• Aucun résultat trouvé

Hevea genetic transformation using a single-chain variable fragment (scFv) specific to cassiicolin, the causal agent of Corynespora leaf disease

N/A
N/A
Protected

Academic year: 2021

Partager "Hevea genetic transformation using a single-chain variable fragment (scFv) specific to cassiicolin, the causal agent of Corynespora leaf disease"

Copied!
1
0
0

Texte intégral

(1)

IRRDB Biotechnology Workshop 30 May – 1 June 2011

28

Hevea genetic transformation using a single-chain variable fragment (scFv) specific to cassiicolin, the causal agent of Corynespora leaf disease

E. Sunderasan1#, · Rusni A. Kadir2, · Valérie Pujade-Renaud3, ·Adeel Malik4, Badrul Ezam Badarudin1, H. Y. Yeang1, and · Sheila Nathan2

1. Biotechnology Unit, Malaysian Rubber Board, RRIM Research Station, 47000 Sungai Buloh, Selangor D.E.

2. Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43000 Bangi, Selangor D.E.

3. CIRAD TA 80/03, Avenue Agropolis 34398 Montpellier Cedex 5 France. 4. Biomedical Informatics Centre, PGIMER, Chandigarh-160012, India.

#

Corresponding author.

The pathogenic fungus Corynespora cassiicola a serious threat to rubber trees (Hevea

brasiliensis); the infected leaves develop necrotic lesions and abscise, leaving the tree

unproductive. The destructiveness of C. cassiicola has been largely attributed to cassiicolin, a secreted protein toxin of the fungus. Recombinant antibody technology coupled to genetic transformation offer hope to curtail the disease in Hevea. Single chain variable fragment (scFv) specific to cassiicolin could bind and deactivate the toxin in genetically modified rubber trees that harbour the functional antibody gene. A scFv phage library was constructed from cassiicolin immunized Balb/C mice spleen IgG heavy and light variable chains. Biopanning of the phage library yielded a scFv clone with high specificity to cassiicolin. Nucleotide sequence and deduced amino acid sequence information of the scFv were obtained. The hemagglutinin (HA) tagged scFv expressed in Escherichia coli is discerned as a band at circa 30 kDa on SDS-PAGE. The corresponding band was detected by anti-HA IgG on a Western immunoblot of the gel. Homology-based modelling was employed to create three-dimensional structures of the scFv antibody and cassiicolin, and binding (docking) of the antibody to the toxin antigen was simulated. Furthermore, deactivation of cassiicolin by the scFv was demonstrated by detached leaf bio-assay on selected susceptible Hevea clones. Efforts are underway to genetically transform Hevea clones with the cassiicolin-specific scFv gene to enhance resistance to Corynespora leaf disease.

Références

Documents relatifs

(1997) showed that the seasonal cycle of water vapour in the tropical lower stratosphere, which is due to the seasonal cycle of tropical tropopause temperatures (e.g. Mote et

cassiicola strain CCP , comparatively to others putative effectors, by comparing the wild-type strain and the same strain deleted for the cassiicolin-encoding

Session 4 Poster 87 Functional analysis of cassiicolin, effector of the rubber tree pathogen Corynespora cassiicola Sébastien Ribeiro 1,2 , Marine Déon 1,2 , Dinh Minh

To further evaluate the potential of this in vitro test in predicting rubber clones susceptibility to CLF, one should investigate whether sensitivity to culture filtrates or

Genetic transformation and regeneration of rubber tree (Hevea brasiliensis Muell. Arg) transgenic plants with a constitutive version of an anti-oxidative stress superoxide dismutase

ID Forward 5’-3’ Reverse 5’-3’. Esr1 TCCGGCACATGAGTAACAAA

Dans une ambiance d’un bleu laiteux, des figures en apesanteur semblent voler; elles ressemblent à des découpages collages détachés d’un catalogue.. Ces formes imaginaires

Objectif : La présente contribution vise, dans un pre- mier temps, à resituer la pharmacie clinique en France au sein des activités de la pharmacie hospitalière, à mettre en