Article
Reference
Microbiological and physicochemical characterization of water and sediment of an urban river: N'Djili River, Kinshasa, Democratic
Republic of Congo
TSHIBANDA, Joseph B., et al.
Abstract
Microbial and toxic metals contamination of freshwater resources is still a major problem in many parts of the world. In this study, water and sediment samples (n=9) were subjected to the microbiological and some physicochemical analysis to assess the water quality of the N'Djili River (Kinshasa, Democratic Republic of Congo). Microbiological analysis was performed for faecal indicator bacteria (FIB) including Escherichia coli (E. coli) and Enterococcus (ENT). The FIB characterization was performed for general E. coli, Enterococcus faecalis (E. faecalis) and human-specific bacteroides by PCR, using specific primers. The physicochemical parameters including pH and electrical conductivity were measured in water samples, and grain size distribution, organic matter and total mercury (Hg) were measured in sediments samples. The results revealed high concentration of FIB, with the maximum values of 1.6x103 and 2.7x103 CFU 100 mL-1 for E. coli and ENT, respectively.
The FIB in sediment samples present higher concentration than in water, with maximum values of 9.4x105 and 1.2x105 for E. coli and ENT, respectively. The PCR assays [...]
TSHIBANDA, Joseph B., et al. Microbiological and physicochemical characterization of water and sediment of an urban river: N'Djili River, Kinshasa, Democratic Republic of Congo.
Sustainability of Water Quality and Ecology, 2014, vol. 3-4, p. 47-54
DOI : 10.1016/j.swaqe.2014.07.001
Available at:
http://archive-ouverte.unige.ch/unige:40249
Disclaimer: layout of this document may differ from the published version.
Accepted Manuscript
Microbiological and physicochemical characterization of water and sediment of an urban river: N’Djili River, Kinshasa, Democratic Republic of Congo Joseph B. Tshibanda, Naresh Devarajan, Niane Birane, Paola M. Mwanamoki, Emmanuel K. Atibu, Pius T. Mpiana, Kandasamy Prabakar, Josué Mubedi Ilunga, Walter Wildi, John Poté
PII: S2212-6139(14)00021-X
DOI: http://dx.doi.org/10.1016/j.swaqe.2014.07.001
Reference: SWAQE 11
To appear in:
Received Date: 14 March 2014 Revised Date: 10 June 2014 Accepted Date: 4 July 2014
Please cite this article as: J.B. Tshibanda, N. Devarajan, N. Birane, P.M. Mwanamoki, E.K. Atibu, P.T. Mpiana, K.
Prabakar, J. Mubedi Ilunga, W. Wildi, J. Poté, Microbiological and physicochemical characterization of water and sediment of an urban river: N’Djili River, Kinshasa, Democratic Republic of Congo, (2014), doi: http://dx.doi.org/
10.1016/j.swaqe.2014.07.001
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Microbiological and physicochemical characterization of water and
1
sediment of an urban river: N’Djili River, Kinshasa, Democratic
2
Republic of Congo
3 4
Joseph B. Tshibanda1, Naresh Devarajan2, 3, Niane Birane2, Paola M. Mwanamoki4, Emmanuel 5
K. Atibu1 , Pius T. Mpiana1, Kandasamy Prabakar3, Josué Mubedi Ilunga5, Walter Wildi2, John 6
Poté1,2,5∗
7
1University of Kinshasa (UNIKIN), Faculty of Science, Department of Chemistry, B.P. 190, Kinshasa 8
XI, Democratic Republic of Congo.
9
2Faculty of science, Forel Institute and Institute of Environmental Sciences, University of Geneva, CP 10
416, 1290 Versoix, Switzerland.
11
3Postgraduate and Research Department of Zoology, Jamal Mohamed College, Tiruchirappalli- 12
620020, Tamil Nadu, India 13
4Institut Supérieur des Techniques Médicales/Kinshasa, Section Nutrition diététique, B.P. 774 14
Kinshasa XI, Democratic Republic of Congo.
15
5Université Pédagogique Nationale (UPN). Croisement Route de Matadi et Avenue de la Libération.
16
Quartier Binza/UPN, B.P. 8815 Kinshasa, République Démocratique du Congo 17
18 19
∗Corresponding author. Tel. : +41-22-379-03-21; fax : + 41 22 379 03 29. John Poté is associate Professor for the collaboration between Forel Institute (University of Geneva) and two Universities of Kinshasa (UPN and UNIKIN).
E-mail address : [email protected] (John Poté)
Abstract 20
Microbial and toxic metals contamination of freshwater resources is still a major 21
problem in many parts of the world. In this study, water and sediment samples (n=9) were 22
subjected to the microbiological and some physicochemical analysis to assess the water 23
quality of the N’Djili River (Kinshasa, Democratic Republic of Congo). Microbiological 24
analysis was performed for faecal indicator bacteria (FIB) including Escherichia coli (E. coli) 25
and Enterococcus (ENT). The FIB characterization was performed for general E. coli, 26
Enterococcus faecalis (E. faecalis) and human-specific bacteroides by PCR, using specific 27
primers. The physicochemical parameters including pH and electrical conductivity were 28
measured in water samples, and grain size distribution, organic matter and total mercury (Hg) 29
were measured in sediments samples. The results revealed high concentration of FIB, with the 30
maximum values of 1.6x103 and 2.7x103 CFU 100 mL-1 for E. coli and ENT, respectively.
31
The FIB in sediment samples present higher concentration than in water, with maximum 32
values of 9.4x105 and 1.2x105 for E. coli and ENT, respectively. The PCR assays for human- 33
specific bacteroides HF183/HF134 indicated that more than 90% of bacteria were from 34
human origin. The Hg concentration in sediment samples reaches the values of 0.5 mg kg-1. 35
Thus, our results indicate that the uncontrolled landfills and mixing of untreated urban and 36
industrial effluents lead to the deterioration of the water quality of the rivers traversing the 37
economically important cities. This study represents useful tools incorporated to evaluate 38
water and sediment quality in river systems which can be applied to similar aquatic 39
environments.
40
Key words: Water pollution, sediments, faecal contamination, mercury, human health risk 41
42
1. Introduction 43
In many parts of the world, the discharge of untreated hospital and industrial effluents, 44
agricultural and urban activities, domestic wastewater and uncontrolled landfills constitute the 45
main contamination sources of aquatic environments. The deterioration of water quality, 46
especially in developing countries pose tremendous effects and human health risks (Kambole, 47
2003; Pritchard et al., 2008; Key et al., 2004; Mubedi et al., 2013; Atibu et al., 2013). The 48
urban river systems receive various types of contaminants including toxic metals, persistent 49
organic pollutants, pathogenic organisms and pharmaceutical drugs such as antibiotics, which 50
constitute major environmental and human health concerns. In the aquatic environment, 51
sediments may constitute a reservoir for these pollutants. It has been demonstrated that the 52
sediments can accumulate contaminants and pathogenic organisms at the concentration of 10- 53
1000 times higher than the overlying water (Davies et al., 1995; Poté et al., 2008; Haller et al., 54
2009a,b). Hence, the sediment represents an important compartment for the assessment of the 55
pollution in river-reservoir systems.
56
Several studies have demonstrated that sediments may constitute an important 57
reservoir of faecal indicator bacteria (FIB) in freshwater environments (LaLiberte and 58
Grimes, 1982; An et al., 2002; Haller et al., 2009a). Accumulation of FIB and pathogenic 59
organisms in sediments has been attributed to the sorption of the microorganisms to particles 60
suspended in water, whereas desorption of the microorganisms from sediment can occur 61
under changing physicochemical conditions (e.g., pH, oxygen availability, redox conditions).
62
Faecal pollution can originate from a variety of human and non-human sources, but FIB 63
contamination from human faecal material is generally considered to be a greater risk to 64
human health as it is more likely to contain human enteric pathogens (Scott et al., 2003;
65
WHO, 2004; Montgomery and Elimelech, 2007). Additionally, the use of wastewater 66
Saharan Africa, but little is understood in these developing nations about the potential risks 68
associated with its use (Ndiaye, 2009; Gemmell and Schmidt, 2012). These studies 69
demonstrated that pathogens contained in the wastewater used for irrigation can be transferred 70
to the raw vegetables and fresh produces.
71
The N'djili River is one of tributaries of Congo River that drain the capital city of 72
Kinshasa. Due to its position in the city, the river is used for many activities including water 73
supply, population bathing and irrigation for urban agriculture. The river receives different 74
urban wastes and is regarded as an uncontrolled landfill (Fig. 1). The river is also exposed to 75
other anthropogenic pollutions including industrial and urban untreated effluent waters 76
discharge as well as runoff from the watershed of the river. Due to this, the evaluation of the 77
water quality of the N’Djili River is essential to identify ecological and potential human risks 78
of the great part of the population living in the south of the city of Kinshasa. There is still a 79
paucity of information concerning the contamination of sediments by toxic metals and 80
pathogenic organisms, and there is little information to be found regarding the accumulation 81
of FIB in the sediments of the river and their dissemination in the water compartment. The 82
main objective of the present study is to quantify and characterize the FIB levels in water and 83
sediments of the N’Djili River, and to assess their spatial distribution.
84 85
2. Materials and methods 86
2.1. Study site and sampling procedure 87
The source of N'djili River is located in the province of Bas-Congo. The river flows 88
from the south and traverses six main municipalities of the capital city of Kinshasa. The 89
sampling took place in July 2013. From each sampling point water (n=9) and surface (0-6 cm) 90
sediment (n=9) samples were collected, labelled EE1-EE9 and ES1-ES9 for water and 91
sediment samples, respectively. The global positioning system (GPS) location of the sampling 92
sites of water and sediments sampled are presented in Table 1. The sampling areas were 93
chosen according to the anthropogenic activities and the eventual sources of river 94
contamination. These activities include the industrial effluent discharge (IED), the presence of 95
uncontrolled landfills (PUL) and urban agricultural and storm runoff (UAS) (Fig. 1). Water 96
samples (300 mL in sterile plastic bottles) were triplicated from 3 selected areas described 97
above; EE1-EE3 from IED, EE4-EE6 from PUL and EE7-EE9 from UAS. Surface sediments 98
samples (0-3 cm depth) were collected manually using plastic bottles at about 3 m from the 99
shore and at less than 1 m water depth. Approximately 250-300 g of sediments were taken 100
from each sites (in selected areas) in triplicate; ES1- ES3 from IED, ES4- ES6 from PUL and 101
ES7- ES9 from UAS.
102
After sampling, water and sediment samples were kept at 4ºC in the dark (Gerba and McLeod, 103
1976; Goldscheider et al. 2007; Poté et al., 2009a) and all analyses were performed within 48 104
h.
105 106
2.2. Water and sediment physicochemical analysis 107
Physicochemical parameters of water including temperature (°C), pH and electrical 108
conductivity (EC) were determined in the sampling sites using a Multi 350i (WTW, 109
Germany). The grain size distribution was measured using a particle size analyzer Coulter ® 110
LS-100 (Beckman Coulter, Fullerton, CA, USA), following ultrasonic dispersal in de-ionized 111
water. The proportions of three major size classes (clays < 2µ m; silts 2-63µm; and sand >
112
63µ m) were determined from size distributions, as well as the median grain size. Sediment 113
total organic matter content was estimated by loss on ignition for 1h in Salvis oven (Salvis 114
AG, Emmenbrücke, Luzern, Switzerland).
115 116
2.3. Faecal indicator bacteria (FIB) analysis in water and sediment 117
118
The FIB (including E. coli and ENT) were quantified in water samples and sediment 119
supernatant according to the international standard methods for water quality determination 120
using the membrane filtration method (APHA, 2005). The sediment supernatant was obtained 121
as described by Haller et al (2009a) and Poté et al (2009b). Briefly; the sediments were 122
resuspended by adding 100 g of fresh sediment to 500 mL of 0.2 % Na6(PO3)6 in 1 L sterile 123
plastic bottles and mixed for 30 min using the agitator rotary printing-press Watson-Marlow 124
601 controller (Skan, Switzerland). The mixture was then centrifuged at 4000 rpm (Sigma, 3- 125
16K) for 15 min at 15°C. For each sample, triplicates of serially diluted sediment supernatant 126
(100 mL) were used. Water samples and sediment supernatant were then passed through a 127
0.45 µm filter (47 mm diameter, Millipore, Bedford, USA), and placed on different selective 128
culture media (Biolife, Italiana) supplemented with the anti-fungal compound Nystatin (100 129
µg mL-1 final concentration), using the following incubation conditions: E. coli: Tryptone Soy 130
Agar (TSA) medium, incubated at 37°C for 4 h and transferred to Tryptone Bile X-Gluc Agar 131
(TBX) medium at 44°C for 24 h; ENT: Slanetz Bartley Agar (SBA) medium, incubated at 132
44°C for 48 h and transferred into Bile Aesculin Agar (BAA) medium at 44°C for 4 h.
133
The results were expressed as colony forming units per 100 mL of water (CFU 100mL-1) or 134
100 g of fresh sediments (CFU 100g-1). The reproducibility of the whole experimental 135
procedure was tested by means of triplicates on selected sediment samples. The sample 136
revealed a mean variation coefficient of 8% and 9% for E. coli and ENT respectively.
137 138
2.4. PCR assays for detection of general FIB, E. faecalis and human bacteroides 139
The genomic profiles of general origin of E. coli and ENT were performed by PCR 140
assays (presence/absence) using specific primers and operational conditions as summarized in 141
Table 2 (Ke et al., 1999; Bernhard and Field, 2000; Sabat et al., 2000; Hammerun and Jensen, 142
2002; Scott et al., 2005; Ahmed et al., 2007; Morrison et al., 2008; Thevenon et al., 2012). A 143
total of 236 isolated colonies from water and sediment samples for each FIB (E. coli and 144
ENT) were selected. PCR amplifications were performed directly on the colonies picked from 145
selective-media plates and resuspended in 20 µL of sterile water, for the general confirmation 146
of E. coli and ENT. The deoxyribonucleic nucleic acid (DNA) extracted from E. coli ATCC 147
25922 and E. faecalis ATCC 29212 were used as positive controls.
148
The PCR assays for human E. faecalis and for the human-specific bacteroides were 149
performed on the total DNA extracted from sediment samples and selected colonies which 150
were positive for general E.coli and ENT PCR. DNA was extracted from the sediment 151
samples and the isolated bacteria using Ultraclean soil DNA Kit (Mo Bio Labs, Solana Beach, 152
CA) according to the manufacturer’s recommendations. The concentration of extracted DNA 153
was measured spectrophotometrically (OD260) and DNA quality was assessed by 154
electrophoresis on 0.8% agarose gels stained with 1x SYBR Safe DNA gel stain (Invitrogen).
155
The purified DNA was kept at –20 °C until used. The human-specific bacteroides were 156
analyzed by PCR assays (presence/absence) using specific primers and operational conditions 157
according to published methods as summarized in Table 2 (Thevenon et al., 2012). The 158
experiment was conducted in triplicate in each set of conditions. The negative (without DNA) 159
and positive controls (e.g. the expected 520 bp length (for HF183/Bac708) from sewage (Poté 160
et al., 2009b)) were used in each PCR essays.
161 162
2.4. Mercury (Hg) analysis in sediment samples 163
For Hg analysis, the sediment samples were previously sieved with 63 µm mesh, air- 164
dried at ambient temperature and ground manually into a fine homogenized powder. The Hg 165
analysis was carried out using atomic absorption spectrophotometry for Hg determination 166
(Advanced Mercury Analyzer; AMA 254, Altec s.r.l., Czech Rep.) as described (Garcia- 167
Bravo et al., 2011). This method is based on sample combustion, gold amalgamation and 168
atomic absorption spectrometry.
169 170
2.5 Data analysis 171
For all analyses, triplicate measurements were performed on selected water and 172
sediment samples. Statistical treatment of data has been realized using SigmaStat 11.0 (Systat 173
Software, Inc., USA).
174 175
3. Results and discussion 176
177
3.1. Water and sediment physicochemical parameters 178
The physicochemical parameters of water and sediments are given in Table 1. The pH 179
of water ranged from 6.28-6.83. The water temperature ranged between 14.5-16.3°C. The 180
maximum value of water electrical conductivity was found in the site EE1 (578 µS cm-1). For 181
other sites, the values of electrical conductivity ranged from 166.5-253 µS cm-1. The 182
percentage of clay, silt and sand, significantly varies considerably with the sampling areas.
183
The sediments located in the IED area are mainly sandy sediment, with 94.4%, 86.6% and 184
98.6% of sand for ES1, ES2 and ES3 respectively. The values of clay and silts from this area 185
were very low ranging from 0-1.7% and 1.4-11.7% for clay and silt, respectively. The 186
sediments from the PUL are also sandy sediment with the values of 97.9%, 100% and 99% of 187
sand for ES4, ES5 and ES6, respectively. These sediments present 0% of clay and the values 188
of silt ranged from 0-2.1%. The sediments from the IED and PUL areas present the lowest 189
values of organic matter, and do not exceed 1.2%. However, the sediments sampled from the 190
area of urban agricultural and storm runoff (UAS) are composed majorly with silts, the values 191
ranged from 36.4-65.1%. Interestingly, the highest concentration of OM (13.5%) is recorded 192
in this area (site ES8), where the maximum of clay is also observed (7.6%). These results 193
reflecting the deposition of fine and muddy sediments with relative high proportion of clays 194
and silts in the river’s streams (Haller et al., 2009a; Poté et al., 2009b). The physicochemical 195
results from the UAS area suggest that the overuse of fertilizers for enriching agricultural 196
soils by nutrients (mainly phosphorus and nitrogen) and enhancing crop production could 197
have increased the organic matter concentration in the proximate rivers through surface runoff 198
and nutrient leaching (Wallbrink et al., 2003; Vadas et al., 2008).
199 200
3.2. The FIB quantification in water and sediment samples 201
The FIB quantification was performed both in water and sediments sampled from the 202
same GPS locations. The results are presented in Table 3. For the water samples, the FIB 203
levels significantly varied (P< 0.05) with sampling sites, ranging between 1.1x102-1.6x103 204
and 3.5 x102-2.7x103 CFU 100 mL-1 for E. coli and ENT, respectively. The same tendency 205
was observed for sediment samples, where FIB levels ranged between 1.4x103-9.4x105 and 206
1.1 x104-1.2x105 CFU 100 g-1 for E. coli and ENT, respectively. The samples from the area 207
subjected to the influence of urban agricultural and storm runoff (UAS) present highly FIB 208
levels in both water and sediment samples (Table 3). However, the values of E. coli and ENT 209
observed in water and sediment samples from IED and PUL areas give a clear indication of 210
contamination of the river with FIB.
211
The U.S. Environmental Protection Agency and the European Union recommend the 212
use of E. coli a subset of the faecal coliform group, and members of the genus Enterococcus, 213
the enterococci (ENT), to assess the hygienic safety of the surface and recreational waters 214
(USEPA, 2000; EU, 2006). The evaluation of faecal indicator bacteria in sediments may be a 215
more stable index of overall or long-term water quality than in the overlying water (Laliberte 216
and Grimes, 1982; Ferguson et al., 2005). Depending on sediment characteristics, coastal 217
sediments can act as a reservoir of FIB, and analysis of water quality may underestimate the 218
risk of exposure to potentially pathogenic microorganisms in recreational waters (Craig et al., 219
2002). Interestingly, the results of this study indicate that the concentrations of FIB are 220
significantly higher in sediments than in the water column, which is consistent with previous 221
studies (Crabill et al., 1999; Alm et al., 2003; Craig et al., 2004; Lee et al., 2006). According 222
to the European Directive 2006/7/CE concerning the management of bathing and drinking 223
water quality, N’Djili River can be considered extensively contaminated by faecal indicator 224
bacteria, rendering it unsuitable for irrigation, drinking, bathing, swimming and other 225
recreational activities.
226 227
3.3. Identification of general FIB, E. faecalisand human-specific bacteroides 228
Qualitative PCR assays was applied for large-scale screening of the colonies isolated 229
from sediment samples to detect presence/absence of general FIB (E. coli and ENT) as well as 230
human-specific E. faecalis and bacteroides (Table 4). General FIB detected in all tested 231
strains, whereas human-specific positive PCR (for E. faecalis and human-specific 232
bacteroides) was also observed in all DNA extracted from isolated colonies on membrane 233
filters. On the other hand, the PCR assays with primers ESP-1 /ESP-2 (Table 2) for E. faecalis 234
were not positive for some tested strains, indicating that some Enterococcus isolated strains 235
from the sediment of the river may have other origins such as animals or environmental 236
adapted strains.
237
The percentage of E. faecalis varied from 50% to more than 90% in sediment 238
sampling sites, indicating that the sediments can be considered as a reservoir of faecal 239
indicator bacteria (Haller et al., 2009a,b). The maximum value occurred in samples from 240
urban agricultural and storm runoff area (UAS) (at site ES8), with the values of 94% for E.
241
faecalis. This site presents the high value of sediment organic matter content (13.5%), 242
comparatively with the values observed in sediment samples from IED and PUL areas 243
(maximum value 1.19% at the site ES2). Interestingly, we detected FIB of human origin 244
(human-specific bacteroides) in all sampling site, indicating the bacteriological human 245
pollution of the river.
246
3.4. Mercury (Hg) concentration in sediment samples 247
In order to assess the eventual sediment contamination by metals in this unexplored 248
area, Hg was selected as it is regarded as being one of the most toxic metals (Garcia-Bravo et 249
al., 2011). The concentration of Hg in sediment samples are presented in Table 3. The Hg 250
levels in sediment samples are generally low, ranging from 0.01-0.5 mg kg-1. However, values 251
of 0.18, 0.24 and 0.5 were determined for sites ES8, ES7 and ES4 respectively. These values 252
are higher than tolerable limits as indicated by the Sediment Quality Guidelines (0.17 mg kg- 253
1), indicating the probable ecotoxicological effects (Long et al., 2006).
254
The Hg is one of toxic metals with a large number of physical and chemical forms, 255
which can cause different environmental and human effects. Thus, several studies on Hg in 256
waters, sediments, fish and human have been carried out (e.g. Wang et al., 2004; Poté et al., 257
2008; Berzas Nevado et al., 2010; Garcia-Bravo et al., 2011). These studies identified the 258
principal sources of Hg contamination in aquatic environment, including gold mining 259
activities, atmospheric deposition, erosion, urban discharge, agricultural material, combustion 260
and industrial discharge. For examples, in the amazon basin, the Hg contamination in 261
different environmental compartments including water, sediment and soil can be explained by 262
traditional gold mining from the mid 1980s (Berzas Nevado et al., 2010). In the sub-Saharan 263
Africa (such as Tanzania, Zimbabwe, Ghana and Senegal), few studies have been conducted 264
to assess the Hg contamination in the artisanal small-scale gold mining areas, as summarized 265
in our recent study (Niane et al., 2014). The Hg concentration in water and sediments from 266
these regions can reach values as high as 9.9 mg kg-1. In the river-reservoir systems (such as 267
the bay of Vidy, Lausanne Switzerland) receiving partially treated urban effluent waters, the 268
Hg levels in sediments can reach the value of 8.6 mg kg-1 (Poté et al., 2008; Garcia-Bravo et 269
al., 2011).
270
Few studies have been conducted to assess the water quality in DRC Rivers (Mubedi 271
et al., 2013, Atibu et al., 2014, Ngelikoto et al., 2014). The authors found that the 272
contamination of urban rivers can be explained by the mining activities, untreated industrial, 273
urban and hospital effluent waters discharge into the rivers. In the current study, the source of 274
Hg contamination in N’Djili River (maximum value of 0.5 mg kg-1) can be attributed to urban 275
runoff and uncontrolled landfill pollution. However, further studies that include more 276
sediment samples from the river are recommended to fully evaluate the other potential sources 277
of Hg contamination as well as the ecotoxicological effects.
278 279
4. Conclusion 280
This study provides the information regarding the spatial distribution and 281
accumulation of FIB in water and sediments, as well as the assessment of Hg in sediments 282
from N’Djili River, Kinshasa, DRC. The results of this study reveal the presence of high 283
levels of FIB (E. coli and ENT) in water and sediment samples from N’Djili River.
284
Interestingly, the detection and spatial characterization of E. faecalis and human-specific 285
bacteroides in several sediment samples indicate the presence of human pollution in the river.
286
To our knowledge, this is the first study characterizing the FIB in both water and sediment 287
samples from the N’Djili River. Their presence suggests that viable human pathogens are 288
present and may accumulate within the sediment; increasing the potential risk of human 289
infections either via direct (drinking, bathing) or indirect exposure (crop irrigation and 290
contamination). The mercury concentration of the sediment samples (0.5 mg kg-1) was 291
determined to be above the maximum tolerable limits according to the Sediment Quality 292
Guidelines.
293
The results of this study will help to better understand the microbiological and toxic 294
metals pollution of the river and will guide future municipality decisions on improving the 295
river quality.
296 297
Acknowledgements 298
We are grateful to financial sources the Swiss National Science Foundation (grant 299
n° 31003A_150163 / 1) and Forel Institute, University of Geneva. This research presents the 300
results of tripartite collaboration between University of Geneva (Forel Institute), University of 301
Kinshasa and Pedagogic National University of Congo (Democratic Republic of Congo), and 302
Jamal Mohamed College, (Affiliated to Bharathidasan University) Tiruchirappalli, Tamil 303
Nadu, India. Naresh Devarajan is a Ph.D., Scholar supported by a Swiss Government 304
Scholarships for Foreign Scholars.
305 306
References 307
Ahmed, W., Stewart, J., Gardner, T., Powell, D., Brooks, P., Sullivan, D., Tindale, N., 2007.
308
Sourcing faecal pollution: a combination of library-dependent and library-independent 309
methods to identify human faecal pollution in nonsewered catchments. Water Res. 41, 310
3771-3779.
311
Alm, E.W., Burke J., Spain, A., 2003. Fecal indicator bacteria are abundant in wet sand and 312
freshwater beaches. Wat. Res. 37, 3978-3982.
313
An, Y., Kampbell, D.H., Breidenbach, G.P., 2002. Escherichia coli and total coliforms in 314
water and sediments at lake marinas. Environ. Poll. 120, 771–778.
315
APHA (American Public Health Association), American Water Works Association & Water 316
Environment Federation, 2005. Standard methods for the examination of water and 317
wastewater, 21st ed., 1368 pp.
318
Atibu, E.K., Devarajan, N., Thevenon, F., Mwanamoki, P.M., et al. 2013. Concentration of 319
metals in surface water and sediment of Luilu and Musonoie Rivers, Kolwezi- 320
Katanga, Democratic Republic of Congo. Applied Geochemistry 39, 26–32 321
Bernhard, A.E., Field, K.G., 2000. A PCR assay to discriminate human and ruminant feces on 322
the basis of host differences in Bacteroides-Prevotella genes encoding 16S rRNA.
323
Applied and Environmental Microbiology. 66 (10), 4571-4574.
324
Berzas Nevado, J.J., Rodríguez Martín-Doimeadios, R.C., Guzmán Bernardo, F.J., Jiménez 325
Moreno, M., Herculano, A.M., do Nascimento, J.L.M., Crespo-López, M.E., 2010.
326
Mercury in the Tapajós River basin, Brazilian Amazon: A review. Environment 327
International, 36, 593-608.
328
Crabill, C., Donald, R., Snelling, J., Foust, R., Southam, G., 1999. The impact of sediment 329
fecal coliform reservoirs on seasonal water quality in Oak Creek, Arizona. Wat. Res.
330
33, 2163-2171.
331
Craig, D.L., Fallowfield, H.J., Cromar, N.J. 2004. Use of microcosms to determine 332
persistence of Escerichia coli in recreational coastal water and sediment and validation 333
with in situ measurements. J. App. Microbiol. 96, 922-930.
334
Craig, D.L., Fallowfield, H.J., Cromar, N.J., 2002. Enumeration of faecal coliforms from 335
recreational coastal sites: evaluation of techniques for the separation of bacteria from 336
sediments. J. App. Microbiol. 93, 557-565.
337
Davies, C.M., Long, J.A.H., Donald, M., Ashbolt, N., 1995. Survival of fecal microorganisms 338
in marine and freshwater sediments. Appl Environm Microbiol 61: 1888–1896.
339
EU, European Directive 2006/7/CE of the European Parliament and of the Council of 15 340
February 2006 concerning the management of bathing water quality and repealing 341
Directive 76/160/EEC.
342
Ferguson, D.M., Moore, D.F., Getrich, M.A., Zhowandai, M.H., 2005. Enumeration and 343
speciation of enterococci found in marine and intertidal sediments and coastal water in 344
southern California. J. App. Microbiol. 99, 598-608.
345
Garcia-Bravo, A., Bouchet, S., Amouroux, D., Poté, J. and Dominik, J. 2011. Distribution of 346
mercury and organic matter in particle-size classes in sediments contaminated by a 347
waste water treatment plant: Vidy Bay, Lake Geneva, Switzerland. Journal of 348
Environmental Monitoring 13: 974–982.
349
Gemmell, M.E., Schmidt, S., 2012. Microbiological assessment of river water used for the 350
irrigation of fresh produce in a sub-urban community in Sobantu, South Africa. Food 351
Research International 47, 300-305 352
Gerba, C., McLeod, J. S., 1976. Effect of sediment on the Survival of Escherichia coli in 353
marine water. Applied and Environmental Microbiology, 32: 114--120.
354
Goldscheider, N., Haller, L., Poté, J., Wildi, W., Zopfi, J., 2007. Characterizing water 355
circulation and contaminant transport in Lake Geneva using bacteriophage tracer 356
experiments and limnological methods. Environmental Science and Technology, 41:
357
5252-5258.
358
Haile, R.W., White, J.S., Gold, M., Cressey, R., McGee, C., Millikan, R.C., Glasser, A., 359
Harawa, N., Ervin, C., Harmon, P., Harper, J., Dermand, J., Alamillo, J., Barrett, K., 360
Nides, M., Wang, G.Y., 1999. The health effects of swimming in ocean water 361
contaminated by storm drain runoff. Epidemiology 10, 355–363.
362
Haller, L., Amedegnato, E., Poté , J., Wildi, W., 2009b. Influence of freshwater sediment 363
characteristics on persistence of fecal indicator bacteria. Water, Air, and Soil 364
Pollution. 203, 217-227.
365
Haller, L., Poté, J., Loizeau, J-L., Wildi, W., 2009a. Distribution and survival of faecal 366
indicator bacteria in the sediments of the Bay of Vidy, Lake Geneva, Switzerland.
367
Ecological Indicators 9: 540-547 368
Hammerun, A.M., Jensen, L.B., 2002. Prevalence of esp, encoding the enterococcal surface 369
protein, in Enterococcus faecalis and Enterococcus faecium isolates from hospital 370
patients, poultry, and pigs in Denmark. J Clin Microbiol p. 4396 371
Kambole, M.S., 2003. Managing the water quality of the Kafue River. Physics and Chemistry 372
of the Earth 28, 1105-1109 373
Key, R.M., De Waele, B., Liyungu, A.K., 2004. A multi-element baseline geochemical 374
database from the western extension of the Central Africa Copperbelt in northwestern 375
Zambia. Appl Earth Sc 113, 205-226.
376
LaLiberte, P., Grimes, D.J., 1982. Survival of Escherichia coli in lake bottom sediment. Appl.
377
Environ. Microbiol. 43, 623–628.
378
Lee, C.M., Lin, T.Y., Lin, C., Kohbodi, G.A., Bhatt, A., Lee, R., Jay, J.A., 2006. Persistence 379
of fecal indicator bacteria in Santa Monica Bay beach sediments. Wat. Res. 40, 2593- 380
2602.
381
Long, E.R., C.G. Ingersoll and D.D. MacDonald. 2006. Calculation and uses of mean 382
sediment quality guideline quotients: a critical review. Environmental Science 383
Technology 40: 1726-1736.
384
Montgomery, M. A., Elimelech, M., 2007. Water and sanitation in developing countries:
385
Including health in the equation. Environ. Sci. Technol. 41, 17–24.
386
Morrison, C., Bachoon, D., Gates, K., 2008. Quantification of enterococci and Bifidobacteria 387
in Georgia estuaries using conventional and molecular methods. Water Research. 42, 388
4001-4009.
389
Mubedi J, I., Devarajan, N., Le Faucheur, S., Kayembe, M.J., Atibu, E.K., Sivalingam, P., 390
Prabakar, K., Mpiana, P.T., Wildi, W., Poté, J., 2013. Effects of untreated hospital 391
effluents on the accumulation of toxic metals in sediments of receiving system under 392
tropical conditions: Case of South India and Democratic Republic of Congo.
393
Chemosphere 93, 1070–1076.
394
Ndiaye, M.L., 2009. Impacts sanitaires des eaux d’arrosage de l’agriculture urbaine de Dakar 395
(sénégal). Terre et environnement Vo. 86, pp. 144.
396
Ngelinkoto, P., Thevenon, F., Devarajan, N., Birane, N., Maliani, J., Buluku, A., Musibono, 397
D., Mubedia, I.J., Poté, J., 2014. Trace metal pollution in aquatic sediments and some 398
fish species from the Kwilu-Ngongo River, Democratic Republic of Congo (Bas- 399
Congo). In press. http://dx.doi.org/10.1080/02772248.2014.910211.
400
Niane, B., Moritz, R., Guédron, S., Malick N.P., Pfeifer, H.R., Mall, I., Poté, J., 2014. Effect 401
of recent artisanal small-scale gold mining on the contamination of surface river 402
sediment: Case of Gambia River, Kedougou region, southeastern Senegal. Journal of 403
Geochemical Exploration. In Press. http://dx.doi.org/10.1016/j.gexplo.2014.03.028.
404
Poté J., Haller, L., Kottelat R., Sastre, V., Arpagaus, P., Wildi W., 2009a. Persistence and 405
growth of faecal culturable bacterial indicators in water column and sediments of Vidy 406
Bay, Lake Geneva, Switzerland. J. Environ. Sc. 21, 62–69.
407
Poté, J., Goldscheider, N., Haller, L., Zopfi, J., Khajehnouri, F., Wildi, W., 2009b. Origin and 408
spatial-temporal distribution of fecal bacteria in a bay of Lake Geneva, Switzerland.
409
Environ. Monit. Assess. 154:337–348.
410
Poté, J., Haller, L., Loizeau, J-L., Garcia Bravo, A., Sastre, V., Wildi, W., 2008. Effects of a 411
sewage treatment plant outlet pipe extension on the distribution of contaminants in the 412
sediments of the Bay of Vidy, Lake Geneva, Switzerland. Bioresour Technol 9: 7122–
413
7131.
414
Pritchard, M., Mkandawire, T., O’Neill J.G., 2008. Assessment of groundwater quality in 415
shallow wells within the southern districts of Malawi. Physics and Chemistry of the 416
Earth 33 812–823 417
Sabat, G., Rose, P., Hickey, W.J., & Harkin, J.M. (2000). Selective and sensitive method for 418
PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl. Environ.
419
Microbiol. 66, 844–849.
420
Scott , TM., Jenkins, T.M., Lukasik, J., Rose, J.B., 2005. Potential use of a host associated 421
molecular Marker in Enterococcus faecium as an Index of human fecal pollution, Env.
422
Sci. Technol. 39, 283-287.
423
Scott, T.M., Parveen, S., Portier. K.M., Rose, J.B., Tamplin, M.L., Farrah, S.R., Koo, A., 424
Lukasik, J., 2003. Geographical variation in ribotype profiles of Escherichia coli 425
isolates from humans, swine, poultry, beef, and dairy cattle in Florida. App. Environ.
426
Microbiol. 69, 1089-1092.
427
Thevenon, F., Regier, N., Benagli, C., Tonolla, M., Adatte, T., Wildi, W., Poté, J. (2012).
428
Characterization of faecal indicator bacteria in sediments cores from the largest 429
freshwater lake of Western Europe (Lake Geneva, Switzerland). Ecotox. Environ.
430
Safety, 78: 50-56.
431
U.S. Environmental Protection Agency. 2000. Improved enumeration methods for the 432
recreational water quality indicators : enterococci and Escherichia coli EPA-821/R- 433
97/004. U.S. Environmental Protection Agency, Washington, D.C.
434
Vadas, P.A., Owens, L.B., Sharpley, A.N., 2008. An empirical model for dissolved 435
phosphorus in runoff from surface-applied fertilizers. Agriculture, Ecosystems and 436
Environment 127, 59–65.
437
Wallbrink, P.J., Martin, C.E., Wilson, C.J., 2003. Quantifying the contributions of sediment, 438
sediment-P and fertiliser-P from forested, cultivated and pasture areas at the landuse 439
and catchment scale using fallout radionuclides and geochemistry. Soil & Tillage 440
Research 69, 53–68.
441
Wang, Q., Kim, D., Dionysiou, D.D., Sorial, G.A., Timberlake, D., 2004. Sources and 442
remediation for mercury contamination in aquatic systems – a literature review.
443
Environmental pollution, 131, 323-336.
444
WHO (World Health Organisation), 2004. Guidelines for drinking-water quality, 445
recommendations (Vol. 1, 3rd ed., 515 pp). Geneva: World Health Organization.
446 447
Tables 448
449
Table 1. Sampling site (GPS location), water and sediment physicochemical characteristics 450
Sample* Latitude Longitude pH** Temp**
(°C)
EC**
(µS/c)
OM***
(%)
Clay***
(%)
Silt***
(%)
Sand***
(%) EE1/ES1 4°23ʹ17.03ʹʹ 15°21ʹ57.0ʹʹ 6.45 14.5 578.0 0.34 0.6 4.98 94.42 EE2/ES2 4°23ʹ16.6ʹʹ 15°21ʹ57.2ʹʹ 6.83 14.5 195.2 1.19 1.67 11.74 86.59 EE3/ES3 4°23ʹ16.8ʹʹ 15°21ʹ56.9ʹʹ 6.79 15.1 175.5 0.30 0 1.38 98.62 EE4/ES4 4°23ʹ7.55ʹʹ 15°21ʹ9.93ʹʹ 6.70 15.6 250.0 0.39 0 2.1 97.9 EE5/ES5 4°23ʹ7.53ʹʹ 15°21ʹ9.88ʹʹ 6.68 16.0 166.5 0.19 0 0 100 EE6/ES6 4°23ʹ7.51ʹʹ 15°21ʹ9.85ʹʹ 6.60 16.3 178.7 0.28 0 0.471 99.52 EE7/ES7 4°20ʹ59.9ʹʹ 15°21ʹ45.0ʹʹ 6.52 15.3 253.0 4.42 5.78 65.06 29.16 EE8/ES8 4°20ʹ59.7ʹʹ 15°21ʹ44.5ʹʹ 6.28 16.0 224.0 13.46 7.62 56.41 35.97 EE9/ES9 4°20ʹ59.4ʹʹ 15°21ʹ44.3ʹʹ 6.42 16.2 244.0 3.63 6.66 36.4 56.94
* EE: water samples, ES: sediment samples 451
** analysis performed in water 452
*** analysis performed in sediments 453
EC: electrical conductivity 454
OM: total organic matter 455
GPS: global positioning system 456
457 458
Table 2. Primers for human Enterococcus faecalis and human-specific bacteroides used in 459
this study*
460 461
Primers Target
Expected product size (bp)
Sequence (5’ to 3’) Annealing
Temp.(°C) Reference ECA75F
ECA619R General E Coli 544 GGAAGAAGCTTGCTTCTTTGCTGAC
AGCCCGGGGATTTCACATCTGACTTA 60 Sabat et al. 2000 Ent1
Ent2 General Enterococci 112 TACTGACAAACCATTCATGATG
AACTTCGTCACCAACGCGAAC 55/49 Morrison et al. 2008 ESP-1 (F)
ESP-2 (R) E. faecalis 680 GGT CAC AAA GCC CAA CTT GT
ACG TCG AAA GTT CGA TTT CC 60 Hammerun and Jensen, 2002 / Scott et al., 2005
HF183/134 Bac708R
human HF183 human HF134
520 570
ATCATGAGTTCACATGTCCG ATCARGTCACATGTCCCG
CAATCGGAGTTCTTCGTG 59
Bernhard and Field, 2000 / Ahmed et al., 2007
*The operational conditions for PCR amplification were carried out according to the published methods 462
(references in this Table with minor modification).
463 464 465 466
Table 3. Escherichia coli and Enterococcus quantification in water and sediment, and mercury 467
concentration in sediment samples from N’DJILI River 468
469
Water Sediment
Sample*
E.coli ENT E.coli ENT Hg
CFU/100 mL ** CFU/100 mL ** CFU / 100 g *** CFU / 100 g *** (mg kg-1)***
EE1/ES1 4.5 x102 7 x102 1.1 x 104 9.6 x 104 0.02
EE2/ES2 1.3x102 5.3 x102 1.4 x 104 1.5 x 104 0.06
EE3/ES3 1.1x 102 4.8 x102 1.4 x 103 3.8 x 104 0.03
EE4/ES4 3.2 x102 3.9 x102 8.3 x 104 5.6 x 104 0.5
EE5/ES5 1.6x103 2.7 x103 7.0 x 104 8.2 x 104 0.01
EE6/ES6 4.1 x102 6.2 x102 3.4 x 103 1.1 x 104 0.02
EE7/ES7 n/a n/a 1.2 x 104 1.3 x 104 0.24
EE8/ES8 2.5 x102 4.1 x102 9.4 x 105 1.2 x 105 0.18
EE9/ES9 1.4 x102 3.5 x102 4.8 x 104 8.8 x 104 0.05
470
* EE: water samples, ES: sediment samples 471
** analysis performed in water 472
*** analysis performed in sediments 473
474 475 476 477 478
Table 4. PCR presence/absence assays for detection of Enterococcus faecalis and human- 479
specific bacteroides in sediment 480
E. faecalis Human bacteroides
Sample
PCR on extracted
DNA NT NP
PCR on extracted DNA
ES1 + 12 8 +
ES2 + 12 7 +
ES3 + 12 6 +
ES4 + 12 8 +
ES5 + 12 7 +
ES6 + 12 8 +
ES7 + 16 14 +
ES8 + 18 17 +
ES9 + 12 9 +
NT: number of tested colonies 481
NP: number of positive PCR amplification 482
+ : positive PCR amplification 483
484 485 486 487
Figure Caption:
488
Fig. 1. Map location sampling area of the N'Djili River, capital city of Kinshasa, Democratic 489
Republic of Congo.
490
a. Africa continental map 491
b. Congo River map 492
c. Picture of the an uncontrolled landfill near N’Djili River (Google map) 493
d. Flow of N'Djili River to the Congo River Basin and the sampling sites location.
494
EE: water samples 495
ES: sediment samples 496
EE1-EE3/ES1-ES3 samples from industrial effluent discharge (IED) area 497
EE4-EE6/ES4-ES6 samples from presence of uncontrolled landfills (PUL) area 498
EE7-EE9/ES7-ES9 samples from urban agricultural and storm runoff (UAS area 499
500
Fig. 1.
501
502 503 504 505
