A Sugar-Inducible Protein Kinase, VvSK1, Regulates Hexose Transport and Sugar Accumulation in Grapevine Cells

(1)

HAL Id: hal-02346899

https://hal.archives-ouvertes.fr/hal-02346899

Submitted on 17 Nov 2020

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

A Sugar-Inducible Protein Kinase, VvSK1, Regulates Hexose Transport and Sugar Accumulation in Grapevine

Cells

Fatma Lecourieux, David Lecourieux, Céline Vignault, Serge Delrot

To cite this version:

Fatma Lecourieux, David Lecourieux, Céline Vignault, Serge Delrot. A Sugar-Inducible Protein Ki- nase, VvSK1, Regulates Hexose Transport and Sugar Accumulation in Grapevine Cells. Plant Phys- iology, American Society of Plant Biologists, 2010, 152 (2), pp.1096-1106. �10.1104/pp.109.149138�.

�hal-02346899�

(2)

Running title:

Regulation of sugar transport by a protein kinase

Corresponding author:

Name : Fatma Lecourieux

Address : UMR Ecophysiology and Grape Functional Genomics, University of Bordeaux, INRA, Institut des Sciences de la Vigne et du Vin, 210 Chemin de Leysotte, 33882 Villenave d’Ornon, France

Phone + 33 5 57575909 Fax +33 5 57575903

e-mail fatma.lecourieux@bordeaux.inra.fr

Research categorie: System biology, Molecular Biology, and Gene Regulation

Plant Physiology Preview. Published on November 18, 2009, as DOI:10.1104/pp.109.149138

(3)

TITLE:

A sugar inducible protein kinase, VvSK1, regulates hexose transport and sugar accumulation in grapevine cells

Authors

Fatma Lecourieux*, David Lecourieux, Céline Vignault and Serge Delrot

Address

UMR Ecophysiology and Grape Functional Genomics, University of Bordeaux, INRA, Institut des Sciences de la Vigne et du Vin, 210 Chemin de Leysotte, 33882 Villenave d’Ornon, France (F.L., D.L., S.D.) ; and FRE CNRS 3091, University of Poitiers, 40 Avenue du Recteur Pineau, France (C.V.)

https://plantphysiol.org Downloaded on November 17, 2020. - Published by

(4)

FOOT NOTES:

*Corresponding author:

Fatma Lecourieux, UMR Ecophysiology and Grape Functional Genomics, University of Bordeaux, INRA, Institut des Sciences de la Vigne et du Vin, 210 Chemin de Leysotte, 33882 Villenave d’Ornon, France

Phone + 33 5 57575909. Fax +33 5 57575903. E-mail: fatma.lecourieux@bordeaux.inra.fr

The author responsible for the distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plant physiol.org) is: Serge Delrot (serge.delrot@bordeaux.inra.fr).

(5)

ABSTRACT

In grapevine as in many crops, soluble sugar content is a major component of yield and economical value. This paper identifies and characterizes a GSK3 protein kinase, cloned from a cDNA library of grape (Vitis vinifera L.) Cabernet Sauvignon berries harvested at the ripening stage. This gene, called VvSK1, was mainly expressed in flowers, berries and roots.

In the berries, it was strongly expressed at post-véraison, when the berries accumulate glucose, fructose, and abscisic acid (ABA). In grapevine cell suspensions, VvSK1 transcript abundance is increased by sugars and ABA. In transgenic grapevine cells overexpressing VvSK1, the expression of four monosaccharide transporters (VvHT3, VvHT4, VvHT5 and VvHT6) was up-regulated, the rate of glucose uptake was increased 3-5 fold, and the amount of glucose and sucrose accumulation was more than doubled, while the starch amount was not affected. The present work provides the first example of the control of sugar uptake and accumulation by a sugar inducible protein kinase.

(6)

INTRODUCTION

Efficient and coordinated transport of assimilates is essential for plant growth, development and productivity. Plant growth and plant productivity are not limited by photosynthesis per se, but rather by the ability of the plant to export and to partition its assimilates in a proper way. Increased crop yield are paralleled by a better partitioning of assimilates between the harvestable part of the plant and the rest of the plant (Gifford and Evans, 1981; Gifford et al., 1984; Hoffmann-Thoma, 1996). Long-distance and intercellular transport of sugars is mediated by proton-coupled sucrose transporters (belonging to the disaccharide transporter family), and hexose and polyol transporters (belonging to the monosaccharide transporter family). Many of these transporters have been identified in a wide range of species (Lemoine, 2000; Sauer et al., 2004; Büttner, 2007;). Disaccharide transporter genes belong to small multigenic families (e.g. 9 members in Arabidopsis and 4 in tomato) (Sauer et al. 2004; Hackel et al. 2006) and can be clustered into 4 groups regarding the homologies of the encoded protein sequences. The Arabidopsis genome has 53 homologous sequences encoding putative monosaccharide transporters, which are distributed into 7 distinct clusters (Büttner, 2007).

Control of the expression of these transporters in specific cell types at precise stages of development allows fine-tuning in the plant of its carbon distribution. Although many sugar transporters have now been identified and characterized, little is known about their regulation.

Upregulation of a glucose transporter gene has been observed after treatment of Chenopodium rubrum cells with cytokinin (Ehness and Roitsch, 1997). In Arabidopsis, the monosaccharide transporter gene, AtSTP4, may be induced by fungal and bacterial elicitors (Truernit et al., 1996; Fotopoulos et al., 2003), whereas the fungal elicitor cryptogein rapidly and completely blocks glucose uptake in tobacco cells (Bourque et al., 2002).

Accumulating evidence indicates that sugars may control the expression and activity of their own transporters. The ability to sense altered sugar concentration is important and allows the plant to regulate its metabolism and compartmentation processes in order to face the demands of sink organs (Roitsch, 1999). There is some discrepancy about the effect of sugars on the control of these transporters. In Chenopodium rubrum cell suspensions, monosaccharide transporter genes are constitutively expressed and not regulated by sugar (Roitsch and Tanner, 1994). Sucrose was reported to repress the sugar beet sucrose transporter BvSUT1 both at transcriptional and translational levels (Chiou and Bush, 1998;

Vaughn et al., 2002; Ransom-Hodgkins et al., 2003), whereas it up-regulates OsSUT1 in rice

(7)

(Matsukura et al., 2000). Down-regulation of monosaccharide transport in response to glucose supply was also observed in suspension-cultured cells of olive (Oliveira et al., 2002) and in peach tree buds (Maurel et al., 2004). By contrast, the expression of VvHT1 in grape cell suspensions is induced by low concentration of sucrose (Atanassova et al., 2003) and repressed at high sucrose concentration (Conde et al., 2006), suggesting that the effect of sugars on transporter genes depend on sugar concentration and on the physiological status of the cells.

In contrast to the situation in bacteria, yeast and mammals, where sugar signaling pathways are extensively studied (Johnston, 1999), signaling cascades involved in response to sugar in plants are still poorly understood. However, the combination of mutant isolation and pharmacological approaches reveals the involvement of protein kinases (PKs), protein phosphatases, and other signal transduction mediators such as Ca²⁺ and calmodulin (Smeekens, 2000). Among the PKs identified in sugar sensing and signaling in plants, the importance of SNF1 (Sucrose Non Fermenting)-like protein kinase complexes and interacting proteins has been well established (Rolland et al., 2006). In addition, the involvement of other PKs, like CDPKs (Calcium Dependent PK) (Ohto et al., 1995) and MAPKs (Mitogen Activating PK) (Ehness et al., 1997) has also been suggested.

Glycogen synthase kinase 3 (GSK3), is a constitutively active serine/threonine kinase involved in diverse physiological activities and functions ranging from metabolism, cell cycle, gene expression and development (Rayasam et al., 2009). In mammalian cells, GSK-3 is an important signaling player that is ubiquitously expressed and has been implicated in the regulation of glucose transport and metabolism (Grimes and Jope, 2001). The few existing reports about regulation of glucose uptake by GSK-3 have produced different findings in different cell systems (Nikoulina et al., 2002; Wieman et al., 2007) implicating GSK-3 in either insulin signaling or in non-insulin stimulated condition in cell types that are not insulin sensitive. GSK-3/SHAGGY-like kinases (GSKs) are a large gene family in plants (Jonak and Hirt, 2002). Recent functional studies indicate that plant GSKs are involved in diverse important processes including hormone signaling, development and stress responses (Dornelas et al., 2000; Jonak et al., 2000; Piao et al., 2001; Choe et al., 2002; Li and Nam, 2002; Perez-Perez et al., 2002; Vert and Chory, 2006, Kempa et al., 2007).

In this work, we report the involvement of VvSK1 (Vitis vinifera Shaggy Kinase), a GSK- 3/SHAGGY-like kinase in the regulation of sugar accumulation in grape cell suspension in response to sugar. This GSK3-like kinase, whose expression is increased by sugars, probably acts through the regulation of monosaccharide transporter gene expression. The analysis of its

(8)

gene expression during grape berry development also suggests that it may be involved in the control of sugar accumulation during berry ripening.

RESULTS

Isolation and Sequence Analysis of VvSK1

Total RNA extracted from Cabernet Sauvignon berry (CSB) cells treated or not with 58 mM sucrose were hybridized with 70-mer oligoarrays bearing a set of 14,562 unigenes (Qiagen Operon Array-Ready Oligo Set for the Grape Genome Version 1.0). Among the genes that were significantly up-regulated after 1 h of sucrose treatment, a gene corresponding to the EST sequence (TC46745) showed homology to the GSK3 family and was selected for further investigation. This choice was directed by previous data showing that members of the GSK3 family are involved in the regulation of carbohydrate metabolism in eukaryotic cells (Embi et al., 1980; Woodgett and Cohen, 1984; Kempa et al., 2007). The full-length cDNA was amplified by PCR using a cDNA library prepared from post-véraison Cabernet Sauvignon berries and it was named VvSK1 (Vitis vinifera Shaggy-like Kinase 1; GenBank accession XP_0022721 12; GSVIVT00026235001). VvSK1 encodes a protein of 468 amino acids that contains the 11 highly conserved domains characteristic of kinases, including the tyrosine residue in the T-loop. VvSK1 exhibits high amino acid sequence similarities with GSKs from others species: 87% with NtSK91 (tobacco), 87% with LpSK6 (tomato), 87%

with PSK6 (Petunia Hybrida), and 86% with AtSK8 (Arabidopsis) (Fig. 1).

Analysis of the Vitis vinifera genome (Jaillon et al., 2007) allowed the identification of 6 additional GSK3 members that were numbered from 2 to 7. Interestingly, VvSK1 only shares 44-67% identity with other members of grape GSK family. Based on protein sequence homology, the VvSKs were grouped into four classes (I–IV) (Fig. 2). VvSK1 (XP_002272112) belongs to class III. VvSK2 (GSVIVT00028178001), VvSK3 (GSVIVT00022544001) and VvSK4 (GSVIVT00020713001) are related to members of class I. VvSK5 (GSVIVT00035848001) and VvSK6 (GSVIVT00018774001) are related to class II, and VvSK7 (GSVIVT00035285001) to class IV.

Expression of VSK1 in response to sugar and ABA treatments

The expression profile of VvSK1 was assessed by RNA blot using RNA samples extractedDownloaded on November 17, 2020. - Published by https://plantphysiol.org Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

(9)

from CSB suspension cells collected 0, 1, 2, 4, 6 and 8 h after supply of 58 mM sucrose as well as from control cells without sugar supply. VvSK1 transcripts accumulate from 1 h until the end of the experiment (Fig. 3A). To exclude an osmotic effect of sucrose, CSB suspension cells were treated with the same concentration of mannitol or PEG 600. None of these chemicals affected VvSK1 expression, indicating that the expression profile previously observed is not due to an osmotic stress but rather to a sucrose specific effect (Fig. 3B).

In order to elucidate the signaling pathway involved in the transcriptional regulation of this gene, we tested different sugar analogs on CSB suspension cells (Fig. 3C). Cells were treated with 3-OMG (which is absorbed but poorly phosphorylated) and 2-DOG (which is absorbed, phosphorylated but not further metabolized), or with 58 mM sucrose in the presence of the hexokinase (HXK) inhibitor mannoheptulose (MHL) (Gibson, 2000). Blockage of HXK activity in cells treated with 10 mM MHL resulted in repressed levels of VvSK1 transcripts.

Addition of 58 mM 3-OMG has no effect on VvSK1 expression. By contrast, addition of 58 mM 2-DOG up-regulates VvSK1 as was observed after sucrose treatment. Taken together, these results suggest that sucrose up regulates VvSK1 expression through an HXK-dependent pathway.

Hormones play a crucial role during grape berry development. More particularly, endogenous ABA levels increase after véraison, and treatments that delay this increase delay the onset of ripening (Davies et al., 1997; Deluc et al 2009). In order to investigate a potential effect of ABA on VvSK1 expression, CSB cell suspensions were treated with 20 tM ABA and collected 0, 2, 4, 6, 8 and 12 h later. VvSK1 expression was monitored by quantitative RT- PCR. The results revealed that ABA increased the transcript abundance of VvSK1 by two fold within 2 h and this amount of VvSK1 transcripts was maintained for at least 10 h after ABA supply (Fig. 3D).

Relative expression profile of VvSK1 in grapevine organs and berry tissues

The relative transcript abundance of VvSK1 was determined in different grapevine organs by RT-PCR with RNA extracted from Cabernet Sauvignon roots, stems, leaves, flowers and mature berries. VvSK1 was predominantly expressed in roots, inflorescences and mature berries, whereas it was hardly detectable in stems and leaves (Fig. 4A). VvSK1 transcript accumulation was also assessed during berry development. VvSK1 was present in green berries, but the accumulation of the transcript increased mainly after véraison stage and was maintained until the harvesting stage (Fig. 4B). This expression profile is in agreement with microarray data that were previously obtained from Shiraz and Chardonnay developing

(10)

berries (David Glissant and Serge Delrot, unpublished data).

The level of expression of VvSK1 in the different berry compartments at véraison (seeds, pulp and skin) was also analyzed by RT-PCR. As shown in Figure 3C, VvSK1 showed ubiquitous expression in the berry even though expression levels seemed higher in skin and pulp than in seeds.

Overexpression of VvSK1 in grapevine cells affects sugar transport

In order to elucidate the function of VvSK1, transgenic grape cells overexpressing HA- tagged VvSK1 under the control of the CaMV 35S promoter were prepared. After stabilization of the cell suspension by subculture in glycerol-maltose-NOA culture medium supplemented with paromomycin and cefotaxime, the expression of VvSK1-HA was tested by PCR and western blotting. A DNA fragment of 1408 bp corresponding to VvSK1 was strongly amplified by VvSK1 specific primers, in the cells expressing the 35S:: VvSK1-HA construct, in comparison with cells expressing the empty vector (Fig. 5A). In addition, the recombinant protein VvSK1-HA with a molecular weight of 57.2 kDa was detected in a western blot with an anti-HA antibody (Fig. 5B). To confirm that VvSK1 is a functional protein kinase, we performed a phosphorylation assay using VvSK1 produced in Escherichia coli as a glutathione S-transferase (GST) fusion protein. VvSK1 phosphorylated myelin basic protein as an artificial substrate (Fig. 5C) showing that in addition to being functional, VvSK1 exhibits a basal constitutive activity.

The expression level of different hexose transporter genes in the 35S:: VvSK1-HA grape cells was measured in order to gain greater insights into sugar accumulation during grape berry development. Seven plasma membrane MST homologues (VvHTs) and a plastidic Glucose transporter (pGLT) have been cloned from grape berries (Hayes et al., 2007; Vignault et al., 2006). Specific primers were designed for the sequences of VvHT1 (accession no. AJ001061), VvHT2 (AY663846), VvHT3 (AY538259), VvHT4 (AY538260), VvHT5 (AY538261), VvHT6 (AY861386), and VvpGLT (AY608701) and used to test the corresponding transcript amounts in 41B cells overexpressing VvSK1 (Fig. 6A). Compared to control cells, overexpression of VvSK1 increased the accumulation of VvHT3, VvHT4, VvHT5 and VvHT6 transcripts when compared to control cells whereas VvHT1, VvHT2, and pGLT transcripts were not significantly affected. Although transcript abundance was increased for all four hexose transporters, they were up-regulated in a slightly different way. Thus, VvHT3 and VvHT4 transcript abundance was increased by 1.7 fold in the VvSK1 overexpressing line, whereas it was increased by 3.4 and 2.8 fold for VvHT5 and VvHT6, respectively. Interestingly, VvHT3,Downloaded on November 17, 2020. - Published by https://plantphysiol.org

(11)

VvHT4, VvHT5 and VvHT6 expression was increased after supply of 58 mM sucrose. Their transcripts accumulated within 1 h and peaked 6 h after sucrose addition (Fig. 6B). These results suggest that sucrose might affect the expression of these 4 VvHTs through a signaling cascade involving VvSK1.

As a consequence, VvSK1 might also affect sugar transport activities in grape cells. To test this hypothesis, uptake of D-^[¹⁴C^]-glucose was compared in control cells and in cells overexpressing VvSK1. The rate of glucose accumulation by 41B cells overexpressing VvSK1 was 3-5 fold higher than in control cells during the time course studied (Fig. 7).

Analysis of sugar content in grape cells overexpressing VvSK1

The stimulation of hexose transporters gene expression in 41B cells overexpressing VvSK1 and the enhanced ability of these cells to accumulate glucose indicated that their sugar content might be altered by VvSK1 expression. Soluble sugars (glucose, fructose and sucrose), and starch contents were assayed seven days after subculture (Fig. 8). Comparison of the sugar profiles showed that 41B cells overexpressing VvSK1 displayed a 2-fold increase in glucose and a 3.3-fold increase in sucrose content as compared to PFB8 control cells. By contrast, starch amounts were not significantly different between both cell lines. Fructose amounts were too small to be quantified and therefore could not be compared. For this experiment, 3 independent flasks of 41 B cell suspension cultures for each condition were used.

DISCUSSION

Sugars provide the reduced carbon needed for the structural materials of the cell, storage compounds and all major primary and secondary metabolites. They also influence plant growth and development by acting as regulatory signals, which affect the expression of various genes involved in many processes of the plant life cycle (Koch, 1996; Jiang and Carlson, 1997; Smeekens 1998; Roitsch, 1999; Sheen et al., 1999). It is therefore important to identify the molecular players that may directly or indirectly control sugar transport in plants.

Although many sugar transporters have now been identified, little is known about sugar transport regulation at the molecular level (Delrot et al., 2000).

Protein kinases are major components of intracellular signal transduction enabling plant cells to rapidly respond to the environment. The present paper shows that VvSK1 is a sugar

10

(12)

and ABA induced GSK3 protein kinase that increases the transcript abundance of several monosaccharide transporters and the soluble sugar content of grape cells. MsK4, a GSK3 homologue from group IV, controls carbohydrate metabolism in response to salt stress (Kempa et al., 2007). MsK4 is a starch-associated protein kinase that, when over-expressed, modulates carbohydrate metabolism. Additionally, MsK4 acts as a signaling component in the high-salinity response, linking stress signaling to metabolic adaptation.

The Vitis GSK3 phylogenic tree revealed that VvSK1 was less related to the other VvSKs than to homologues from other species. Indeed, VvSK1 shared highest similarities with GSK3s from Solanacea NSK91, NSK59, LpSK6 (87%, 87%, 86.6%), PSK6 and PSK7 (87%

and 84.3%) or from Arabidopsis ASK2 () and ASK8 () (78% and 86%). These GSK3s, which belong to the same clade (group III), are preferentially expressed in flowers (Tichtinsky et al., 1998; Charrier et al., 2002; Wilson et al., 2004). Among these, ASK(AtSK3-2) was shown to be involved in the control of cell elongation in flower development and in response to light (Claisse et al., 2007). Our data showed that VvSK1 was not only expressed in flowers, but also in two other major sink organs: roots and berries, indicating that its role was not only restricted to flower development in grapevine (Fig. 4A). In berries, VvSK1 transcript amounts transiently decreased after the green stage and increased again after véraison stage (Fig. 4B), when both sugars and ABA accumulate in this organ (Davies et al., 1997; Pan et al., 2005).

Our experiments showed that both sugar and ABA could increase the transcript abundance of VvSK1 in grape cell suspensions (Fig. 3A and 3D). It is well known that sugar signaling does not operate alone but rather is integrated in cellular regulatory networks. Most notably, there is a tight interaction between sugar and hormonal signaling, particularly for ABA (Smeekens, 2000 ; Finkelstein and Gibson, 2002 ; Léon and Sheen, 2003 ; Rolland et al., 2006). Also, it is known that ABA enhances sugar accumulation in crop sink organs (Kobashi et al. 2001) and data from the literature show that both sugar and ABA act synergistically (Smeekens, 2000 ; Léon and Sheen, 2003 ; Rolland et al., 2006; Ramon et al., 2008). In peach fruit flesh, sugar accumulation is stimulated by ABA that in turn stimulates uptake of sugars (Kobashi et al.

2001). ABA induces the expression of VvHT1 (Atanassova et al., 2003) and acts synergistically with physiological concentrations of monosaccharides to transiently induce VvHT1 transcription. VvHT1 responsiveness to both signals involves the presence in its promoter of a specific overlapping configuration of the two sugar response cis-elements. This configuration seems a target for the fixation and the action of VvASR, Vitis vinifera Abscisic acid, Stress, Ripening-induced) protein (also called VvMSA, ‚akir et al., 2003). VvASR expression is strongly up-regulated by the combined effect of sugars and ABA (‚akir et al.,

11

(13)

2003). More recently, it was shown that ABA increases invertase activities and amounts during grape development in correlation with soluble sugar concentration (Pan et al., 2005).

VvSK1 was induced by addition of exogenous sucrose and this induction was not due to an osmotic effect (Fig. 3C). This indicates that VvSK1 was involved downstream of sugar perception. In plants, two signaling pathways relaying sugar sensing have been described. The first one is HXK-dependent and the second is independent of HXK activity (Smeekens, 2000). To investigate the role of HXK in the sucrose induction of VvSK1, we tested the effect of glucose analogs and an inhibitor of HXK activity. The results showed that the HXK inhibitor MHL blocked VvSK1 induction by sucrose, whereas 3-OMG had no effect and 2- DOG stimulated VvSK1 expression in grape cells (Fig. 3B). This indicates that an HXK- dependent pathway may be involved in the sugar control of VvSK1 expression in grape cells

VvSK1 over-expression in grape cell suspension affects the level of expression of some sugar transporters genes expressed in grape berries (Fig. 6A). The VvHTs whose expressions were affected by VvSK1 over-expression were also affected at the transcriptional level by sugars and ABA (Fig. 6B and data not shown). This result was in accordance with the observation that VvSK1 over-expression increased by more than 3-fold the uptake rate of radiolabeled glucose in comparison to control cells (Fig. 7). The involvement of VvSK1 in the control of sugar compartmentation was further strengthened by the fact that cells overexpressing VvSK1 accumulate twice more glucose and three times more sucrose than the control, whereas the starch content remains unaffected. Sugar levels of suspension cells significantly differ from those in berries, where monosaccharide concentrations can reach 1.5 M whereas sucrose is poorly detectable (Fillion et al., 1999; Liu et al., 2006). In this context, the role of VvSK1 on sugar transport and accumulation in grape berries has to be further investigated by altering VvSK1 expression in berries.

In this work, VvSK1 was identified as a potential regulator of hexose uptake and sugar accumulation in grapevine cells. As a functional PK, VvSK1 can regulate its targets by direct phosphorylation. Protein phosphorylation is one of the most important and best characterized post-translational protein modification regulating cellular signaling processes. In plants, previous work suggested that protein phosphorylation plays a direct role in the regulation of sugar transporter transcription and sugar transport activity (Roblin et al. 1998; Ransom- Hodgkins et al., 2003). Key enzymes from carbon metabolism may also be directly regulated by phosphorylation (Sugden et al., 1999; Ikeda et al., 2000). Furthermore, in yeast, the transcription factor RGT1 that functions as a repressor in the absence of glucose becomes a transcriptional activator required for maximal induction of HXT1 gene expression, upon

(14)

phosphorylation in the presence of high concentrations of glucose (Mosley et al., 2003).

Therefore, one can hypothesize that VvSK1 can affect sugar uptake and accumulation in grapevine through the regulation of hexose transporter expression. This regulation might be mediated through VvSK1 phosphorylation events affecting the activity and/or stability of specific transcription factors, sugar transporters and/or of enzymes from sugar metabolism.

This still has to be demonstrated.

In grapevine, one of the main features of berry development is the accumulation of hexose sugars (i.e., glucose and fructose), which begins at véraison and continues throughout the ripening process. In addition to participating in the regulation of sugar homeostasis in grape cells, VvSK1 may play a role in grape berry development by affecting sugar compartmentation. This hypothesis is further supported by the capacity of VvSK1 to up regulate several VvHT gene expression and more particularly that of VvHT3 and VvHT6.

VvHT6 transcript abundance correlates well with hexose accumulation in the berries, and was recently proposed to play a significant role in hexose accumulation during berry ripening (Deluc et al., 2007). If VvHT6, which is highly homologous to the tonoplast glucose transporter AtTMT2 (Wormit et al., 2006) acts as a tonoplast sugar transporter, it would only favor indirectly glucose uptake across the plasma membrane, by decreasing the cytosolic glucose concentration. VvHT3 transcript accumulates in young berries but also later during the phase of sugar storage (Hayes et al., 2007). VvHT4 expression shows little change throughout berry development whereas VvHT5 transcript amounts increased by 3 fold at 14 weeks post-flowering. As both genes are very weakly expressed in Cabernet Sauvignon berry flesh, these transporters, unlike VvHT3 and VvHT6, may not contribute significantly to sugar import during berry development (Hayes et al., 2007). Nevertheless, the authors did not rule out the possibility that these VvHTs could be better expressed in more specific pulp cell types.

Furthermore, as VvSK1 expression in not restricted to the berry, the role of the kinase in the regulation of these 2 VvHTs in other plant organs is possible if they are expressed in the same organs.

In grape berries, like in other sink organs, sugar accumulation significantly impacts crop yield and economical value. To our knowledge, this work provides the first demonstration that soluble sugar content may be significantly affected by manipulation of a single gene involved in signaling pathways. VvSK1 transgenic cells may provide a useful model to investigate the metabolic and physiological consequences of a deregulation of sugar uptake and accumulation. Analysis of the effect of glucose analogs and the involvement of ABA, place VvSK1 downstream to the HXK-dependent sugar signaling cascade, ABA being

13

(15)

involved downstream of HXK1 (Zhou et al., 1998; Arenas-Huertero et al., 2000). The expression profiles of VvSK1 in sink organs (roots and fruits) and during berry development indicate a key role of this PK in the maturation process that still remains to be demonstrated in planta. Overall, our data provide a first trail for the identification of potential signaling components affecting sugar transport and accumulation during grape berry development and ripening.

MATERIALS AND METHODS

Isolation of grapevine Shaggy like kinase cDNA

VvSK1 was isolated from an expressed sequence tag (EST; accession number TC46745 (new TC92799)) collected at the DFCI Vitis vinifera Gene Index (VvGI) and containing the entire open reading frame (ORF). For expression analysis, the entire clone was generated from a cDNA library of grape Cabernet Sauvignon berries (ripen stage) by PCR using synthetic oligonucleotide primers designed to begin and end at the start and stop codons of the ORF (forward primer TACCCGGGACTCGAGATGAATGTGATGCGTCGTCTCAAGA GCATT ; reverse primer ATGGATCCTCAGCGGCCGCCTTTCCTTGCATGCTCAGGAA TGAGA). The VvSK1 cDNA was cloned into the pGEM-T Easy vector (Promega) for DNA sequencing prior to -HA tagging and subcloning into the vector pFB8 downstream of the 35S promoter of cauliflower mosaic virus.

RNA isolation and cDNA production

After collection, the cells were immediately frozen in liquid nitrogen and stored at –80 °C until RNA extraction. The samples were ground under liquid nitrogen with a mortar and pestle and RNA was isolated as previously described (Reid et al. 2006). Briefly, the extraction buffer contained 300 mM Tris HCl (pH 8.0), 25 mM EDTA, 2 M NaCl, 2% CTAB (Cetyltrimethylammonium bromide), 2% PVPP, 0.05% spermidine trihydrochloride and 2%

b-mercaptoethanol. Fifteen mL of pre-warmed (65°C) extraction buffer was added to the ground tissue. Samples were incubated at 65°C for 10 min, and then extracted twice with chloroform. The final aqueous layer was centrifuged at 30,000 g for 20 min at 4 °C, then 0.1 vol of 3 M NaOAc (pH 5.2) and 0.6 vol of isopropanol were added to the supernatant and stored overnight at -80°C. Samples were pelleted by centrifugation (3500g, 30 min) the next day and resuspended in 0.7 mL TE (pH 7.5). To selectively precipitate the RNA, 0.3 vol of 8 M LiCl was added and the sample was stored overnight at 4 °C. RNA was pelleted the nextDownloaded on November 17, 2020. - Published by https://plantphysiol.org

(16)

day, washed with ice cold 70% EtOH, air dried, and dissolved in DEPC-treated water. RNA isolation was followed by DNaseI treatment. Total RNA was quantified and the quality was evaluated on 1% agarose gels.

For RT-PCR analysis, 2 tg of total RNA were reverse transcribed with oligo(dT)12-18 in a 20 tL reaction mixture using the Moloney murine leukemia virus reverse transcriptase (Promega) according to the manufacturer’s instructions. After heat inactivation of the reaction mixture, PCR was performed using 2.5 tL of the first-strand cDNA sample with 20 pmol of the primers in a 50 tL reaction.

Real-time PCR expression analysis was performed by using a commercial IQ SYBR-Green Supermix kit (Bio-Rad) with the CFX96 Real-Time PCR Detection system (Bio-Rad). Gene transcripts were quantified upon normalization to EF1and actin as internal standards, by comparing the cycle threshold of the target gene with those of standard genes. All biological samples were tested in triplicate, and SE values of means were calculated using standard statistical methods. Specific oligonucleotide primer pairs were designed with Beacon Designer 7 © software (Premier Biosoft International). Specific annealing of the oligonucleotides was controlled on dissociation kinetics performed at the end of each PCR run. The efficiency of each primer pair was measured on a PCR product serial dilution. The p r i m e r s u s e d f o r a m p l i f i c a t i o n w e r e a s f o l l o w s : V v S K 1- F o r , GGTCGATCAAGAAGCAGAACAG and VvSK1 -Rev, GCAGCAGTTTCCTGTGATGTAG

; V v H T 1-For, CGTTGTTCACATCGTCGCTTTATC ; and V v H T 1-Rev, GAGCAGTCCTCCGAATAGCATTG ; VvHT2-For, GGCATAGGGGTGGTGGTAG; and V v H T 2 - R e v , T C G G G C T T T A C G G A G A G A G ; V v H T 3 - F o r , G C T A C T C T C T A C T C G T C C G C T T T G ; a n d V v H T 3 - R e v , CCCGTCATTGCTTCCGAACTTG; VvHT4-For, GGGCTGGCGAGTTTCTCTAG; and V v H T 4- R e v , A G T T C T G C T T G G A C A T C G T T T G ; V v H T 5- F o r , C A G G C T G T T C C A C T G T T C T T A T C G ; a n d V v H T 5 - R e v , AGTTAGGAGGACCGCAGGAATC; VvHT6-For, TTTATTTGCATGAGGAGGGAGTC;

a n d V v H T 6- R e v , G A G C A G C A G C C T G G A T A T A A T C ; V v p G L T- F o r , C A G T G G T T A T G G G A G C C G A G T T T G ; a n d V v p G L T - R e v , TCCACCAGAAGCTCTAGCCTTGAC.

Grapevine transformation and culture conditions

Grapevine transformations were made in 41B rootstock (V. vinifera cv. Chasselas Ñ V.

15

(17)

berlandieri). An embryogenic cell suspension culture was initiated as described previously (Coutos-Thévenot et al. 1992a,b). This cell suspension was subcultured weekly in 25 mL of glycerol-maltose culture medium (Coutos-Thevenot et al., 1992b) supplemented with synthetic auxin (naphthoxy acetic acid at 1 mg L^–1) in the dark. Embryogenic cells were transformed using an Agrobacterium cocultivation method (Mauro et al., 1995) and, after selection, the transgenic cells were subcultured in the same condition in a medium supplemented with paromomycin at 2 tg mL^–1 (final concentration) and cefotaxime at 200 tg mL^–1 (Duchefa).

Western blot analysis

Western blotting was performed with 30 tg of protein extracts separated by SDS–

polyacrylamide-gel electrophoresis, immunoblotted to poly(vinylidene difluoride) membranes (Millipore) and probed with –HA antibody (Sigma) in Tris-buffered saline pH 7.4 containing 0.05% Tween 20. Peroxidase-conjugated goat anti-rabbit IgG was used as secondary antibody and the reaction was revealed by fluorography (ECL; Amersham Biosciences).

In vitro kinase Assay

The open reading frame of VvSK1 was cloned into GST fusion protein expression vector pGEX4T-1 (Pharmacia). Expression of the GST fusion protein and affinity purification were performed as described previously (Kiegerl et al., 2000). Kinase reactions were performed in 15 µL of kinase buffer (20 mM HEPES, pH 7.4, 10 mM MgCl2, 5 mM EGTA, and 1 mM DTT) containing 5 µg of GST fusion protein, 5 µg of myelin basic protein, 0.1 mM ATP, and 2 µCi of [-32P]ATP. The protein kinase reactions were performed at room temperature for 30 min, and the reactions were stopped by adding 4x SDS loading buffer and heating for 5 min at 95°C. The phosphorylation of myelin basic protein was analyzed by autoradiography after separation by 12.5% SDS-PAGE.

Glucose uptake studies

Transgenic cells overexpressing VvSK1 were collected 10 days after subculture and washed 3 times with culture medium lacking sugar at pH 5.0. Cells were then resuspended in the same fresh medium and equilibrated for 2 h at 120 rpm. Uptake was initiated by addition of D-^[¹⁴C^]-glucose (final concentration: 0.133 Mbq/g FW). One mL aliquotes of the cell suspension were collected after 0, 0.5, 2 and 4 h of incubation with the radioactive sugar. The reaction was stopped by addition of 2 x 5 mL of culture medium without sugar and the cells

(18)

were collected by filtration on GF/C Whatman membranes. The filters were dried and, their radioactivity was measured in a Packard Tri-Carb 1900 TR liquid scintillation counter (Packard Instruments).

Analysis of sugar content in 41B cells

41 B transgenic cells were collected 7 days after subculture, washed twice with water and frozen in liquid nitrogen before grinding. Soluble sugars (reducing sugars and sucrose) and starch were analyzed enzymatically (kit LISA 200C, CETIM, France) after sequential extraction with an ethanol/water mixture (80/20, v/v) at 60°C. The NADPH2 released by the enzymatic reactions was measured spectrophotometrically at 340 nm with an absorbance microplate reader (ELx800UV, Bio-Tek Instruments, Winooski, VT, USA) (Grechi et al., 2007).

ACKNOWLEDGEMENTS

The authors thank Christian Kappel for assistance in bioinformatics, Messaoud Meddar for preparing the cell culture media, Ghislaine Hilbert and Christelle Renaud for help in sugar content analysis, Prof Heribert Hirt for critical reading of the manuscript and Prof. Grant Cramer for improving the style of the manuscript.

LITERATURE CITED

Arenas-Huertero F, Arroyo A, Zhou L, Sheen J, Le—n P (2000) Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev 14:

208 5–209 6

Atanassova R, Leterrier M, Gaillard C, Agasse A, Sagot E, Coutos-Thevenot P, Delrot S (2003) Sugar-regulated expression of a putative hexose transport gene in grape. Plant Physiol. 131: 326-334

Bourque S, Lemoine R, Sequeira-Legrand a, Fayolle L, Delrot S, Pugin A (2002) The elicitor cryptogein blocks glucose transport in tobacco cells. Plant Physiol 130: 2177-2187

17

(19)

Büttner M (2007) The monosaccharide transporter(-like) gene family in Arabidopsis. FEBS Lett 581:2318-2324

Cakir B, Agasse A, Gaillard C, Saumonneau A, Delrot S, Atanassova R (2003) A grape ASR protein involved in sugar and abscisic acid signaling. Plant Cell 15: 2165-2180

Charrier B, Champion A, Henry Y, Kreis M (2002) Expression profiling of the whole Arabidopsis shaggy-like kinase multigene family by real-time reverse transcriptase polymerase chain reaction. Plant Physiol 130:577–590

Chiou TJ, Bush DR (1998) Sucrose is a signal molecule in assimilate partitioning. Proc Natl Acad Sci USA 95 :4784–4788

Choe S, Schmitz RJ, Fujioka S, Takatsuto S, Lee MO, Yoshida S, Feldmann KA, Tax FE (2002) Arabidopsis brassinosteroid-insensitive dwarf12 mutants are semidominant and defective in a glycogen synthase kinase 3beta-like kinase. Plant Physiol 130 : 1506–1515 Claisse G, Charrier B, Kreis M (2007) The Arabidopsis thaliana GSK3/Shaggy like kinase

AtSK3-2 modulates floral cell expansion. Plant Mol Biol 64:113-124

Conde C, Agasse A, Glissant D, Tavares R, Gerós H, Delrot S (2006) Pathways of glucose regulation of monosaccharide transport in grape cells. Plant Physiol 141:1563-1577

Coutos-Thévenot P, Goebel-Tourand I, Mauro MC, Jouanneau JP, Boulay M, Deloire A, Guern J (1992) Somatic embryogenesis from grapevine cells. I. Improvement of embryo development by changes in culture conditions. Plant Cell, Tissue and Organ Culture 29 : 125–133.

Coutos-Thévenot P, Maës O, Jouenne T, Mauro MC, Boulay M, Deloire A, Guern J (1992b) Extracellular protein patterns of grapevine cell suspensions in embryogenic and non-embryogenic situations. Plant Science 86 : 137–145.

Davies C, Boss PK, Robinson SP (1997) Treatment of grape berries, a nonclimacteric fruit with a synthetic auxin, retards ripening and alters the expression of developmentally regulated genes. Plant Physiol 115: 1155–1161

Delrot S, Atanassova R, Maurousset L (2000) Regulation of sugar, amino acid and peptide plant membrane transporters. Biochim Biophys Acta 1465: 28 1-306

Deluc LG, Grimplet J, Wheatley MD, Tillett RL, Quilici DR, Osborne C, Schooley DA, Schlauch KA, Cushman JC, Cramer GR (2007) Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development. BMC Genomics 8:429-47 1

Deluc LG, Quilici DR, Decendit A, Grimplet J, Wheatley MD, Schlauch KA, Mérillon JM, Cushman JC, Cramer GR (2009) Water deficit alters differentially metabolic

(20)

pathways affecting important flavor and quality traits in grape berries of Cabernet Sauvignon and Chardonnay. BMC Genomics 10:212-245

Dornelas MC, Van Lammeren AA, Kreis M (2000) Arabidopsis thaliana SHAGGY-related protein kinases (AtSK1 1 and 12) function in perianth and gynoecium development. Plant J 21 : 419–429

Ehness R, Ecker M, Godt DE, Roitsch TH (1997) Glucose and Stress Independently Regulate Source and Sink Metabolism and Defense Mechanisms via Signal Transduction Pathways Involving Protein Phosphorylation. Plant Cell 9: 1825–1841

Ehness R, Roitsch T (1997) Co-ordinated induction of mRNAs for extracellular invertase and a glucose transporter in Chenopodium rubrum by cytokinins. Plant J 11 :539-548

Embi N, Rylatt DB and Cohen P (1980) Glycogen synthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase.

Eur J Biochem 107: 5 19–527

Fillion L, Ageorges A, Picaud S, Coutos-Thévenot P, Lemoine R, Romieu C, Delrot S (1999) Cloning and expression of a hexose transporter gene expressed during the ripening of grape berry. Plant Physiol 120: 1083-1094

Finkelstein RR, Gibson SI (2002) ABA and sugar interactions regulating development:

cross-talk or voices in a crowd? Curr Opin Plant Biol 5:26-32

Fotopoulos V, Gilbert MJ, Pittman JK, Marvier AC, Buchanan AJ, Sauer N, Hall JL, Williams LE (2003) The monosaccharide transporter gene, AtSTP4, and the cell-wall Invertase, Atbfruct1, are induced in Arabidopsis during infection with the fungal biotroph Erysiphe cichoracearum. Plant Physiol. 132: 82 1-829

Gibson SI (2000) Plant sugar-response pathways. Part of a complex regulatory web. Plant Physiol 124 :1532-1539

Gifford RM, Evans LT (1981) Photosynthesis, carbon partitioning, and yield. Annu Rev Plant Physiol 32: 485-509

Gifford RM, Thorne JH, Hitz WD, Giaquinta, RT (1984) Crop productivity and photoassimilate partitioning. Science 225: 801-808

Grimes CA, Jope RS (2001) The multifaceted roles of glycogen synthase kinase 3beta in cellular signaling. Prog Neurobiol 65:39 1-426

Hackel A, Schauer N, Carrari F, Fernie AR, Grimm B, KŸhn C (2006) Sucrose transporter LeSUT1 and LeSUT2 inhibition affects tomato fruit development in different ways. Plant J 45:180-192

19

(21)

Hayes MA, Davies C, Dry IB (2007) Isolation, functional characterization, and expression analysis of grapevine ( Vitis vinifera L.) hexose transporters: differential roles in sink and source tissues. J Exp Bot 58:1985-1997

Hoffmann-Thoma G, Hinkel K, Nicolay P, Willenbrink J (1996) Sucrose accumulation in sweet sorghum stem internodes in relation to growth. Physiol Plantarum 97:277–284

Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyère C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pè ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; French- Italian Public Consortium for Grapevine Genome Characterization (2007) The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449:463-467

Jiang R, Carlson M (1997) The Snf1 protein kinase and its activating subunit, Snf4, interact with distinct domains of the Sip 1/Sip2/Gal83 component in the kinase complex. Mol Cell Biol 17:2099-2106

Johnston M (1999) Feasting, fasting and fermenting. Glucose sensing in yeast and other cells. Trends Genet 15 : 29-33

Jonak C, Beisteiner D, Beyerly J, Hirt H (2000) Wound-induced expression and activation of WIG, a novel glycogen synthase kinase 3. Plant Cell 12 : 1467–1476

Jonak C, Hirt H (2002) Glycogen synthase kinase 3/SHAGGY-like kinases in plants: an emerging family with novel functions. Trends Plant Sci 7 : 457–461

Kempa S, Rozhon W, Samaj J, Erban A, Baluska F, Becker T, Haselmayer J, Schleiff E, Kopka J, Hirt H, Jonak C (2007) A plastid-localized glycogen synthase kinase 3 modulates stress tolerance and carbohydrate metabolism. Plant J 49:1076-1090

Kiegerl S, Cardinale F, Siligan C, Gross A, Baudouin E, Liwosz A, Eklof S, Till S, Bogre L, Hirt H, and Meskiene I (2000) SIMKK, a mitogen-activated protein kinase (MAPK) kinase, is a specific activator of the salt stress-induced MAPK, SIMK. Plant Cell 12:

2247–2258

(22)

Kobashi K, Sugaya S, Gemma H, Iwahori S (2001) Effect of abscisic acid (ABA) on sugar accumulation in the flesh tissue of peach fruit at the start of the maturation stage. Plant Growth Regul 35 :215-223

Koch KE (1996) Carbohydrate-modulated gene expression in plants. Annu Rev Plant Physiol Plant Mol Biol 47:509-540

Lemoine R (2000) Sucrose transporters in plants: update on function and structure. Biochim Biophys Acta 1465:246-262

Le—n P, Sheen J (2003) Sugar and hormone connections. Trends Plant Sci 8:110-6

Li J, Nam KH (2002) Regulation of brassinosteroid signaling by a GSK3/SHAGGY-like kinase. Science 295 : 1299–1301

Liu HF, Wu BH, Fan PG, Li SH, Li LS (2006) Sugar and acid concentrations in 98 grape cultivars analyzed by principal component analysis. J Sci Food Agric 86: 1526-1536

Matsukura C, Saitoh T, Hirose T, Ohsugi R, Perata P, Yamaguchi J (2000) Sugar uptake and transport in rice embryo: expression of companion cell-specific sucrose transporter (OsSUT1) induced by sugar and light. Plant Physiol 124: 85–94

Maurel K, Sakr S, Gerbe F, Guilliot A, Bonhomme M, Rageau R, Pétel G (2004) Sorbitol uptake is regulated by glucose through the hexokinase pathway in vegetative peach-tree buds. J Exp Bot 55: 879–888

Mauro MC, Toutain S, Walter B, Pinck L, Otten L, Coutos-Thévenot P, Deloire A, Barbier P (1995) High efficiency regeneration of grapevine plants transformed with the GFLV coat protein gene. Plant Science 112 : 97–106

Mosley AL, Lakshmanan J, Aryal BK, Ozcan S (2003) Glucose-mediated phosphorylation converts the transcription factor Rgt1 from a repressor to an activator. J Biol Chem.

278:10322-7

Nikoulina SE, Ciaraldi TP, Mudaliar S, Carter L, Johnson K, Henry RR (2002) Inhibition of glycogen synthase kinase 3 improves insulin action and glucose metabolism in human skeletal muscle. Diabetes 51:2190-8

Oliveira J, Tavares RM, Geros H (2002) Utilization and transport of glucose in Olea europaea cell suspensions. Plant Cell Physiol 43: 1510–1517

Ohto M, Nakamura K (1995) Sugar-induced increase of calcium-dependent protein kinases associated with the plasma membrane in leaf tissues of tobacco. Plant Physiol 109:973-98 1 Pan QH, Li MJ, Peng CC, Zhang N, Zou X, Zou KQ, Wang XL, Yu XC, Wang XF,

Zhang DP (2005) Abscisic acid activates acid invertases in developing grape berry.

Physiol Plant 125: 157–170

21

(23)

Perez-Perez JM, Ponce MR, Micol JL (2002) The UCU1 Arabidopsis gene encodes a SHAGGY/GSK3-like kinase required for cell expansion along the proximodistal axis. Dev Biol 242 : 161–173

Piao HL, Lim JH, Kim SJ, Cheong GW, Hwang I (2001) Constitutive over-expression of AtGSK1 induces NaCl stress responses in the absence of NaCl stress and results in enhanced NaCl tolerance in Arabidopsis. Plant J 27:305-14

Ransom-Hodgkins R, Vaughn MW, Bush DR (2003) Protein phosphorylation plays a key role in sucrose-mediated transcriptional regulation of a phloem-specific proton-sucrose symporter. Planta 217: 483–489

Rayasam GV, Tulasi VK, Sodhi R, Davis JA, Ray A (2009) Glycogen synthase kinase 3:

more than a namesake. Brit J Pharmacol 156:885-98

Roitsch T (1999) Source-sink regulation by sugar and stress Curr Opin Plant Biol 2:198-206 Roitsch T, Tanner W (1994) Expression of a sugar-transporter gene family in a

photoautotrophic suspension culture of Chenopodium rubrum L. Planta 193: 365-371 Rolland F, Baena-Gonzalez E, Sheen J (2006) Sugar sensing and signaling in plants:

conserved and novel mechanisms. Annu Rev Plant Biol 57:675-709

Sakr S, Lemoine R, Gaillard C, Delrot S (1993) Effect of cutting on solute uptake by plasma membrane vesicles from sugar beet (Beta vulgaris L.) leaves. Plant Physiol 103:49- 58

Sauer N, Ludwig A, Knoblauch A, Rothe P, Gahrtz M, Klebl F (2004) AtSUC8 and AtSUC9 encode functional sucrose transporters, but the closely related AtSUC6 and AtSUC7 genes encode aberrant proteins in different Arabidopsis ecotypes. Plant J 40:120- 30

Sheen J, Zhou L, Jang JC (1999) Sugars as signaling molecules. Curr Opin Plant Biol 2:410-8

Smeekens S (1998) Sugar regulation of gene expression in plants. Curr Opin Plant Biol 1:230-4

Smeekens S (2000) Sugar-induced signal transduction in plants. Annu Rev Plant Physiol Plant Mol Biol 51 :49-81

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599 Tichtinsky G, Tavares R, Takvorian A, Schwebel-Dugué N, Twell D, Kreis M (1998) An

evolutionary conserved group of plant GSK-3/shaggy-like protein kinase genes preferentially expressed in developing pollen. Biochim Biophys Acta 1442 : 261-73

(24)

Truernit E, Schmid J, Epple P, Illig J, Sauer N (1996) The sink-specific and stress- regulated Arabidopsis STP4 gene: enhanced expression of a gene encoding a monosaccharide transporter by wounding, elicitors, and pathogen challenge. Plant Cell 8:

2169-2182

Vaughn MW, Harrington GN, Bush DR (2002) Sucrose-mediated transcriptional regulation of sucrose symporter activity in the phloem. Proc Natl Acad Sci USA 99: 10876–10880 Vert G, Chory J (2006) Downstream nuclear events in brassinosteroid signalling. Nature

441 : 96–100

Vignault C, Vachaud M, Cakir B, Glissant D, Dédaldechamp F, Buttner M, Atanassova R, Fleurat-Lessard P, Lemoine R, Delrot S (2005) VvHT1 encodes a monosaccharide transporter expressed in the conducting complex of the grape berry phloem. J Exp Bot 56:

1409–1418

Wieman HL, Wofford JA, Rathmell JC (2007) Cytokine stimulation promotes glucose uptake via phosphatidylinositol-3 kinase/Akt regulation of Glut 1 activity and trafficking.

Mol Biol Cell 18:1437-46

Wilson KS, Stoeva-Popova P, Dimaculangan D (2004) Characterization of LpSK6: a Lycopersicon group three GSK-3/SHAGGY-like protein kinase. Biotechnol Biotechnol Eq 18 : 20-26

Woodgett J R, Cohen P (1984) Multisite phosphorylation of glycogen synthase : molecular basis for the substrate specificity of glycogen synthase kinase-3 and casein kinase-II (glycogen synthase kinase-5). Biochim Biophys Acta 788: 339-347

Wormit A, Trentmann O, Feifer I, Lohr C, Tjaden J, Meyer S, Schmidt U, Martinoia E, Neuhaus HE (2006) Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport. Plant Cell 18:3476-90

Zhou L, Jang JC, Jones TL, Sheen J (1998) Glucose and ethylene signal transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc Natl Acad Sci USA 95 :10294–10299

LEGENDS TO FIGURES

Figure 1. Sequence alignment of VvSK1 with other GSK3 like PK from various plant species. Identical residues are shown in black, conserved residues in dark gray, and similar

23

(25)

residues in light gray. GeneBank accession numbers are as follows : VvSK1 (XP_0022721 12), ASK8 (At4g00720), PSK6 (AJ224164), NSK91 (AJ224163) and LsPK6 (AY575716). The sequence alignment was done by the Mcoffee program at http://tcoffee.vital-it.ch/cgi-bin/Tcoffee/tcoffee_cgi/index.cgi.

Figure 2. Phylogenetic relationship between GSK3 proteins from grape and Arabidopsis. A phylogenetic tree was constructed using MEGA version 4 (Tamura et al., 2007) using the Minimum Evolution method with 2.000 bootstrap replicates. Names and GenBank accession numbers are as follows: VvSK1 (XP_0022721 12, GSVIVT00026235001), VvSK2 (XP_002279596, GSVIVT0002 8178001), VvSK3 (XP_002280673, GSVIVT0002254400 1), VvSK4 (XP_002276754, GSVIVT000207 13001), VvSK5 (XP_002270455, GSVIVT00035848001), VvSK6 (XP_002281788, GSVIVT00018774001), VvSK7 (XP_002263398, GSVIVT00035285001), ASK1-alpha (At5g26751), ASK2-beta (At3g6 1160), ASK3 -gamma (At3g05 840), ASK4-delta (At 1 g57 870), ASK5-epsilon (At5g14640), ASK6-zeta (At2g30980), ASK7-BIN2-eta (At4g1 8710), ASK8-theta (At4g00720), ASK9-iota (At1g06390), and ASK1 0-kappa (At1g09840).

Figure 3. Analysis of VvSK1 expression in response to sugar and ABA treatments in CSB cells. A, RNA gel blot analysis of VvSK1 accumulation after different times of treatment with 58 mM sucrose. B, Semi-quantitative RT-PCR analysis of VvSK1 expression in response to 58 mM mannitol and 58 mM PEG treatment. The elongation factor VvEF1was used as an internal control. C, Effect of sugar analogs on VvSK1 accumulation determined by RNA gel blot 4h after treatment. Results are shown for: non treated control cells (C), and cells treated with 58 mM sucrose (S), 10 mM MHL (MHL), 58 mM sucrose + 10 mM MHL (SMHL), 58 mM 2-DOG (2-DOG) and, 58 mM 3-OMG (3-OMG). D, Quantitative RT-PCR of VvSK1 transcript accumulation after treatment with 20 1&M ABA. Elongation factor VvEF1and actin were used as internal controls. All data are means of three replicates from independent experiments, with error bars indicating SE.

Figure 4. Expression of VvSK1 in various tissues from cabernet sauvignon plants. Expression of VvSK1 mRNA was determined by semi-quantitative RT-PCR and elongation factor VvEF1was used as an internal control. A, VvSK1 expression in roots, stems, leaves, inflorescences and mature berries. B, Expression of VvSK1 in developing berries: 3 weeks (P3), 7 weeks (P7), 9 weeks (P9), 11 weeks (P11) and 15 weeks (P15) post-flowering. C,Downloaded on November 17, 2020. - Published by https://plantphysiol.org

(26)

Expression of VvSK1 in berry skin, pulp and seed at véraison stage. The experiment was repeated 3 times independently with similar results.

Figure 5. Characterization of transgenic cells over-expressing VvSK1. A, RT-PCR of control (PFB 8) and VvSK1 over-expressors (35 S: :VvSK1 -HA) detecting VvSK1 transcript.

Elongation factor VvEF1was used as an internal control. B, Protein extracts from cells overexpressing VvSK1-HA were separated and immunodetected using a specific HA antibody. C, GST-VvSK1 phosphorylates myelin basic protein (MBP) in vitro. Upper panel, Coomassie blue staining showing the recombinant protein; down panel, MBP phosphorylation by VvSK1.

Figure 6. Over-expression of VvSK1 modifies the transcription of some grape monosaccharide transporter genes. A, Quantitative RT-PCR analysis of monosaccharide transporters in control (PFB8, grey bars) and 35S:: VvSK1-HA (black bars) grape cells.

Expression levels of VvHTs were evaluated in transgenic 41B cells. B, Kinetic of expression of VvHT3 (^{K y}), VvHT4 (^•), VvHT5 (^A), and VvHT6 (⁰) assessed by quantitative RT-PCR using total RNA extracted from CSB cells treated with 58 mM sucrose. Elongation factor VvEF1was used as an internal control. All data are means of three replicates, with error bars indicating SE. The primer sequences are given in materials and methods.

Figure 7. Activity of the monosaccharide transport system in VvSK1 over-expressing cells. D- [14C]Glucose uptake was measured in control cells transformed with PFB8 empty vector (

A

⁾

and 35S:: VvSK1 cells (

•

). Cell aliquots were collected at different time periods (0, 0.5, 2, and 4h). Errors bars indicate SD. For this experiment, 6 independent flasks of 41 B cell suspension cultures for each condition were used and analyzed.

Figure 8. Sugar content of VvSK1 over-expressing cells. Left Y axis shows Glucose (grey bars) content and right Y axis shows sucrose (black bars) and starch (doted bars) contents.

Levels of sugars were analyzed in control cells (PFB8) and 35S:: VvSK1 transgenic cells, 7 days after subculture. Errors bars indicate SD. For this experiment, 3 independent flasks of 41 B cell suspension cultures for each condition were used and analyzed.

25

(27)

Figure 1. Sequence alignment of VvSK1 with other GSK3 like PK from various plant species. Identical residues are shown in black, conserved residues in dark gray, and similar residues in light gray. GeneBank accession numbers are as follows : VvSK1 (XP_002272112), ASK8 (At4g00720), PSK6 (AJ224164), NSK91 (AJ224163) and LsPK6 (AY575716). The sequence alignment was done by the Mcoffee program at http://tcoffee.vital-it.ch/cgi-bin/Tcoffee/tcoffee_cgi/index.cgi.

(28)

Figure 2. Phylogenetic relationship between GSK3 proteins from grape and Arabidopsis. A phylogenetic tree was constructed using MEGA version 4 (Tamura et al., 2007) using the Minimum Evolution method with 2.000 bootstrap replicates. Names and GenBank accession numbers are as follows: VvSK1 (XP_002272112, GSVIVT00026235001), VvSK2 (XP_002279596, GSVIVT00028178001), VvSK3 (XP_002280673, GSVIVT00022544001), VvSK4 (XP_002276754, GSVIVT00020713001), VvSK5 (XP_002270455, GSVIVT00035848001), VvSK6 (XP_002281788, GSVIVT00018774001), VvSK7 (XP_002263398, GSVIVT00035285001), ASK1-alpha (At5g26751), ASK2-beta (At3g61160), ASK3-gamma (At3g05840), ASK4-delta (At1g57870), ASK5-epsilon (At5g14640), ASK6-zeta (At2g30980), ASK7-BIN2-eta (At4g18710), ASK8-theta (At4g00720), ASK9-iota (At1g06390), and ASK10-kappa (At1g09840).

(29)

58 mM Sucrose VvSK1

0 1 2 4 6 8 h

r RNA

A

VvSK1 rRNA

C S MHL SMHL 2-DOG 3-OMG

B

C

D

VvSK1 VvEF1

α

VvSK1 VvEF1

α

0 1 2 4 6 8 h

58 mM mannitol

58 mM PEG

1.4 1.2 1 0.8 0.6 0.4 0.2 0

⁰

0,2 0,4 0,6 0,8 1 1,2 1,4

0 1 2 4 6 8 10

Time (h)

Relative expression level Relative expression level

Time (h)

Figure 3. Analysis of VvSK1 expression in response to sugar and ABA treatments in CSB cells. A, RNA gel blot analysis of VvSK1 accumulation after different times of treatment with 58 mM sucrose. B, Semi- quantitative RT-PCR analysis of VvSK1 expression in response to 58 mM mannitol and 58 mM PEG treatment. The elongation factor VvEF1α was used as an internal control. C, Effect of sugar analogs on VvSK1 accumulation determined by RNA gel blot 4h after treatment. Results are shown for: non treated control cells (C), and cells treated with 58 mM sucrose (S), 10 mM MHL (MHL), 58 mM sucrose + 10 mM MHL (SMHL), 58 mM 2-DOG (2-DOG) and, 58 mM 3-OMG (3-OMG). D, Kinetic of accumulation of VvSK1 transcript after treatment with 20 µM ABA analyzed by quantitative RT-PCR. Elongation factor VvEF1γ and actin were used as internal controls. All data are means of three replicates, with error bars indicating SE.

(30)

Mature berries

VvSK1

roots stems leaves Inflorescences

VvEF1

α

A

VvSK1 VvEF1

α

Green Véraison Ripening

P3 P7 P9 P11 P15

B

Véraison

Skin Pulp Seed VvEF1

α

VvSK1

C

Figure 4. Expression of VvSK1 in various tissues from cabernet sauvignon plants. Expression of VvSK1 mRNA was determined by semi-quantitative RT-PCR and elongation factor VvEF1α was used as an internal control. A, VvSK1 expression in roots, stems, leaves, inflorescences and mature berries. B, Expression of VvSK1 in developing berries: 3 weeks (P3), 7 weeks (P7), 9 weeks (P9), 11 weeks (P11) and 15 weeks (P15) post-flowering. C, Expression of VvSK1 in berry skin, pulp and seed at véraison stage. The experiment was repeated 3 times independently with similar results.

(31)

PFB8 35S::

VvSK1-HA

VvSK1 VvEF1

α

A

VvSK1-HA

B

VvSK1-GST

GST

MBP VvSK1-GST GST

C

MW marker

Figure 5. Characterization of transgenic cells over-expressing VvSK1. A, RT-PCR of control (PFB8) and VvSK1 over-expressors (35S::VvSK1-HA) detecting VvSK1 transcript. Elongation factor VvEF1α was used as an internal control. B, Protein extracts from cells overexpressing VvSK1-HA were separated and immunodetected using a specific HA antibody. C, GST-VvSK1 phosphorylates myelin basic protein (MBP) in vitro. Upper panel, Coomassie blue staining showing the recombinant protein; down panel, MBP phosphorylation by VvSK1.

(32)

A

B

0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6

0h 1h 2h 4h 6h 8h 10h

Time (h)

Relative expression level

1.6 1.4 1.2 1 0.8 0.6 0.4 0.2

Relative expression level 0

0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6

VvHT1 VvHT2 VvHT3 VvHT4 VvHT5 VvHT6 VvpGLT

Relative expression level Relative expression level

1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

Figure 6. Over-expression of VvSK1 modifies the transcription of some grape monosaccharide transporter genes. A, Quantitative RT-PCR analysis of monosaccharide transporters in control (PFB8, grey bars) and 35S::VvSK1-HA (black bars) grape cells. Expression levels of VvHTs were evaluated in transgenic 41B cells. B, Kinetic of expression of VvHT3 (), VvHT4 (), VvHT5 (), and VvHT6 () assessed by quantitative RT-PCR using total RNA extracted from CSB cells treated with 58 mM sucrose.

Elongation factor VvEF1γ and actin were used as internal controls. All data are means of three replicates, with error bars indicating SE. The primer sequences are given in materials and methods.Downloaded on November 17, 2020. - Published by https://plantphysiol.org

(33)

0 0.5 2 4 0

5 10 15 20 25 30 35 40 45

0 0,5 2 4

Time (h) nmol glucose g

-1

d.w nmol glucose g

-1

d.w

Time (h)

Figure 7. Activity of the monosaccharide transport system in VvSK1 over-expressing cells. D- [14C]Glucose uptake was measured in control cells transformed with PFB8 empty vector () and 35S::

VvSK1 cells (). Cell aliquots were collected at different time periods (0, 0.5, 2, and 4h). For this experiment, 6 independent flasks of 41 B cell suspension cultures for each condition were used and analyzed. Errors bars indicate SD.