HAL Id: hal-00485536
https://hal.archives-ouvertes.fr/hal-00485536
Submitted on 21 May 2010
HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
An isogenic AasP mutant exhibits altered biofilm formation but retains virulence
Halina E. Tegetmeyer, Kerstin Fricke, Nina Baltes
To cite this version:
Halina E. Tegetmeyer, Kerstin Fricke, Nina Baltes. An isogenic AasP mutant exhibits altered biofilm formation but retains virulence. Veterinary Microbiology, Elsevier, 2009, 137 (3-4), pp.392.
�10.1016/j.vetmic.2009.01.026�. �hal-00485536�
Accepted Manuscript
Title: An isogenicActinobacillus pleuropneumoniaeAasP mutant exhibits altered biofilm formation but retains virulence Authors: Halina E. Tegetmeyer, Kerstin Fricke, Nina Baltes
PII: S0378-1135(09)00047-9
DOI: doi:10.1016/j.vetmic.2009.01.026
Reference: VETMIC 4341
To appear in: VETMIC Received date: 22-7-2008 Revised date: 13-1-2009 Accepted date: 19-1-2009
Please cite this article as: Tegetmeyer, H.E., Fricke, K., Baltes, N., An isogenic Actinobacillus pleuropneumoniaeAasP mutant exhibits altered biofilm formation but retains virulence,Veterinary Microbiology(2008), doi:10.1016/j.vetmic.2009.01.026 This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Accepted Manuscript
An isogenic Actinobacillus pleuropneumoniaeAasP mutant exhibits altered biofilm formation 1
but retains virulence 2
3
HALINA E. TEGETMEYER, KERSTIN FRICKE, AND NINA BALTES*
4
Department of Infectious Diseases, Institute for Microbiology, University of Veterinary 5
Medicine Hannover, 30173 Hannover, Germany 6
7 8 9
running title: A. pleuropneumoniaeAasP mutant 10
11 12
Address for correspondence: Nina Baltes 13
Institut fuer Mikrobiologie 14
Zentrum für Infektionsmedizin 15
Tieraerztliche Hochschule Hannover 16
Bischofsholer Damm 15 17
D-30173 Hannover 18
Germany 19
Phone: +49 511-856-7595 20
Fax: +49 511-856- 82 7595 21
E-mail: nina.baltes@tiho-hannover.de 22
23 24
Manuscript
Accepted Manuscript
ABSTRACT 1
AasP, an autotransporter serine protease of A. pleuropneumoniae, has been shown to be 2
expressed in necrotic porcine lung tissue. Based on the hypothesis that AasP might play an 3
important role in A. pleuropneumoniaeadhesion and virulence by processing other surface- 4
associated proteins, the predicted catalytic site of AasP was deleted and the isogenic mutant, 5
AP76ΔaasP, was compared to the wild type strain in a biofilm assay as well as an aerosol 6
infection model. AP76ΔaasPshowed increased adherence compared to the wild type strain 7
under standard culturing conditions as well as under NAD restriction. No significant 8
differences between AP76 wild type and AP76ΔaasPwere observed upon experimental 9
infection of pigs, indicating that AasP does not play a crucial role in A. pleuropneumoniae 10
virulence.
11 12
Keywords:Actinobacillus pleuropneumoniae, AasP, adherence, autotransporter 13
Accepted Manuscript
INTRODUCTION 1
Actinobacillus (A.) pleuropneumoniaeis the causative agent of porcine pleuropneumonia, an 2
economically important disease of fattening pigs. The ability to persistently colonize pigs 3
after infection and even after vaccination with bacterins is a major obstacle for eradication of 4
the organism (Fenwick and Henry, 1994, Haesebrouck et al., 1997, Chiers et al., 1998). We 5
recently identified an autotransporter serine protease, AasP (GenBank accession no.
6
DQ490067), which appears to remain associated with the membrane and is present in 7
membrane fractions in large amounts (Baltes et al., 2007). Its function is largely unknown to 8
date, but one possible role might be the processing of other autotransporter proteins, namely 9
adhesins, similar to SphB1 in Bordetella pertussis(Coutte et al., 2001). AasP has recently 10
been found to be involved in the processing of OmlA (Ali et al., 2008). While autotransporter 11
adhesins have not been characterized in A. pleuropneumoniae to date, two have been 12
identified, one of which is interrupted by the insertion of an IS element (Baltes and Gerlach, 13
2004, Tegetmeyer et al., 2008).A. pleuropneumoniae has been shown to form biofilms, and 14
genes responsible for matrix polysaccharide production have been identified (Kaplan et al., 15
2004, Kaplan and Mulks, 2005). However, the role of biofilms in A. pleuropneumoniae 16
infection has not been extensively studied in the pig. A regulatory mutant lacking regulator 17
protein arcAwas shown to be impaired in biofilm formation and virulence (Buettner et al., 18
2007). In the present study, we investigate the influence of AasP on A. pleuropneumoniae 19
adherence in vitro, and on virulence.
20 21
MATERIALS AND METHODS 22
Bacterial strains, plasmids, and primers.
23
The strains, plasmids, and primers used in this work are listed in Table 1.
24
Media and growth conditions.
25
Accepted Manuscript
Escherichia colistrains were cultured in LB-medium supplemented with ampicillin (100 1
g/ml). A. pleuropneumoniaestrains were routinely cultured in PPLO medium (Difco GmbH, 2
Augsburg, Germany) supplemented with nicotinamide dinucleotide (NAD; 10 µg/ml; Merck, 3
Darmstadt, Germany), L-glutamine (100 µg/ml; Serva, Heidelberg, Germany), L-cysteine- 4
hydrochloride (260 µg/ml; Sigma-Aldrich), L-cystine-dihydrochloride (10 µg/ml; Sigma- 5
Aldrich), Dextrose (1 mg/ml), and Tween®80 (0.1%).
6
Manipulation of DNA.
7
DNA-modifying enzymes were purchased from New England Biolabs (Bad Schwalbach, 8
Germany) and used according to the manufacturer’s instructions. Taqpolymerase was 9
purchased from Gibco-BR Life Technologies (Karlsruhe, Germany). Chromosomal DNA for 10
PCR and Southern Blotting as well as plasmid DNA was prepared by standard protocols 11
(Sambrook et al., 1989). PCR, Southern Blotting, transformation and gel electrophoresis were 12
done by standard procedures (Sambrook et al., 1989).
13
Sequence analyses.
14
Nucleotide sequencing was performed by SeqLab GmbH, Göttingen, Germany. Promoter 15
prediction was performed using the Virtual Footprint promoter analysis tool (Munch et al., 16
2005) available at http://prodoric.tu-bs.de/vfp/).
17
Construction of transconjugation plasmid pSER705 18
Primer pairs oSER101-Psp/oSER106-Bsm and oSER102-Not/oSER105-Bsm were used to 19
generate PCR products which were ligated together after digestion with BsmBI. The ligation 20
product was amplified using primer pair oSER101-Psp/ oSER102-Not, which was then 21
digested with PspOMI and NotI and ligated into pEMOC2 to generate transconjugation 22
plasmid pSER705.
23
Adherence assay.
24
Adhesion of A. pleuropneumoniaeto abiotic surfaces under different conditions was tested in 25
an adherence assay that has been described for Listeria monocytogenes(Djordjevic et al., 26
Accepted Manuscript
2002). Overnight cultures of AP76 and AP76ΔaasPwere diluted 1:100 with fresh PPLO 1
media containing additives for the respective conditions (standard: 10 µg/ml NAD; reduced 2
NAD: 0.1 µg/ml; iron restriction: 0.1 mM dipyridyl and 10 µg/ml NAD). Sterile 96 well flat 3
bottom tissue culture plates (Sarstedt, Germany) were seeded with 4 x 200 µl of bacterial 4
suspension or the respective supplemented media per growth condition, and incubated at 5
37°C, 5% CO2for a total of six or 24 hours. Optical density (OD) was measured in a 6
microtiter plate reader (GENios Pro, Tecan GmbH, Crailsheim, Germany) at 630 nm. After 7
incubation, the medium was removed and nonadherent bacteria were removed by rinsing the 8
wells with distilled water three times. After drying, biofilms were stained with 80 µl of 1 % 9
crystal violet solution per well for 30 minutes, followed by four washing steps with distilled 10
water. After at least 30 minutes of air drying, crystal violet was dissolved by adding 150 µl 11
destaining solution (50% ethanol, 30 % glacial acetic acid, 20% acetone) and OD was 12
measured at 550 nm after 15 minutes of incubation. Average OD values from control wells 13
were subtracted from average OD values from respective inoculated wells both for bacterial 14
culture (630 nm) and crystal violet (550 nm) ODs. For quantitative comparison of adherence, 15
OD values of crystal violet readings were divided by culture OD values to correct for 16
different growth OD values between the two A. pleuropneumoniae strains. Four wells were 17
set up for each strain and each growth condition, and the experiment was repeated three times.
18
Animal experiments.
19
Animal experiments were carried out using an aerosol infection model previously described 20
(Baltes et al., 2001). 16 A. pleuropneumoniaeseronegative male landrace pigs of 7-8 weeks of 21
age were randomly divided into two groups. The challenge dose was prepared from cultures 22
at an OD600of 0.49 (AP76wt) and 0.48 (AP76ΔaasP). 13 ml of an 1:30000 dilution of these 23
cultures were aerosolized per four pigs. Body temperatures were monitored daily. Pigs were 24
cared for in accordance with the principles outlined in the European Convention for the 25
Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes 26
Accepted Manuscript
(European Treaty Series, no. 123: http://conventions.coe.int/treaty/EN/Menuprincipal.htm), 1
and the experiments were approved by an ethics committee. Lung lesion scores were 2
evaluated according to Hannan et al. (Hannan et al., 1982).
3 4
RESULTS AND DISCUSSION 5
In order to determine whether the function of AasP was crucial for A. pleuropneumoniae 6
adherence and virulence, we constructed an isogenic mutant lacking the predicted catalytic 7
site (Gly349to Gly359). Using E. coli strain ß2155 (Dehio and Meyer, 1997), plasmid pSER705 8
was used to introduce the deletion in the aasPgene using the single-step transconjugation 9
system described earlier (Oswald et al., 1999). The mutant, AP76ΔaasP, lacks 123 bp 10
spanning the putative catalytic site of AasP as confirmed by PCR, sequence analysis and 11
Southern blot (data not shown). AP76ΔaasPdoes not differ from the wild type strain 12
macroscopically or microscopically, and growth of AP76ΔaasPin liquid PPLO medium 13
supplemented with 10 µg/ml NAD, incubated with shaking, was unaffected compared to the 14
parent strain.
15
In the in vitro adherence assay, both AP76wtand AP76ΔaasPshowed increased adhesion 16
during iron and NAD restricted growth compared to standard culturing conditions (Fig. 1A).
17
While increased adherence of A. pleuropneumoniaehas previously been described for NAD 18
restricted growth conditions (van Overbeke et al., 2002), this has not been demonstrated for 19
iron restricted conditions. AP76ΔaasPshowed a higher degree of adherence than the wild 20
type both under standard and NAD restricted conditions, these results were statistically 21
significant in the Wilcoxon signed-rank test (p < 0.05). Under iron restricted conditions, 22
AP76ΔaasPshowed less adherence than the wild type strain. This effect was statistically 23
significant only after 24 hours, not after 6 hours. Interestingly, growth of AP76ΔaasPin this 24
stationary culture was significantly impaired in comparison to the wild type under standard 25
and NAD restricted conditions (Fig. 1B). Under iron restricted conditions, the wild type strain 26
Accepted Manuscript
showed better growth than AP76ΔaasPafter 6 hours, but reached a lower OD than 1
AP76ΔaasPafter 24 hours. However, this effect was not statistically significant. In summary, 2
AP76ΔaasP appears to grow slower, but adhere more efficiently than AP76wtunder standard 3
and NAD restricted conditions. Under iron restricted conditions, the impact of the deletion on 4
growth is not statistically significant, but the mutant is slightly impaired in adhesion after 24 5
hours. Our results imply that AasP function does not seem to play a fundamental role in A.
6
pleuropneumoniaeadhesion to abiotic surfaces. The only factor crucial for A.
7
pleuropneumoniaeadhesion that has been identified so far is LPS (Rioux et al., 1997, Paradis 8
et al., 1999). Our findings also show that AasP is unlikely to have adhesin properties itself, 9
because the mutant still shows increased adhesion under conditions that have previously 10
shown to increase adhesion, and more importantly, the mutant adheres better than the wild 11
type strain under standard and NAD restricted conditions. Rather than AasP being an adhesin, 12
it is more likely that AasP processes other proteins, possibly adhesins, like it has been shown 13
for autotransporter serine protease SphB1 of Bordetella pertussis(Coutte et al., 2003).
14
However, OmlA, the only substrate of AasP identified so far (Ali et al., 2008), has no known 15
role in biofilm formation. A role for AasP in PGA polysaccharide (biofilm matrix) 16
biosynthesis or degradation can also not be excluded at this point.
17
Assuming a role of AasP in adhesin processing, the observed increased adherence upon 18
elimination of AasP function might be due to adhesive structures not being released from the 19
bacterial surface, preventing detachment of bacteria. Fine tuning of mucosal colonization by 20
adhesin release has been shown to be an important function of SphB1 of Bordetella pertussis 21
(Coutte et al., 2003).
22
Transcription of aasPhas previously been found to be upregulated under iron restriction 23
conditions (Deslandes et al., 2007).Upstream of the aasPstart codon, two putative binding 24
sites for global iron regulatorfurcan be found using the Virtual Footprint software; one is 25
centered at 239 bp upstream (GATTTTGAATGTCATTTCT), the other is closer to the start 26
Accepted Manuscript
codon, centered at 122 bp upstream (CATAAATTCTTTCACTCTC). These furboxes share 1
15/19 and 11/19 bp, respectively, with the furconsensus sequence of E. coli 2
(GATAATGATTTTCATTAAC, de Lorenzo et al., 1987)).
3
Under iron restricted conditions, AP76ΔaasPadheres less effectively than AP76wtafter 24 4
hours. These contrasting effects of the AasP deletion under standard conditions and NAD 5
restriction versus iron restriction might indicate that AasP mediated protein cleavage is 6
dependent on growth conditions, or that AasP has more than one substrate, and the 7
substrate(s), rather than AasP itself, are dependent on growth conditions.
8
We assessed the pathogenic potential of A. pleuropneumoniae AP76ΔaasP in an aerosol 9
infection experiment. One animal in the AP76ΔaasPgroup had to be excluded from the trial 10
prior to infection due to severe lameness. Following infection, one animal in the AP76ΔaasP 11
group died on day 2. This animal was excluded from statistical analyses because lung lesion 12
scores in such cases are extraordinarily high and therefore difficult to compare to those of 13
animals who die after day 4. A second animal from the AP76ΔaasPwas euthanized on day 5 14
post infection. No significant difference was found between both groups concerning lung 15
lesion scores (Fig. 2) or reisolation rates (Table 2), indicating that AP76ΔaasP is fully 16
virulent. The effects of the aasPdeletion that we saw in adhesion assays are either masked or 17
compensated in vivo by the action of of other virulence associated factors, most importantly 18
the ApxIII toxin (the ApxIV toxin ORF is interrupted in AP76 by insertion element ISApl1in 19
AP76, Tegetmeyer et al., 2008).
20
In summary, loss of AasP function appears to have an effect on A. pleuropneumoniae 21
adhesion to abiotic surfaces, but not on virulence. Our findings imply that AasP does not 22
play a crucial role in A. pleuropneumoniae pathogenicity, but may still be involved in "fine 23
tuning" of adhesion.
24 25
ACKNOWLEDGMENTS 26
Accepted Manuscript
This work was supported by the Dorothea Erxleben Program from the Deutsche 1
Forschungsgemeinschaft (DFG), Bonn, Germany, and DFG project BA 3421/2-1.
2
Accepted Manuscript
FIGURE LEGENDS 1
2
FIG. 1: Adherence experiments of A. pleuropneumoniae AP76 wt and AP76ΔaasP.
3
Representative experiment, each bar represents data from four wells. A: adherence assay in 4
microtiter plate, adhesion measured after 6 and 24 hours B: growth in microtiter plates prior 5
to processing for adherence assay. Asterisks denote statistical significance (p < 0.05 in the 6
Wilcoxon signed-rank test).
7 8
FIG. 2: Lung lesion scores of pigs infected with A. pleuropneumoniae AP76wt (♦) or 9
AP76ΔaasP(■)as a scatter plot diagram. 1) Animal died on day 2 post infection and was 10
excluded fron statistical analysis.
11
Accepted Manuscript
REFERENCES
Ali, T., Oldfield, N. J., Wooldridge, K. G., Turner, D. P., and Ala'Aldeen, D. A., 2008.
Functional characterization of AasP, a maturation protease autotransporter protein of Actinobacillus pleuropneumoniae. Infect. Immun. 76, 5608-5614.
Baltes, N., Buettner, F. F., and Gerlach, G. F., 2007. Selective capture of transcribed sequences (SCOTS) ofActinobacillus pleuropneumoniaein the chronic stage of disease reveals an HlyX-regulated autotransporter protein. Vet. Microbiol. 123, 110-121.
Baltes, N. and Gerlach, G. F., 2004. Identification of genes transcribed by Actinobacillus pleuropneumoniaein necrotic porcine lung tissue by using selective capture of transcribed sequences. Infect. Immun. 72, 6711-6716.
Baltes, N., Tonpitak, W., Gerlach, G. F., Hennig-Pauka, I., Hoffmann-Moujahid, A., Ganter, M., and Rothkotter, H. J., 2001. Actinobacillus pleuropneumoniaeiron transport and urease activity: effects on bacterial virulence and host immune response. Infect. Immun. 69, 472- 478.
Buettner, F. F., Maas, A., and Gerlach, G. F., 2007. An Actinobacillus pleuropneumoniae arcAdeletion mutant is attenuated and deficient in biofilm formation. Vet. Microbiol.
Chiers, K., van Overbeke, I., De Laender, P., Ducatelle, R., Carel, S., and Haesebrouck, F., 1998. Effects of endobronchial challenge with Actinobacillus pleuropneumoniaeserotype 9 of pigs vaccinated with inactivated vaccines containing the Apx toxins. Vet. Q. 20, 65-69.
Coutte, L., Alonso, S., Reveneau, N., Willery, E., Quatannens, B., Locht, C., and Jacob- Dubuisson, F., 2003. Role of adhesin release for mucosal colonization by a bacterial pathogen. J. Exp. Med. 197, 735-742.
Accepted Manuscript
Coutte, L., Antoine, R., Drobecq, H., Locht, C., and Jacob-Dubuisson, F., 2001. Subtilisin- like autotransporter serves as maturation protease in a bacterial secretion pathway. EMBO J.
20, 5040-5048.
de Lorenzo, V., Wee, S., Herrero, M., and Neilands, J. B., 1987. Operator sequences of the aerobactin operon of plasmid ColV-K30 binding the ferric uptake regulation (fur) repressor. J.
Bacteriol. 169, 2624-2630.
Dehio, C. and Meyer, M., 1997. Maintenance of broad-host-range incompatibility group P and group Q plasmids and transposition of Tn5in Bartonella henselaefollowing conjugal plasmid transfer from Escherichia coli. J. Bacteriol. 179, 538-540.
Deslandes, V., Nash, J. H., Harel, J., Coulton, J. W., and Jacques, M., 2007. Transcriptional profiling ofActinobacillus pleuropneumoniaeunder iron-restricted conditions. BMC.
Genomics 8, 72.
Djordjevic, D., Wiedmann, M., and McLandsborough, L. A., 2002. Microtiter plate assay for assessment of Listeria monocytogenes biofilm formation. Appl. Environ. Microbiol. 68, 2950- 2958.
Fenwick, B. and Henry, S., 1994. Porcine pleuropneumonia. J. Am. Vet. Med. Assoc. 204, 1334-1340.
Haesebrouck, F., Chiers, K., van Overbeke, I., and Ducatelle, R., 1997. Actinobacillus pleuropneumoniae infections in pigs: the role of virulence factors in pathogenesis and protection. Vet. Microbiol. 58, 239-249.
Hannan, P. C., Bhogal, B. S., and Fish, J. P., 1982. Tylosin tartrate and tiamutilin effects on experimental piglet pneumonia induced with pneumonic pig lung homogenate containing mycoplasmas, bacteria and viruses. Res. Vet. Sci. 33, 76-88.
Accepted Manuscript
Kaplan, J. B. and Mulks, M. H., 2005. Biofilm formation is prevalent among field isolates of Actinobacillus pleuropneumoniae. Vet. Microbiol. 108, 89-94.
Kaplan, J. B., Velliyagounder, K., Ragunath, C., Rohde, H., Mack, D., Knobloch, J. K., and Ramasubbu, N., 2004. Genes involved in the synthesis and degradation of matrix
polysaccharide in Actinobacillus actinomycetemcomitansand Actinobacillus pleuropneumoniaebiofilms. J. Bacteriol. 186, 8213-8220.
Munch, R., Hiller, K., Grote, A., Scheer, M., Klein, J., Schobert, M., and Jahn, D., 2005.
Virtual Footprint and PRODORIC: an integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, 4187-4189.
Oswald, W., Tonpitak, W., Ohrt, G., and Gerlach, G., 1999. A single-step transconjugation system for the introduction of unmarked deletions into Actinobacillus pleuropneumoniae serotype 7 using a sucrose sensitivity marker. FEMS Microbiol. Lett. 179, 153-160.
Paradis, S. E., Dubreuil, J. D., Gottschalk, M., Archambault, M., and Jacques, M., 1999.
Inhibition of adherence of Actinobacillus pleuropneumoniae to porcine respiratory tract cells by monoclonal antibodies directed against LPS and partial characterization of the LPS receptors. Curr. Microbiol. 39, 313-0320.
Rioux, S., Begin, C., Dubreuil, J. D., and Jacques, M., 1997. Isolation and characterization of LPS mutants of Actinobacillus pleuropneumoniaeserotype 1. Curr. Microbiol. 35, 139-144.
Sambrook, J., Fritsch, E. F., and Maniatis, T., 1989. Molecular cloning: a laboratory manual.
2nd ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. , USA .
Tegetmeyer, H. E., Jones, S. C., Langford, P. R., and Baltes, N., 2008. ISApl1, a novel insertion element of Actinobacillus pleuropneumoniae, prevents ApxIV-based serological detection of serotype 7 strain AP76. Vet. Microbiol. 128, 342-353.
Accepted Manuscript
van Overbeke, I., Chiers, K., Charlier, G., Vandenberghe, I., Van Beeumen, J., Ducatelle, R., and Haesebrouck, F., 2002. Characterization of the in vitro adhesion of Actinobacillus pleuropneumoniae to swine alveolar epithelial cells. Vet. Microbiol. 88, 59-74.
Accepted Manuscript
Figure1
Accepted Manuscript
Figure 2
Accepted Manuscript
Table 1: Strains, plasmids and primers used in this study
Characteristics Source
Strains
AP76 A. pleuropneumoniae serotype 7 strain kindly provided by the Western College of Veterinary Medicine, Saskatoon, Canada
(Anderson et al., 1991) AP76aasP Unmarked aasPdeletion mutant of A. pleuropneumoniaeAP76 This work Plasmid
pSER750 Transconjugation vector pEMOC2 (Baltes et al., 2003) containing truncated aasPfragment, lacking the putative catalytic site
This work
Primers
oSER101-Psp oSER102-Not
5' GACGACGGGCCCAAAACCCGTCGAACAGAATG 3' 5' GTAAGTGCGGCCGCGCTCAAGCCAAACTGACGTT 3' primer pair containing PspOMI and NotI restriction sites, respectively, surrounding the putative catalytic site of aasP,
resulting in a 1750 bp amplification product in the wild type, and a 1627 bp product in the aasPmutant
This work
oSER105-Bsm 5' ACAAGTGGGCCCAAAACCTGTTGAACAGAATG 3' downstream primer containing BsmBI restriction site, binds upstream of putative catalytic site
This work
oSER106-Bsm 5' TGGACCCGTCTCAGTTGCATTAAGTATTGCTAGATTGC 3' upstream primer containing BsmBI restriction site, binds
downstream of putative catalytic site
This work
Table 1
Accepted Manuscript
Table 2: Challenge experiment of A. pleuropneumoniaeAP76 wild type (wt) and deletion mutant A. pleuropneumoniae AP76 aasPin an aerosol infection model
A. pleuropneumoniae strains
number of animals with lung lesions
arithmetic mean of lung lesion scores
number of animals and localization of reisolation of
A. pleuropneumoniae
post mortem (day 7 post infection) tonsil lymph
node heart lung
AP76 wt 3/8 3.21 5/8 3/8 0/8 4/8
AP76 aasP 3a)/7b) 7.56 5/7 3/7 0/7 3/7
a) one animal died on day 2 post infection, another one was euthanized on day 5 b) one animal was excluded from the trial before infection because of severe lameness
Table 2
