression profiles of the
very aggressive anaplastic thyroid carcinomas, and to compare them with the ones of
types of tumors. A muldidimensional scaling (MDS) analysis has shown that ATC displayed a gene expression profile intermediate between PTCs and thyroid cancer cell lines, suggesting a trend to dedifferentiation and higher proliferation rate from PTCs to cell lines. Because the MDS was performed on a global scale, this suggests that the major differences between ATCs and PTCs are related to dedifferentiation and proliferation.
Nevertheless, the genes differentially expressed between both types of cancers have to be further analyzed with statistical tools to have more insight into the differences in their physiopathology. The different processes and signaling pathways that have been identified as regulated in PTCs compared to adjacent tissues should be analyzed in ATCs.
Because no other large scale investigations have been realized so far for ATCs, this study would be the starting point for a better understanding of this very aggressive thyroid tumor. This work is currently ongoing in the laboratory.
To conclude, this thesis can be considered as an initiating work trying to understand the
molecular mechanisms that regulate thyroid carcinogenesis, and more specifically the
physiopathology of PTCs. The strength of our study is that our analyses are based on in
vivo data, which generated many hypotheses about the initiation, the progression, the
aggressiveness and the invasion of PTCs. Nevertheless, in vitro studies are now required
to validate these hypotheses and to go further in the understanding of the mechanisms
involved.
Chapter V : Material and methods
Chapter V. Material and methods
Note: In this section, we describe the material and methods related to results from sections II, V, VI, and VII of the results chapter. The remaining material and methods are described in the 2 published papers, in section III and IV.
I. Material
I.1 Cell lines
- KAT 10: human thyroid cell line derived from a papillary thyroid carcinoma - FTC 13342: human thyroid cell line derived from a follicular thyroid carcinoma - BCPAP: human thyroid cell line derived from a papillary thyroid carcinoma and
containing an activating mutation of BRAF
- TPC1: human thyroid cancer cell line derived from a papillary thyroid carcinoma and containing the RET/PTC1 rearrangement
- PCCL3: differentiated rat thyroid cell line
I.2 Culture mediums
3H medium:
Coon’s modified Ham’s F12 1µg/ml insulin
5µg/ml transferrin
1mU/ml TSH
1% fungizone
2% penicilin/streptomycin 5% FBS
2H medium: 3H medium without TSH Quiescence medium:
Coon’s modified Ham’s F12 5µg/ml transferrin
1% fungizone
2% penicilin/streptomycin 0,05% BSA
LB agar dishes:
LB agar
Ampicillin (100 µg/ml)
I.3 Solutions
I.3.1 Protein extraction and quantification Lysis buffer:
Tris-HCl 0,06M pH 6,8 SDS 2%
DTT 100 mM Glycerol 10%
Phosphatases inhibitors: sodium vanadate 100 µM and NaF 20 mM
Proteases inhibitors: Pefabloc 100 µg/ml and leupeptine 5µg/ml
Staining solution:
0,5% coomassie blue G 7% acetic acid 100%
Destaining solution:
7% acetic acid 100%
Extraction solution:
methanol 66%
NH
4OH 1%
I.3.2 Western blotting Separating gel:
poly-acrylamide 6,5%
Tris-HCl 375 mM pH 8,8 SDS 0,1%
Ammonium persulfate (APS) 0,05%
Temed 0,05%
Stacking gel:
poly-acrylamide 4%
Tris-HCl 125 mM pH 6,8 SDS 0,1%
Ammonium persulfate (APS) 0,05%
Temed 0,2%
Laëmmli buffer 1×:
Tris-HCl 0,06 M pH 6,2 SDS 2%
DTT 100 mM Glycerol 10%
bromophenol blue 0,1%
Electrophoresis buffer 1×:
Tris 25 mM Glycine 192 mM SDS 0,1%
Transfer buffer:
Tris 20 mM Glycine 154 mM Methanol 20%
PBS 1×:
NaCl 150 mM KH
2PO
42mM Na
2HPO
48mM KCl 3 mM pH 7,4 TBST:
Tris 1%
NaCl 150 mM
Tween 0,05%
Antibodies used:
Primary antibody:
- FAK
total(BioSource, Paisley, UK): dilution 1:1000 in TBST 1×
- FAK
397(BioSource, Paisley, UK): dilution 1:1000 in TBST 1×
- α-tubulin (NeoMarkers, Fremont, CA) : dilution 1:500 in TBST 1×
- β-actin (Sigma, St Louis, MO) : dilution 1:1000 in TBST 1×
Secondary antibody:
- mouse IgG antibody (Amersham, Buckinghamshire, UK): dilution 1:10000 in TBST 1×
- rabbit IgG antibody (Amersham, Buckinghamshire, UK): dilution 1:10000 in TBST 1×
I.3.3 Silver nitrate staining Fixator 1:
Methanol 50% (v/v) Acetic Acid 25% (v/v) Fixator 2:
Glutaraldehyde 10% (v/v) Washing solution:
Ethanol 10% (v/v) Acetic Acid 5% (v/v) Oxydation solution:
K
2Cr
2O
70.1% (w/v)
Nitric Acid 0.015% (v/v)
Silver Nitrate staining AgNO
30.2% (w/v) Developing solution
Na
2CO
33% (w/v)
Formaldehyde 0.02% (v/v) Stopping solution
Acetic Acid 3% (v/v) Glycerol 2% (v/v)
II. Methods
II.1 Proteins manipulations
II.1.1 Extraction and quantification of proteins
Thyroid tissues were pulverized in powder with teflon glass in 200 µl of lysis buffer.
After homogenization, the solution was incubated at 100°C during 5 minutes and stored until use.
To quantify proteins, we used the spectrophotometric technique to assess our proteins concentration compared to a standard curve. 4 µl of proteins were deposited on squares of 1,5× 1,5 cm
2on Wattman paper in parallel with 4 µl of blank and 8 standard solutions of BSA (respectively 1, 2, 3, 4, 5, 6, 8 and 12 µg of proteins). The Wattman paper was dried, and then successively incubated in methanol during 30 seconds to eliminate all substances interfering with the assay, in the staining solution during 30 minutes at RT, then finally in the destaining solution 3 times during 30 minutes. The Wattman paper was dried, squares were cut and placed in eppendorf tubes in 1 ml of extraction solution.
Tubes were vortexed twice at 5 minutes intervals. 300 µl of each tube were taken and
used to measure the optical density at 620 nm. The optical densities of the standards were
plotted on a graphic in function of their respective concentration and the concentration of the proteins of our samples was deduced.
II.1.2 Western blotting
10 µg of proteins dissolved in Laëmmli 1× buffer were loaded in a 4% poly-acrylamide stacking gel in parallel with 5 µl of ladder (Precision Plus Protein
TMDual Color Standards, Bio-Rad, Hercules, CA). A 25 mA current was applied during 1 hour. First, samples migrated in the stacking gel to concentrate them. Then, they entered in the 6,5%
separating gel, enabling the separation of proteins according to their size. Proteins were transferred on a nitrocellulose membrane by application of a current with a constant voltage (100 V) during 1h30.
The blocking of the nitrocellulose membrane was realized with incubation in TBST 1×
containing 5% of milk powder during 1h at RT. Incubation with the primary antibody was then performed at 4°C overnight. The membrane was washed 3 times in TBST 1×
during 10 minutes before incubation with the secondary antibody during 45 minutes.
After 3 washes in TBST 1× during 10 minutes, an ECL solution (Enhanced Chemiluminescence, Perkin Elmer, Waltham, MA) was applied on the membrane during one minute. The membrane was afterwards exposed to a film (hyperfilm, Amersham, Buckinghamshire, UK) during an adequate time to obtain an interpretable signal (1 to 20 minutes).
II.1.3 Silver Nitrate staining
This staining was done after the transfer of proteins on a nitrocellulose membrane.
Consequently, only a few proteins remained on the separating gel but this was sufficient to visualize them.
All the incubations were done under agitation. After transfer of the main proteins on the
nitrocellulose membrane, the separating gel was incubated overnight and a second time
during 30 minutes with 200 ml of the fixator 1 solution. This solution was then replaced
by 200 ml of the fixator 2 solution during 30 minutes. Two washes were realized during
15 minutes before immersing the separating gel in 200 ml of the oxidant solution during 12 minutes. The staining was then performed in the presence of 200 ml of the Silver nitrate solution during 18 minutes. After a fast wash with water (30 seconds), 200 ml of the developing solution were used to detect the proteins. When the proteins clearly appeared, the stopping solution (200 ml) was added for 5 minutes. The gel was finally dried and stored.
II.2 Cell lines manipulations
II.2.1 Trypsinisation
Cells were trypsinized when reaching 80-90% confluence. Dishes were washed with 5 ml of BME medium and incubated during 5 minutes at 37°C with 5 ml of trypsine-EDTA 0,25%. The solution was transferred in a Falcon tube with a medium containing 5% of serum to neutralize the trypsine. The tube was centrifuged 5 minutes at 1200 rpm and the pellet of cells was resuspended in culture medium. The cells were counted with a hemocytometer before seeding.
II.2.2 Bromodeoxyuridine staining and indirect immunofluorescence
Bromodeoxyuridine (BrdU) is an analog of thymidine which substitutes for thymidine during DNA replication. BrdU can then be detected by immunofluorescence to calculate the number of cells entered in the S phase of the cell cycle.
10 µl of BrdU (Sigma, St Louis, MO) and 5 µl of fluorodeoxyuridine (FdU) (Sigma, St Louis, MO) were added to 6 cm
2dishes containing PCCL3 cells (final concentrations: 10
-4
M for BrdU and 2×10
-6M for FdU). FdU inhibits the endogene thymidine synthesis.
Note that the washes described below were done at room temperature (RT) during 5
minutes with PBS 1×/ BSA 0,05%. The antibodies, the sheep serum, the streptavidin and
the propidium iodide were diluted in PBS 1×/ BSA 0,05%.
After an incubation of 24h with BrdU and FdU, the medium was removed and cells were fixed by adding 2 ml of methanol during 10 minutes at -20°C. The next incubations were done at RT under agitation. In order to enable the entrance of molecules required for the staining (antibodies, streptavidine coupled with a fluorophore), cells were incubated with 2 ml of triton 0,1% / PBS 1× during 10 minutes. The nuclear proteins were destroyed by incubation with 2 ml of HCl 2N during 10 minutes. HCl was then neutralized with 2 ml of borax (0,1 M Na
2B
4O
7.10H
2O pH 8,5) and cells were washed 3 times. 120 µl of sheep serum (dilution 1:20; Dako, Glostrup, Denmark) were deposited on the cells during 30 minutes. Cells were then incubated during 2h with a mouse antibody directed against BrdU (dilution 1:25; Becton Dickinson, Franklin lakes, NJ). Then, they were successively incubated with a biotinylated anti-mouse immunoglobulin antibody (dilution 1:200;
Amersham, Buckinghamshire, UK) during 1h, washed 3 times during 10 minutes, incubated with fluorescein-conjugated streptavidin (dilution 1:50; Amersham, Buckinghamshire, UK) during 1h and washed again 3 times. Finally, cells were incubated 5 minutes in the dark with propidium iodide (dilution 1:100) to color the nuclei before being washed with water and dried in the dark overnight. A fluorescence microscope was used to calculate the proportion of cells having incorporated BrdU.
II.3 Microarray analyses
II.3.1 Experiments on Agilent cDNA Microarray slides
RNA purification, amplification, cDNA synthesis and labeling were performed as
described in the supplementary information of the paper described in §III of the results
chapter. All the tumor/non-tumor tissue pairs (n=26) were hybridized according to the
manufacturer’s protocol on Human 1 cDNA microarray (Agilent Technologies, Palo Alto,
CA) containing 12000 cDNAs, covering 8000 genes. The microarrays were scanned with
a Genepix 4000B scanner. All the details of microarray data pre-processing,
normalization and detection of differentially expressed genes are described in the
supplementary information of the paper described in §III of the results chapter.
SLC16A7 AGTTCTTCTTGGCCCTCCTC CGCTTGCTGCTACCACAATA 101 bp
FABP5 ATGGCCAAGCCAGATTGTAT TGAACCAATGCACCATCTGT 176 bp
NELL2 AATTTGGATGGCGGATATGA AAGCCTTGGGTCACATTCAG 228 bp
ANXA1 TCAAGCCATGAAAGGTGTTG CACAAAGAGCCACCAGGATT 182 bp
EPHA4 CGCTGCACCAAATCAAGTAG AACGTTTTTCAACCCACCAG 99 bp
TRIM22 ACCAGATCTGAGTGGGATGC TGCAGGTGCGTACAGTTTTC 149 bp
MAP3K1 GGATGCACTCTTGCCATTTT TGGGCATGGTGATCTACAAA 130 bp
DAPK2 CCAAGAGGCTCTCAGACACC CGATGTCCTCCTCAGTGTCA 239 bp
ARMCX2 TGTCTTCCTTTTGGGCTCTG AAGGTTAAGGGATGCCTGCT 145 bp
SNX1 CAAGCCACACTGCAGAAGAA CGGACCACTGTTGAAATCCT 155 bp
NRAS CCAAGACCAGACAGGGTGTT GTCAGGACCAGGGTGTCAGT 201 bp
MCM10 CGTCAGTGAGCAGCATGAAT TCCCGTTCCCATTTGTAGAG 141 bp
MCM4 ACCCTCAGGACGAAGCCTAT CGAGGGTATGCAGAAACCAT 241 bp
CTSZ GGGAGAAGATGATGGCAGAA ATAGGTGCTGGTCACGATCC 245 bp
RXRG AGAGCGAGCTGAGAGTGAGG CCTCCAAGGTGAGGTCAGAG 239 bp
DUSP6 CCAAATCATGGGCTCACTTT TGCATTTGAGGTGACACTCC 110 bp
OCLN TGGCAAAGTGAATGACAAGC GCAGGTGCTCTTTTTGAAGG 165 bp
NRCAM CCAATTGGATTACCACCACCTATAA ATTGGAAAAATAAAGGTCCCCATT 111 bp
NEDD8 TGACCGGAAAGGAGATTGAGAT CCTCCACACGCTCCTTGATT 72 bp
TTC1 CGGAGAAGCTGTGAGGTTCTTTA TCCTCTGGAACCCCACAGTT 85 bp
Table 8. Nucleotide sequence of the primers used for RT-PCR
II.3.2 Experiments on Affymetrix slides
Because RNA from our samples were already amplified by the method described in §III of the results chapter, we had to adapt the protocol of Affymetrix to our samples. In deed, in the Affymetrix protocol with one cycle of amplification, cRNA were labeled with biotin, which was not the case in our protocol. Consequently, we used the Affymetrix protocol with two cycles of amplification and we started just after the first round of amplification, considering that both protocols generated non biotinylated-cRNA after the first round of amplification. So briefly, the cRNA generated by our protocol from all our tissues (9 ATCs, 20 PTCs, 20 adjacent tissues to PTCs) were purified according to the Affymetrix protocol. The first and second strands of cDNA were synthesized and purified.
Biotynilated cRNA was generated, purified, quantified and fragmented. The quality of the fragmented cRNA was assessed using the Agilent 2100 Bioanalyzer. 15 µg of cRNA were finally hybridized on Affymetrix slides (HGU133 plus 2.0) which were afterwards washed and analyzed according the manufacturer’s protocol. Affymetrix experiments were performed at the microarray facility of the Institut J.Bordet (headed by Dr.
C.Sotiriou).
II.4 Real-time RT-PCR experiments
RT-PCR experiments related to the correlation between the gene expression profile and the biological phenotype of PTCs are described in §IV of the results chapter. For the
“ATC” project (§VII of the results chapter), confirmation of the reliability of the
regulated gene list was performed on 9 ATCs, 20 PTCs and 20 adjacent tissues to PTCs
for 16 selected genes. The primers were designed with the Primer3 software
(http://frodo.wi.mit.edu/) and are listed in table 8. We used the facilities of the University
of Swansea (Wales, UK, collaboration with Dr. Gerry Thomas) to perform our qRT-PCR
experiments. 1 µg of cRNA was incubated with DNase I (Ambion, Foster city, CA) and
reverse-transcribed in a 100µl reaction volume with random primers and Superscript II
(Invitrogen, Paisley, UK). Approximately 20ng of reverse-transcribed RNA (based on the
RNA concentration evaluated after the DNase treatment) were used in duplicate as a
template for the PCR reaction. We used the kit of Roche (Basel, Switzerland) and followed the manufacturer’s instructions. PCRs were performed on a LightCycler® 2.0 System using the cycling profile recommended by the manufacturer. All PCR efficiencies, obtained with 4 serial dilutions points (ranging from 20ng to 200pg), were above 90%
and real-time RT-PCR experiments were performed in duplicate for each gene.
Chapter VI : Bibliography
Chapter VI. Bibliography
1. Bertrand, S., Brunet, F. G., Escriva, H., Parmentier, G., Laudet, V., and Robinson-Rechavi, M.
Evolutionary genomics of nuclear receptors: from twenty-five ancestral genes to derived endocrine systems. Mol.Biol.Evol., 21: 1923-1937, 2004.
2. Ullrich, A. and Schlessinger, J. Signal transduction by receptors with tyrosine kinase activity. Cell, 61: 203-212, 1990.
3. Kasuga, M., Zick, Y., Blithe, D. L., Crettaz, M., and Kahn, C. R. Insulin stimulates tyrosine phosphorylation of the insulin receptor in a cell-free system. Nature, 298: 667-669, 1982.
4. Heldin, C. H. and Ostman, A. Ligand-induced dimerization of growth factor receptors: variations on the theme. Cytokine Growth Factor Rev., 7: 3-10, 1996.
5. Pusztai, L., Lewis, C. E., Lorenzen, J., and McGee, J. O. Growth factors: regulation of normal and neoplastic growth. J.Pathol., 169: 191-201, 1993.
6. Hamm, H. E. The many faces of G protein signaling. J.Biol.Chem., 273: 669-672, 1998.
7. Singer, W. D., Brown, H. A., and Sternweis, P. C. Regulation of eukaryotic phosphatidylinositol- specific phospholipase C and phospholipase D. Annu.Rev.Biochem., 66: 475-509, 1997.
8. Exton, J. H. Regulation of phosphoinositide phospholipases by G-proteins. Adv.Exp.Med.Biol., 400A: 3-8, 1997.
9. Carpenter, G. and Ji, Q. Phospholipase C-gamma as a signal-transducing element. Exp.Cell Res., 253: 15-24, 1999.
10. Burgering, B. M. and Bos, J. L. Regulation of Ras-mediated signalling: more than one way to skin a cat. Trends Biochem.Sci., 20: 18-22, 1995.
11. Wymann, M. P. and Pirola, L. Structure and function of phosphoinositide 3-kinases.
Biochim.Biophys.Acta, 1436: 127-150, 1998.
12. Tasken, K. and Aandahl, E. M. Localized effects of cAMP mediated by distinct routes of protein kinase A. Physiol Rev., 84: 137-167, 2004.
13. Dremier, S., Coulonval, K., Perpete, S., Vandeput, F., Fortemaison, N., Van Keymeulen, A., Deleu, S., Ledent, C., Clement, S., Schurmans, S., Dumont, J. E., Lamy, F., Roger, P. P., and Maenhaut, C. The role of cyclic AMP and its effect on protein kinase A in the mitogenic action of thyrotropin on the thyroid cell. Ann.N.Y.Acad.Sci., 968: 106-121, 2002.
14. Dumont, J. E., Jauniaux, J. C., and Roger, P. P. The cyclic AMP-mediated stimulation of cell proliferation. Trends Biochem.Sci., 14: 67-71, 1989.
15. Roger, P. P., Reuse, S., Maenhaut, C., and Dumont, J. E. Multiple facets of the modulation of growth by cAMP. Vitam.Horm., 51: 59-191, 1995.
16. Conti, M. Phosphodiesterases and cyclic nucleotide signaling in endocrine cells. Mol.Endocrinol., 14: 1317-1327, 2000.
17. Sunahara, R. K., Dessauer, C. W., and Gilman, A. G. Complexity and diversity of mammalian
18. Cully, M., You, H., Levine, A. J., and Mak, T. W. Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat.Rev.Cancer, 6: 184-192, 2006.
19. Engelman, J. A., Luo, J., and Cantley, L. C. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat.Rev.Genet., 7: 606-619, 2006.
20. Kaupp, U. B. and Seifert, R. Cyclic nucleotide-gated ion channels. Physiol Rev., 82: 769-824, 2002.
21. Gold, G. H. and Pugh, E. N., Jr. Olfactory adaptation. The nose leads the eye. Nature, 385: 677, 679, 1997.
22. Quinn, P. G. Mechanisms of basal and kinase-inducible transcription activation by CREB.
Prog.Nucleic Acid Res.Mol.Biol., 72: 269-305, 2002.
23. Servillo, G., Della Fazia, M. A., and Sassone-Corsi, P. Coupling cAMP signaling to transcription in the liver: pivotal role of CREB and CREM. Exp.Cell Res., 275: 143-154, 2002.
24. Raman, M., Chen, W., and Cobb, M. H. Differential regulation and properties of MAPKs.
Oncogene, 26: 3100-3112, 2007.
25. Pearson, G., Robinson, F., Beers, G. T., Xu, B. E., Karandikar, M., Berman, K., and Cobb, M. H.
Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions.
Endocr.Rev., 22: 153-183, 2001.
26. Morrison, D. K. and Davis, R. J. Regulation of MAP kinase signaling modules by scaffold proteins in mammals. Annu.Rev.Cell Dev.Biol., 19: 91-118, 2003.
27. Davis, R. J. Signal transduction by the JNK group of MAP kinases. Cell, 103: 239-252, 2000.
28. Lau, L. F. and Nathans, D. Expression of a set of growth-related immediate early genes in BALB/c 3T3 cells: coordinate regulation with c-fos or c-myc. Proc.Natl.Acad.Sci.U.S.A, 84:
1182-1186, 1987.
29. Curran, T. and Morgan, J. I. Memories of fos. Bioessays, 7: 255-258, 1987.
30. Angel, P. and Karin, M. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim.Biophys.Acta, 1072: 129-157, 1991.
31. Gentz, R., Rauscher, F. J., III, Abate, C., and Curran, T. Parallel association of Fos and Jun leucine zippers juxtaposes DNA binding domains. Science, 243: 1695-1699, 1989.
32. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. Phorbol ester-inducible genes contain a common cis element recognized by a TPA- modulated trans-acting factor. Cell, 49: 729-739, 1987.
33. Wisdom, R. AP-1: one switch for many signals. Exp.Cell Res., 253: 180-185, 1999.
34. Vickers, E. R., Kasza, A., Kurnaz, I. A., Seifert, A., Zeef, L. A., O'donnell, A., Hayes, A., and Sharrocks, A. D. Ternary complex factor-serum response factor complex-regulated gene activity is required for cellular proliferation and inhibition of apoptotic cell death. Mol.Cell Biol., 24: 10340- 10351, 2004.
35. Treisman, R. Ternary complex factors: growth factor regulated transcriptional activators.
Curr.Opin.Genet.Dev., 4: 96-101, 1994.
36. Minden, A., Lin, A., Smeal, T., Derijard, B., Cobb, M., Davis, R., and Karin, M. c-Jun N-terminal phosphorylation correlates with activation of the JNK subgroup but not the ERK subgroup of mitogen-activated protein kinases. Mol.Cell Biol., 14: 6683-6688, 1994.
37. Hahn, W. C. and Weinberg, R. A. Rules for making human tumor cells. N.Engl.J.Med., 347:
1593-1603, 2002.
38. Hanahan, D. and Weinberg, R. A. The hallmarks of cancer. Cell, 100: 57-70, 2000.
39. Hynes, R. O. Metastatic potential: generic predisposition of the primary tumor or rare, metastatic variants-or both? Cell, 113: 821-823, 2003.
40. Felding-Habermann, B., O'Toole, T. E., Smith, J. W., Fransvea, E., Ruggeri, Z. M., Ginsberg, M.
H., Hughes, P. E., Pampori, N., Shattil, S. J., Saven, A., and Mueller, B. M. Integrin activation controls metastasis in human breast cancer. Proc.Natl.Acad.Sci.U.S.A, 98: 1853-1858, 2001.
41. Borsig, L., Wong, R., Hynes, R. O., Varki, N. M., and Varki, A. Synergistic effects of L- and P- selectin in facilitating tumor metastasis can involve non-mucin ligands and implicate leukocytes as enhancers of metastasis. Proc.Natl.Acad.Sci.U.S.A, 99: 2193-2198, 2002.
42. Hanahan, D. and Folkman, J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell, 86: 353-364, 1996.
43. Guo, W. and Giancotti, F. G. Integrin signalling during tumour progression. Nat.Rev.Mol.Cell Biol., 5: 816-826, 2004.
44. Larsen, M., Artym, V. V., Green, J. A., and Yamada, K. M. The matrix reorganized: extracellular matrix remodeling and integrin signaling. Curr.Opin.Cell Biol., 18: 463-471, 2006.
45. Skrzydlewska, E., Sulkowska, M., Koda, M., and Sulkowski, S. Proteolytic-antiproteolytic balance and its regulation in carcinogenesis. World J.Gastroenterol., 11: 1251-1266, 2005.
46. Friedl, P. and Wolf, K. Tumour-cell invasion and migration: diversity and escape mechanisms.
Nat.Rev.Cancer, 3: 362-374, 2003.
47. Thiery, J. P. Epithelial-mesenchymal transitions in tumour progression. Nat.Rev.Cancer, 2: 442- 454, 2002.
48. Burridge, K. and Chrzanowska-Wodnicka, M. Focal adhesions, contractility, and signaling.
Annu.Rev.Cell Dev.Biol., 12: 463-518, 1996.
49. Miranti, C. K. and Brugge, J. S. Sensing the environment: a historical perspective on integrin signal transduction. Nat.Cell Biol., 4: E83-E90, 2002.
50. Giancotti, F. G. and Tarone, G. Positional control of cell fate through joint integrin/receptor protein kinase signaling. Annu.Rev.Cell Dev.Biol., 19: 173-206, 2003.
51. van Nimwegen, M. J. and van de, W. B. Focal adhesion kinase: a potential target in cancer therapy.
Biochem.Pharmacol., 73: 597-609, 2007.
52. Dumont, J. E., Lamy, F., Roger, P., and Maenhaut, C. Physiological and pathological regulation of thyroid cell proliferation and differentiation by thyrotropin and other factors. Physiol Rev., 72:
667-697, 1992.
53. Wolfe, H. J., Voelkel, E. F., and Tashjian, A. H., Jr. Distribution of calcitonin-containing cells in the normal adult human thyroid gland: a correlation of morphology with peptide content.
J.Clin.Endocrinol.Metab, 38: 688-694, 1974.
54. Dumont, J. E., Willems, C., Van Sande, J., and Neve, P. Regulation of the release of thyroid hormones: role of cyclic AMP. Ann.N.Y.Acad.Sci., 185: 291-316, 1971.
55. Dumont, J. E. The action of thyrotropin on thyroid metabolism. Vitam.Horm., 29: 287-412, 1971.
56. Dai, G., Levy, O., and Carrasco, N. Cloning and characterization of the thyroid iodide transporter.
Nature, 379: 458-460, 1996.
57. Dohan, O., De, l., V, Paroder, V., Riedel, C., Artani, M., Reed, M., Ginter, C. S., and Carrasco, N.
The sodium/iodide Symporter (NIS): characterization, regulation, and medical significance.
Endocr.Rev., 24: 48-77, 2003.
58. Scott, D. A., Wang, R., Kreman, T. M., Sheffield, V. C., and Karniski, L. P. The Pendred syndrome gene encodes a chloride-iodide transport protein. Nat.Genet., 21: 440-443, 1999.
59. Royaux, I. E., Suzuki, K., Mori, A., Katoh, R., Everett, L. A., Kohn, L. D., and Green, E. D.
Pendrin, the protein encoded by the Pendred syndrome gene (PDS), is an apical porter of iodide in the thyroid and is regulated by thyroglobulin in FRTL-5 cells. Endocrinology, 141: 839-845, 2000.
60. Rodriguez, A. M., Perron, B., Lacroix, L., Caillou, B., Leblanc, G., Schlumberger, M., Bidart, J.
M., and Pourcher, T. Identification and characterization of a putative human iodide transporter located at the apical membrane of thyrocytes. J.Clin.Endocrinol.Metab, 87: 3500-3503, 2002.
61. De Deken, X., Wang, D., Many, M. C., Costagliola, S., Libert, F., Vassart, G., Dumont, J. E., and Miot, F. Cloning of two human thyroid cDNAs encoding new members of the NADPH oxidase family. J.Biol.Chem., 275: 23227-23233, 2000.
62. Dupuy, C., Ohayon, R., Valent, A., Noel-Hudson, M. S., Deme, D., and Virion, A. Purification of a novel flavoprotein involved in the thyroid NADPH oxidase. Cloning of the porcine and human cdnas. J.Biol.Chem., 274: 37265-37269, 1999.
63. Damante, G. and Di Lauro, R. Thyroid-specific gene expression. Biochim.Biophys.Acta, 1218:
255-266, 1994.
64. Damante, G., Tell, G., and Di Lauro, R. A unique combination of transcription factors controls differentiation of thyroid cells. Prog.Nucleic Acid Res.Mol.Biol., 66: 307-356, 2001.
65. Roger, P., Taton, M., Van Sande, J., and Dumont, J. E. Mitogenic effects of thyrotropin and adenosine 3',5'-monophosphate in differentiated normal human thyroid cells in vitro.
J.Clin.Endocrinol.Metab, 66: 1158-1165, 1988.
66. Roger, P. P., Servais, P., and Dumont, J. E. Stimulation by thyrotropin and cyclic AMP of the proliferation of quiescent canine thyroid cells cultured in a defined medium containing insulin.
FEBS Lett., 157: 323-329, 1983.
67. Pohl, V., Roger, P. P., Christophe, D., Pattyn, G., Vassart, G., and Dumont, J. E. Differentiation expression during proliferative activity induced through different pathways: in situ hybridization study of thyroglobulin gene expression in thyroid epithelial cells. J.Cell Biol., 111: 663-672, 1990.
68. Roger, P. P. and Dumont, J. E. Factors controlling proliferation and differentiation of canine thyroid cells cultured in reduced serum conditions: effects of thyrotropin, cyclic AMP and growth factors. Mol.Cell Endocrinol., 36: 79-93, 1984.
69. Roger, P. P., Reuse, S., Servais, P., Van Heuverswyn, B., and Dumont, J. E. Stimulation of cell proliferation and inhibition of differentiation expression by tumor-promoting phorbol esters in dog thyroid cells in primary culture. Cancer Res., 46: 898-906, 1986.
70. Laurent, E., Mockel, J., Van Sande, J., Graff, I., and Dumont, J. E. Dual activation by thyrotropin of the phospholipase C and cyclic AMP cascades in human thyroid. Mol.Cell Endocrinol., 52:
273-278, 1987.
71. Van Sande, J., Raspe, E., Perret, J., Lejeune, C., Maenhaut, C., Vassart, G., and Dumont, J. E.
Thyrotropin activates both the cyclic AMP and the PIP2 cascades in CHO cells expressing the human cDNA of TSH receptor. Mol.Cell Endocrinol., 74: R1-R6, 1990.
72. Mazzaferri, E. L. Management of a solitary thyroid nodule. N.Engl.J.Med., 328: 553-559, 1993.
73. Delange, F. Iodine prophylaxis following nuclear accidents. Concern for the neonate? Cell Mol.Biol.(Noisy.-le-grand), 47: 417-418, 2001.
74. Gimm, O. Thyroid cancer. Cancer Lett., 163: 143-156, 2001.
75. Corvilain, B. The natural history of thyroid autonomy and hot nodules. Ann.Endocrinol.(Paris), 64:
17-22, 2003.
76. Wattel, S., Mircescu, H., Venet, D., Burniat, A., Franc, B., Frank, S., Andry, G., Van Sande, J., Rocmans, P., Dumont, J. E., Detours, V., and Maenhaut, C. Gene expression in thyroid autonomous adenomas provides insight into their physiopathology. Oncogene, 24: 6902-6916, 2005.
77. Hundahl, S. A., Cady, B., Cunningham, M. P., Mazzaferri, E., McKee, R. F., Rosai, J., Shah, J. P., Fremgen, A. M., Stewart, A. K., and Holzer, S. Initial results from a prospective cohort study of 5583 cases of thyroid carcinoma treated in the united states during 1996. U.S. and German Thyroid Cancer Study Group. An American College of Surgeons Commission on Cancer Patient Care Evaluation study. Cancer, 89: 202-217, 2000.
78. Liska, J., Altanerova, V., Galbavy, S., Stvrtina, S., and Brtko, J. Thyroid tumors: histological classification and genetic factors involved in the development of thyroid cancer. Endocr.Regul., 39:
73-83, 2005.
79. Franc, B., de la, S. P., Lange, F., Hoang, C., Louvel, A., de Roquancourt, A., Vilde, F., Hejblum, G., Chevret, S., and Chastang, C. Interobserver and intraobserver reproducibility in the
histopathology of follicular thyroid carcinoma. Hum.Pathol., 34: 1092-1100, 2003.
80. Lloyd, R. V., Erickson, L. A., Casey, M. B., Lam, K. Y., Lohse, C. M., Asa, S. L., Chan, J. K., DeLellis, R. A., Harach, H. R., Kakudo, K., LiVolsi, V. A., Rosai, J., Sebo, T. J., Sobrinho- Simoes, M., Wenig, B. M., and Lae, M. E. Observer variation in the diagnosis of follicular variant of papillary thyroid carcinoma. Am.J.Surg.Pathol., 28: 1336-1340, 2004.
81. Masson P. Human tumors. Histology, diagnosis , and technique. 2nd ed.Detroit: Wayne State Univ , 588-589. 1970.
82. Dean, D. S. and Hay, I. D. Prognostic indicators in differentiated thyroid carcinoma. Cancer Control, 7: 229-239, 2000.
83. Ravetto, C., Colombo, L., and Dottorini, M. E. Usefulness of fine-needle aspiration in the diagnosis of thyroid carcinoma: a retrospective study in 37,895 patients. Cancer, 90: 357-363, 2000.
84. Uchino, S., Noguchi, S., Yamashita, H., Yamashita, H., Watanabe, S., Ogawa, T., Tsuno, A., Murakami, A., and Miyauchi, A. Mutational analysis of the APC gene in cribriform-morula variant of papillary thyroid carcinoma. World J.Surg., 30: 775-779, 2006.
85. Moore, F. D., Jr. Inherited aspects of papillary thyroid carcinoma. J.Surg.Oncol., 94: 719-724, 2006.
86. Brierley, J. D., Panzarella, T., Tsang, R. W., Gospodarowicz, M. K., and O'Sullivan, B. A comparison of different staging systems predictability of patient outcome. Thyroid carcinoma as an example. Cancer, 79: 2414-2423, 1997.
87. Hay, I. D., Grant, C. S., van Heerden, J. A., Goellner, J. R., Ebersold, J. R., and Bergstralh, E. J.
Papillary thyroid microcarcinoma: a study of 535 cases observed in a 50-year period. Surgery, 112:
1139-1146, 1992.
88. Franc, B. [Current anatomopathological aspects of differentiated thyroid cancers of follicular (vesicular) origin: value and necessity of a common language]. Ann.Chir, 49: 909-921, 1995.
89. Lang, W., Choritz, H., and Hundeshagen, H. Risk factors in follicular thyroid carcinomas. A retrospective follow-up study covering a 14-year period with emphasis on morphological findings.
Am.J.Surg.Pathol., 10: 246-255, 1986.
90. Lang, B. H. and Lo, C. Y. Surgical options in undifferentiated thyroid carcinoma. World J.Surg., 31: 969-977, 2007.
91. Green, L. D., Mack, L., and Pasieka, J. L. Anaplastic thyroid cancer and primary thyroid lymphoma: a review of these rare thyroid malignancies. J.Surg.Oncol., 94: 725-736, 2006.
92. Wang, H. M., Huang, Y. W., Huang, J. S., Wang, C. H., Kok, V. C., Hung, C. M., Chen, H. M., and Tzen, C. Y. Anaplastic Carcinoma of the Thyroid Arising More Often from Follicular Carcinoma than Papillary Carcinoma. Ann.Surg.Oncol., 2007.
93. Sherman, S. I. Thyroid carcinoma. Lancet, 361: 501-511, 2003.
94. Begum, S., Rosenbaum, E., Henrique, R., Cohen, Y., Sidransky, D., and Westra, W. H. BRAF mutations in anaplastic thyroid carcinoma: implications for tumor origin, diagnosis and treatment.
Mod.Pathol., 17: 1359-1363, 2004.
95. Nikiforova, M. N., Kimura, E. T., Gandhi, M., Biddinger, P. W., Knauf, J. A., Basolo, F., Zhu, Z., Giannini, R., Salvatore, G., Fusco, A., Santoro, M., Fagin, J. A., and Nikiforov, Y. E. BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J.Clin.Endocrinol.Metab, 88: 5399- 5404, 2003.
96. Nikiforov, Y. E. Genetic alterations involved in the transition from well-differentiated to poorly differentiated and anaplastic thyroid carcinomas. Endocr.Pathol., 15: 319-327, 2004.
97. Williams, D. and Baverstock, K. Chernobyl and the future: too soon for a final diagnosis. Nature, 440: 993-994, 2006.
98. Baverstock, K. and Williams, D. The chernobyl accident 20 years on: an assessment of the health consequences and the international response. Environ.Health Perspect., 114: 1312-1317, 2006.
99. Williams, E. D., Abrosimov, A., Bogdanova, T., Demidchik, E. P., Ito, M., LiVolsi, V., Lushnikov, E., Rosai, J., Sidorov, Y., Tronko, M. D., Tsyb, A. F., Vowler, S. L., and Thomas, G. A. Thyroid carcinoma after Chernobyl latent period, morphology and aggressiveness. Br.J.Cancer, 90: 2219- 2224, 2004.
100. Chico, G., V, Massart, C., Jin, L., Vanvooren, V., Caillet-Fauquet, P., Andry, G., Lothaire, P., Dequanter, D., Friedman, M., and Van Sande, J. Acrylamide, an in vivo thyroid carcinogenic agent, induces DNA damage in rat thyroid cell lines and primary cultures. Mol.Cell Endocrinol., 257-258: 6-14, 2006.
101. Chu, R., Lin, Y., Reddy, K. C., Pan, J., Rao, M. S., Reddy, J. K., and Yeldandi, A. V.
Transformation of epithelial cells stably transfected with H2O2-generating peroxisomal urate oxidase. Cancer Res., 56: 4846-4852, 1996.
102. Lee, M. L., Chen, G. G., Vlantis, A. C., Tse, G. M., Leung, B. C., and van Hasselt, C. A. Induction of thyroid papillary carcinoma cell proliferation by estrogen is associated with an altered
expression of Bcl-xL. Cancer J., 11: 113-121, 2005.
103. Fusco, A., Grieco, M., Santoro, M., Berlingieri, M. T., Pilotti, S., Pierotti, M. A., Della, P. G., and Vecchio, G. A new oncogene in human thyroid papillary carcinomas and their lymph-nodal metastases. Nature, 328: 170-172, 1987.
104. Grieco, M., Santoro, M., Berlingieri, M. T., Melillo, R. M., Donghi, R., Bongarzone, I., Pierotti, M. A., Della, P. G., Fusco, A., and Vecchio, G. PTC is a novel rearranged form of the ret proto- oncogene and is frequently detected in vivo in human thyroid papillary carcinomas. Cell, 60: 557- 563, 1990.
105. Alberti, L., Carniti, C., Miranda, C., Roccato, E., and Pierotti, M. A. RET and NTRK1 proto- oncogenes in human diseases. J.Cell Physiol, 195: 168-186, 2003.
106. Minoletti, F., Butti, M. G., Coronelli, S., Miozzo, M., Sozzi, G., Pilotti, S., Tunnacliffe, A., Pierotti, M. A., and Bongarzone, I. The two genes generating RET/PTC3 are localized in chromosomal band 10q11.2. Genes Chromosomes.Cancer, 11: 51-57, 1994.
107. Santoro, M., Dathan, N. A., Berlingieri, M. T., Bongarzone, I., Paulin, C., Grieco, M., Pierotti, M.
A., Vecchio, G., and Fusco, A. Molecular characterization of RET/PTC3; a novel rearranged version of the RETproto-oncogene in a human thyroid papillary carcinoma. Oncogene, 9: 509-516, 1994.
108. Ciampi, R., Giordano, T. J., Wikenheiser-Brokamp, K., Koenig, R. J., and Nikiforov, Y. E.
HOOK3-RET: a novel type of RET/PTC rearrangement in papillary thyroid carcinoma.
Endocr.Relat Cancer, 14: 445-452, 2007.
109. Gandhi, M., Medvedovic, M., Stringer, J. R., and Nikiforov, Y. E. Interphase chromosome folding determines spatial proximity of genes participating in carcinogenic RET/PTC rearrangements.
Oncogene, 25: 2360-2366, 2006.
110. Nikiforova, M. N., Stringer, J. R., Blough, R., Medvedovic, M., Fagin, J. A., and Nikiforov, Y. E.
Proximity of chromosomal loci that participate in radiation-induced rearrangements in human cells.
Science, 290: 138-141, 2000.
111. Powell, D. J., Jr., Russell, J., Nibu, K., Li, G., Rhee, E., Liao, M., Goldstein, M., Keane, W. M., Santoro, M., Fusco, A., and Rothstein, J. L. The RET/PTC3 oncogene: metastatic solid-type papillary carcinomas in murine thyroids. Cancer Res., 58: 5523-5528, 1998.
112. Santoro, M., Chiappetta, G., Cerrato, A., Salvatore, D., Zhang, L., Manzo, G., Picone, A., Portella, G., Santelli, G., Vecchio, G., and Fusco, A. Development of thyroid papillary carcinomas
secondary to tissue-specific expression of the RET/PTC1 oncogene in transgenic mice. Oncogene, 12: 1821-1826, 1996.
113. Jhiang, S. M., Sagartz, J. E., Tong, Q., Parker-Thornburg, J., Capen, C. C., Cho, J. Y., Xing, S., and Ledent, C. Targeted expression of the ret/PTC1 oncogene induces papillary thyroid carcinomas. Endocrinology, 137: 375-378, 1996.
114. Melillo, R. M., Castellone, M. D., Guarino, V., De, F., V, Cirafici, A. M., Salvatore, G., Caiazzo, F., Basolo, F., Giannini, R., Kruhoffer, M., Orntoft, T., Fusco, A., and Santoro, M. The RET/PTC- RAS-BRAF linear signaling cascade mediates the motile and mitogenic phenotype of thyroid cancer cells. J.Clin.Invest, 115: 1068-1081, 2005.
115. Viglietto, G., Chiappetta, G., Martinez-Tello, F. J., Fukunaga, F. H., Tallini, G., Rigopoulou, D., Visconti, R., Mastro, A., Santoro, M., and Fusco, A. RET/PTC oncogene activation is an early event in thyroid carcinogenesis. Oncogene, 11: 1207-1210, 1995.
116. Kondo, T., Ezzat, S., and Asa, S. L. Pathogenetic mechanisms in thyroid follicular-cell neoplasia.
Nat.Rev.Cancer, 6: 292-306, 2006.
117. Zhu, Z., Ciampi, R., Nikiforova, M. N., Gandhi, M., and Nikiforov, Y. E. Prevalence of RET/PTC rearrangements in thyroid papillary carcinomas: effects of the detection methods and genetic heterogeneity. J.Clin.Endocrinol.Metab, 91: 3603-3610, 2006.
118. Rhoden, K. J., Unger, K., Salvatore, G., Yilmaz, Y., Vovk, V., Chiappetta, G., Qumsiyeh, M. B., Rothstein, J. L., Fusco, A., Santoro, M., Zitzelsberger, H., and Tallini, G. RET/papillary thyroid cancer rearrangement in nonneoplastic thyrocytes: follicular cells of Hashimoto's thyroiditis share low-level recombination events with a subset of papillary carcinoma. J.Clin.Endocrinol.Metab, 91:
2414-2423, 2006.
119. Unger, K., Zitzelsberger, H., Salvatore, G., Santoro, M., Bogdanova, T., Braselmann, H., Kastner, P., Zurnadzhy, L., Tronko, N., Hutzler, P., and Thomas, G. Heterogeneity in the distribution of RET/PTC rearrangements within individual post-Chernobyl papillary thyroid carcinomas.
J.Clin.Endocrinol.Metab, 89: 4272-4279, 2004.
120. Bongarzone, I., Fugazzola, L., Vigneri, P., Mariani, L., Mondellini, P., Pacini, F., Basolo, F., Pinchera, A., Pilotti, S., and Pierotti, M. A. Age-related activation of the tyrosine kinase receptor protooncogenes RET and NTRK1 in papillary thyroid carcinoma. J.Clin.Endocrinol.Metab, 81:
2006-2009, 1996.
121. Nikiforov, Y. E., Rowland, J. M., Bove, K. E., Monforte-Munoz, H., and Fagin, J. A. Distinct pattern of ret oncogene rearrangements in morphological variants of radiation-induced and sporadic thyroid papillary carcinomas in children. Cancer Res., 57: 1690-1694, 1997.
122. Ciampi, R. and Nikiforov, Y. E. RET/PTC rearrangements and BRAF mutations in thyroid tumorigenesis. Endocrinology, 148: 936-941, 2007.
123. Ciampi, R., Knauf, J. A., Kerler, R., Gandhi, M., Zhu, Z., Nikiforova, M. N., Rabes, H. M., Fagin, J. A., and Nikiforov, Y. E. Oncogenic AKAP9-BRAF fusion is a novel mechanism of MAPK pathway activation in thyroid cancer. J.Clin.Invest, 115: 94-101, 2005.
124. Castro, P., Rebocho, A. P., Soares, R. J., Magalhaes, J., Roque, L., Trovisco, V., Vieira, d. C., I, Cardoso-de-Oliveira, M., Fonseca, E., Soares, P., and Sobrinho-Simoes, M. PAX8-PPARgamma rearrangement is frequently detected in the follicular variant of papillary thyroid carcinoma.
J.Clin.Endocrinol.Metab, 91: 213-220, 2006.
125. Marques, A. R., Espadinha, C., Catarino, A. L., Moniz, S., Pereira, T., Sobrinho, L. G., and Leite, V. Expression of PAX8-PPAR gamma 1 rearrangements in both follicular thyroid carcinomas and adenomas. J.Clin.Endocrinol.Metab, 87: 3947-3952, 2002.
126. Davies, H., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M. J., Bottomley, W., Davis, N., Dicks, E., Ewing, R., Floyd, Y., Gray, K., Hall, S., Hawes, R., Hughes, J., Kosmidou, V., Menzies, A., Mould, C., Parker, A., Stevens, C., Watt, S., Hooper, S., Wilson, R., Jayatilake, H., Gusterson, B. A., Cooper, C., Shipley, J., Hargrave, D., Pritchard-Jones, K., Maitland, N., Chenevix-Trench, G., Riggins, G. J., Bigner, D. D., Palmieri, G., Cossu, A., Flanagan, A., Nicholson, A., Ho, J. W., Leung, S. Y., Yuen, S. T., Weber, B. L., Seigler, H. F., Darrow, T. L., Paterson, H., Marais, R., Marshall, C. J., Wooster, R., Stratton, M.
R., and Futreal, P. A. Mutations of the BRAF gene in human cancer. Nature, 417: 949-954, 2002.
127. Trovisco, V., Vieira, d. C., I, Soares, P., Maximo, V., Silva, P., Magalhaes, J., Abrosimov, A., Guiu, X. M., and Sobrinho-Simoes, M. BRAF mutations are associated with some histological types of papillary thyroid carcinoma. J.Pathol., 202: 247-251, 2004.
128. Nikiforova, M. N., Ciampi, R., Salvatore, G., Santoro, M., Gandhi, M., Knauf, J. A., Thomas, G.
A., Jeremiah, S., Bogdanova, T. I., Tronko, M. D., Fagin, J. A., and Nikiforov, Y. E. Low prevalence of BRAF mutations in radiation-induced thyroid tumors in contrast to sporadic papillary carcinomas. Cancer Lett., 209: 1-6, 2004.
129. Lima, J., Trovisco, V., Soares, P., Maximo, V., Magalhaes, J., Salvatore, G., Santoro, M., Bogdanova, T., Tronko, M., Abrosimov, A., Jeremiah, S., Thomas, G., Williams, D., and
Sobrinho-Simoes, M. BRAF mutations are not a major event in post-Chernobyl childhood thyroid carcinomas. J.Clin.Endocrinol.Metab, 89: 4267-4271, 2004.
130. Powell, N., Jeremiah, S., Morishita, M., Dudley, E., Bethel, J., Bogdanova, T., Tronko, M., and Thomas, G. Frequency of BRAF T1796A mutation in papillary thyroid carcinoma relates to age of patient at diagnosis and not to radiation exposure. J.Pathol., 205: 558-564, 2005.
131. Namba, H., Nakashima, M., Hayashi, T., Hayashida, N., Maeda, S., Rogounovitch, T. I., Ohtsuru, A., Saenko, V. A., Kanematsu, T., and Yamashita, S. Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. J.Clin.Endocrinol.Metab, 88: 4393-4397, 2003.
132. Di Cristofaro, J., Marcy, M., Vasko, V., Sebag, F., Fakhry, N., Wynford-Thomas, D., and De Micco, C. Molecular genetic study comparing follicular variant versus classic papillary thyroid carcinomas: association of N-ras mutation in codon 61 with follicular variant. Hum.Pathol., 37:
824-830, 2006.
133. Vogelstein, B., Lane, D., and Levine, A. J. Surfing the p53 network. Nature, 408: 307-310, 2000.
134. Gomez-Lazaro, M., Fernandez-Gomez, F. J., and Jordan, J. p53: twenty five years understanding the mechanism of genome protection. J.Physiol Biochem., 60: 287-307, 2004.
135. La Perle, K. M., Jhiang, S. M., and Capen, C. C. Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas. Am.J.Pathol., 157: 671-677, 2000.
136. Polakis, P. The many ways of Wnt in cancer. Curr.Opin.Genet.Dev., 17: 45-51, 2007.
137. Knauf, J. A., Ma, X., Smith, E. P., Zhang, L., Mitsutake, N., Liao, X. H., Refetoff, S., Nikiforov, Y. E., and Fagin, J. A. Targeted expression of BRAFV600E in thyroid cells of transgenic mice results in papillary thyroid cancers that undergo dedifferentiation. Cancer Res., 65: 4238-4245, 2005.
138. Mitsutake, N., Miyagishi, M., Mitsutake, S., Akeno, N., Mesa, C., Jr., Knauf, J. A., Zhang, L., Taira, K., and Fagin, J. A. BRAF mediates RET/PTC-induced mitogen-activated protein kinase activation in thyroid cells: functional support for requirement of the RET/PTC-RAS-BRAF pathway in papillary thyroid carcinogenesis. Endocrinology, 147: 1014-1019, 2006.
139. Mitsutake, N., Knauf, J. A., Mitsutake, S., Mesa, C., Jr., Zhang, L., and Fagin, J. A. Conditional BRAFV600E expression induces DNA synthesis, apoptosis, dedifferentiation, and chromosomal instability in thyroid PCCL3 cells. Cancer Res., 65: 2465-2473, 2005.
140. Samuels, Y. and Ericson, K. Oncogenic PI3K and its role in cancer. Curr.Opin.Oncol., 18: 77-82, 2006.
141. Fresno Vara, J. A., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C., and Gonzalez-Baron, M.
PI3K/Akt signalling pathway and cancer. Cancer Treat.Rev., 30: 193-204, 2004.
142. Ringel, M. D., Hayre, N., Saito, J., Saunier, B., Schuppert, F., Burch, H., Bernet, V., Burman, K.
D., Kohn, L. D., and Saji, M. Overexpression and overactivation of Akt in thyroid carcinoma.
Cancer Res., 61: 6105-6111, 2001.
143. Garcia-Rostan, G., Costa, A. M., Pereira-Castro, I., Salvatore, G., Hernandez, R., Hermsem, M. J., Herrero, A., Fusco, A., Cameselle-Teijeiro, J., and Santoro, M. Mutation of the PIK3CA gene in anaplastic thyroid cancer. Cancer Res., 65: 10199-10207, 2005.
144. Hou, P., Liu, D., Shan, Y., Hu, S., Studeman, K., Condouris, S., Wang, Y., Trink, A., El Naggar, A. K., Tallini, G., Vasko, V., and Xing, M. Genetic alterations and their relationship in the phosphatidylinositol 3-kinase/Akt pathway in thyroid cancer. Clin.Cancer Res., 13: 1161-1170, 2007.
145. Shinohara, M., Chung, Y. J., Saji, M., and Ringel, M. D. AKT in thyroid tumorigenesis and progression. Endocrinology, 148: 942-947, 2007.
146. Trevino, V., Falciani, F., and Barrera-Saldana, H. A. DNA microarrays: a powerful genomic tool for biomedical and clinical research. Mol.Med., 2007.
147. Perou, C. M., Sorlie, T., Eisen, M. B., van de, R. M., Jeffrey, S. S., Rees, C. A., Pollack, J. R., Ross, D. T., Johnsen, H., Akslen, L. A., Fluge, O., Pergamenschikov, A., Williams, C., Zhu, S. X., Lonning, P. E., Borresen-Dale, A. L., Brown, P. O., and Botstein, D. Molecular portraits of human breast tumours. Nature, 406: 747-752, 2000.
148. Sotiriou, C., Neo, S. Y., McShane, L. M., Korn, E. L., Long, P. M., Jazaeri, A., Martiat, P., Fox, S.
B., Harris, A. L., and Liu, E. T. Breast cancer classification and prognosis based on gene
expression profiles from a population-based study. Proc.Natl.Acad.Sci.U.S.A, 100: 10393-10398, 2003.
149. Golub, T. R., Slonim, D. K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J. P., Coller, H., Loh, M. L., Downing, J. R., Caligiuri, M. A., Bloomfield, C. D., and Lander, E. S. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring.
Science, 286: 531-537, 1999.
150. Sotiriou, C., Wirapati, P., Loi, S., Harris, A., Fox, S., Smeds, J., Nordgren, H., Farmer, P., Praz, V., Haibe-Kains, B., Desmedt, C., Larsimont, D., Cardoso, F., Peterse, H., Nuyten, D., Buyse, M., Van de Vijver, M. J., Bergh, J., Piccart, M., and Delorenzi, M. Gene expression profiling in breast cancer: understanding the molecular basis of histologic grade to improve prognosis. J.Natl.Cancer Inst., 98: 262-272, 2006.
151. Ramaswamy, S., Ross, K. N., Lander, E. S., and Golub, T. R. A molecular signature of metastasis in primary solid tumors. Nat.Genet., 33: 49-54, 2003.
152. Carter, S. L., Eklund, A. C., Kohane, I. S., Harris, L. N., and Szallasi, Z. A signature of chromosomal instability inferred from gene expression profiles predicts clinical outcome in multiple human cancers. Nat.Genet., 38: 1043-1048, 2006.
153. Ross, D. T., Scherf, U., Eisen, M. B., Perou, C. M., Rees, C., Spellman, P., Iyer, V., Jeffrey, S. S., van de, R. M., Waltham, M., Pergamenschikov, A., Lee, J. C., Lashkari, D., Shalon, D., Myers, T.
G., Weinstein, J. N., Botstein, D., and Brown, P. O. Systematic variation in gene expression patterns in human cancer cell lines. Nat.Genet., 24: 227-235, 2000.
154. Scherf, U., Ross, D. T., Waltham, M., Smith, L. H., Lee, J. K., Tanabe, L., Kohn, K. W., Reinhold, W. C., Myers, T. G., Andrews, D. T., Scudiero, D. A., Eisen, M. B., Sausville, E. A., Pommier, Y., Botstein, D., Brown, P. O., and Weinstein, J. N. A gene expression database for the molecular pharmacology of cancer. Nat.Genet., 24: 236-244, 2000.
155. Van de Vijver, M. J., He, Y. D., van't Veer, L. J., Dai, H., Hart, A. A., Voskuil, D. W., Schreiber, G. J., Peterse, J. L., Roberts, C., Marton, M. J., Parrish, M., Atsma, D., Witteveen, A., Glas, A., Delahaye, L., van, d., V, Bartelink, H., Rodenhuis, S., Rutgers, E. T., Friend, S. H., and Bernards, R. A gene-expression signature as a predictor of survival in breast cancer. N.Engl.J.Med., 347:
1999-2009, 2002.
156. Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. Cluster analysis and display of genome-wide expression patterns. Proc.Natl.Acad.Sci.U.S.A, 95: 14863-14868, 1998.
157. Tusher, V. G., Tibshirani, R., and Chu, G. Significance analysis of microarrays applied to the ionizing radiation response. Proc.Natl.Acad.Sci.U.S.A, 98: 5116-5121, 2001.
158. Radmacher, M. D., McShane, L. M., and Simon, R. A paradigm for class prediction using gene expression profiles. J.Comput.Biol., 9: 505-511, 2002.
159. Jemal, A., Siegel, R., Ward, E., Murray, T., Xu, J., and Thun, M. J. Cancer statistics, 2007. CA Cancer J.Clin., 57: 43-66, 2007.
160. Van Gelder, R. N., von Zastrow, M. E., Yool, A., Dement, W. C., Barchas, J. D., and Eberwine, J.
H. Amplified RNA synthesized from limited quantities of heterogeneous cDNA.
Proc.Natl.Acad.Sci.U.S.A, 87: 1663-1667, 1990.
161. Zhao, H., Hastie, T., Whitfield, M. L., Borresen-Dale, A. L., and Jeffrey, S. S. Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis.
BMC.Genomics, 3: 31, 2002.
162. Matz, M., Shagin, D., Bogdanova, E., Britanova, O., Lukyanov, S., Diatchenko, L., and Chenchik, A. Amplification of cDNA ends based on template-switching effect and step-out PCR. Nucleic Acids Res., 27: 1558-1560, 1999.
163. Hebrant, A., van Staveren, W. C., Delys, L., Solis, D. W., Bogdanova, T., Andry, G., Roger, P., Dumont, J. E., Libert, F., and Maenhaut, C. Long-term EGF/serum-treated human thyrocytes mimic papillary thyroid carcinomas with regard to gene expression. Exp.Cell Res., 2007.
164. van Staveren, W. C., Solis, D. W., Delys, L., Venet, D., Cappello, M., Andry, G., Dumont, J. E., Libert, F., Detours, V., and Maenhaut, C. Gene expression in human thyrocytes and autonomous adenomas reveals suppression of negative feedbacks in tumorigenesis. Proc.Natl.Acad.Sci.U.S.A, 103: 413-418, 2006.
165. van Staveren, W. C., Solis, D. W., Delys, L., Duprez, L., Andry, G., Franc, B., Thomas, G., Libert, F., Dumont, J. E., Detours, V., and Maenhaut, C. Human thyroid tumor cell lines derived from different tumor types present a common dedifferentiated phenotype. Cancer Res., 67: 8113-8120, 2007.
166. Dennis, G., Jr., Sherman, B. T., Hosack, D. A., Yang, J., Gao, W., Lane, H. C., and Lempicki, R.
A. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol., 4: 3, 2003.
167. Mazzieri, R. and Blasi, F. The urokinase receptor and the regulation of cell proliferation.
Thromb.Haemost., 93: 641-646, 2005.
168. Wang, Y. The role and regulation of urokinase-type plasminogen activator receptor gene expression in cancer invasion and metastasis. Med.Res.Rev., 21: 146-170, 2001.
169. Zhang, Z., Vuori, K., Wang, H., Reed, J. C., and Ruoslahti, E. Integrin activation by R-ras. Cell, 85: 61-69, 1996.
170. Krause, K., Schierhorn, A., Sinz, A., Wissmann, J. D., Beck-Sickinger, A. G., Paschke, R., and Fuhrer, D. Toward the application of proteomics to human thyroid tissue. Thyroid, 16: 1131-1143, 2006.
171. Kim, S. J., Park, J. W., Yoon, J. S., Mok, J. O., Kim, Y. J., Park, H. K., Kim, C. H., Byun, D. W., Lee, Y. J., Jin, S. Y., Suh, K. I., and Yoo, M. H. Increased expression of focal adhesion kinase in thyroid cancer: immunohistochemical study. J.Korean Med.Sci., 19: 710-715, 2004.
172. Owens, L. V., Xu, L., Dent, G. A., Yang, X., Sturge, G. C., Craven, R. J., and Cance, W. G. Focal adhesion kinase as a marker of invasive potential in differentiated human thyroid cancer.
Ann.Surg.Oncol., 3: 100-105, 1996.
173. Detours, V., Wattel, S., Venet, D., Hutsebaut, N., Bogdanova, T., Tronko, M. D., Dumont, J. E., Franc, B., Thomas, G., and Maenhaut, C. Absence of a specific radiation signature in post- Chernobyl thyroid cancers. Br.J.Cancer, 92: 1545-1552, 2005.
174. Frattini, M., Ferrario, C., Bressan, P., Balestra, D., De Cecco, L., Mondellini, P., Bongarzone, I., Collini, P., Gariboldi, M., Pilotti, S., Pierotti, M. A., and Greco, A. Alternative mutations of BRAF, RET and NTRK1 are associated with similar but distinct gene expression patterns in papillary thyroid cancer. Oncogene, 23: 7436-7440, 2004.
175. Giordano, T. J., Kuick, R., Thomas, D. G., Misek, D. E., Vinco, M., Sanders, D., Zhu, Z., Ciampi, R., Roh, M., Shedden, K., Gauger, P., Doherty, G., Thompson, N. W., Hanash, S., Koenig, R. J., and Nikiforov, Y. E. Molecular classification of papillary thyroid carcinoma: distinct BRAF, RAS,
and RET/PTC mutation-specific gene expression profiles discovered by DNA microarray analysis.
Oncogene, 24: 6646-6656, 2005.
176. Huang, Y., Prasad, M., Lemon, W. J., Hampel, H., Wright, F. A., Kornacker, K., LiVolsi, V., Frankel, W., Kloos, R. T., Eng, C., Pellegata, N. S., and de la, C. A. Gene expression in papillary thyroid carcinoma reveals highly consistent profiles. Proc.Natl.Acad.Sci.U.S.A, 98: 15044-15049, 2001.
177. Jarzab, B., Wiench, M., Fujarewicz, K., Simek, K., Jarzab, M., Oczko-Wojciechowska, M., Wloch, J., Czarniecka, A., Chmielik, E., Lange, D., Pawlaczek, A., Szpak, S., Gubala, E., and Swierniak, A. Gene expression profile of papillary thyroid cancer: sources of variability and diagnostic implications. Cancer Res., 65: 1587-1597, 2005.
178. Shin, E., Hong, S. W., Kim, S. H., and Yang, W. I. Expression of down stream molecules of RET (p-ERK, p-p38 MAPK, p-JNK and p-AKT) in papillary thyroid carcinomas. Yonsei Med.J., 45:
306-313, 2004.
179. Kennedy, N. J. and Davis, R. J. Role of JNK in tumor development. Cell Cycle, 2: 199-201, 2003.
180. Uhlirova, M., Jasper, H., and Bohmann, D. Non-cell-autonomous induction of tissue overgrowth by JNK/Ras cooperation in a Drosophila tumor model. Proc.Natl.Acad.Sci.U.S.A, 102: 13123- 13128, 2005.
181. Sakurai, T., Maeda, S., Chang, L., and Karin, M. Loss of hepatic NF-kappa B activity enhances chemical hepatocarcinogenesis through sustained c-Jun N-terminal kinase 1 activation.
Proc.Natl.Acad.Sci.U.S.A, 103: 10544-10551, 2006.
182. Gao, Y., Tao, J., Li, M. O., Zhang, D., Chi, H., Henegariu, O., Kaech, S. M., Davis, R. J., Flavell, R. A., and Yin, Z. JNK1 is essential for CD8+ T cell-mediated tumor immune surveillance.
J.Immunol., 175: 5783-5789, 2005.
183. Unger, J., Ketelbant, P., Erneux, C., Mockel, J., and Dumont, J. E. Mechanism of cholinergic inhibition of dog thyroid secretion in vitro. Endocrinology, 114: 1266-1271, 1984.