• Aucun résultat trouvé

Table S1

N/A
N/A
Info
Télécharger
Protected

Academic year: 2021

Partager "Table S1"

Copied!
1
0
0

Chargement.... (Voir le texte intégral maintenant)

Texte intégral

(1)

Table S1. Primer and polymorphism information for three plastid DNA sequence regions studied in Restio capensis, including region name, primer name, forward and reverse primer sequences, length of analyzed sequence regions, numbers of SNPs and Indels detected, and primer source.

*

Primer used for population-level sequencing of amplicons. †References for previously published primer pairs can be found in the main paper.

Region Primer Sequence Length SNPs Indels Source†

ssrt9 F* AAACTACCGGTTTCGCTTGGTGG 417 2 0 newly designed

R ACCAGTAGGTCCTTGGGCGGAT

ndhA intron F GCYCAATCWATTAGTTATGAAATACC 305 2 0 Shaw et al. 2007

R* GGTTGACGCCAMARATTCCA

psbD Exon F* CCTTGTGCYTATTTCGCYTTA 466 1 0 Scarcelli 2011

Figure

Table S1. Primer and polymorphism information for three plastid DNA sequence regions studied in Restio capensis, including region

Références

Télécharger maintenant ( PDF - 1 Page - 13.14 KB )

Documents relatifs

Bariatric surgery: A primer

MAIN MESSAGE Bariatric surgery should be considered for obese patients at high risk of morbidity and mortality who have not achieved adequate weight loss with lifestyle and

Primer BLISS

Although the lexical string functions have some direct application outside of macros, lexical functions are primarily used in conjunction with the macro

STREAMS Primer

These calls allow a user process to detect events that occur at the Stream head on one or more Streams, including receipt of a data or protocol message on the read

Project Primer

Historically, the purpose of the address base register was to be a convenient place to store effective pointers, i.e., segment numbers of data or procedure

Supplemental Table 2. Marker information for microsatellite loci on Populus chromosome XIX, including marker name, repeat type, primer sequences, and PCR size expected from the P. trichocarpa genome sequence.

Marker information for microsatellite loci on Populus chromosome XIX, including marker name, repeat type, primer sequences, and PCR size expected from the P.. trichocarpa

Sympatric bromeliad species (Pitcairnia spp.) facilitate tests of mechanisms involved in species cohesion and reproductive isolation in Neotropical inselbergs

Table S1 Primer sequences and characteristics of plastid DNA microsatellite loci in Pitcairnia spp., including locus name, plastid DNA region, primer sequences, repeat type,

A daphnia parasite (Caullerya mesnili) constitutes a new member of the ichthyosporea, a group of protists near the animal - fungi divergence

Primer sequences used to amplify the small subunit (SSU) and ITS rDNA regions of Caullerya mesnili.. Primer name Species Primer sequence (5 0 –3 0 ) rDNA region Product length T

A power primer

[r]