Purification and characterization of SepII a new restriction endonuclease from Staphylococcus epidermidis

ContentslistsavailableatScienceDirect

Microbiological Research

jo u r n al h om e p a g e :w w w . e l s e v i e r . d e / m i c r e s

Purification and characterization of SepII a new restriction endonuclease from Staphylococcus epidermidis

Abdelkarim Belkebir

, Houssine Azeddoug

LaboratoiredeBiochimieetdeBiologieMoléculaire,FacultédesSciences,UniversitéHassanII-AinChock,Casablanca,km8,routed’ElJadidaBP.5366,Casablanca,Morocco

a r t i c l e i n f o

Articlehistory:

Received11October2010

Receivedinrevisedform15March2011 Accepted26March2011

Keywords:

SepII

Restrictionendonuclease Staphylococcusepidermidis TypeIIsystem

a b s t r a c t

ATypeIIrestrictionenzymeSepIIhasbeenpurifiedtoapparenthomogeneityfromthegram-positive coccus,Staphylococcusepidermidis.Thepurificationincludedanammoniumsulfateprecipitationfollowed byQ-sepharose,heparin-sepharoseandMonoQcolumnchromatographyonanFPLCsystem.SDS-PAGE analysisshowedadenaturedmolecularweightof29kDa.Theeffectsoftemperature,pH,NaCl,Mn²⁺,Ca²⁺, andMg²⁺ionconcentrationswerestudiedtodeterminetheoptimalreactionconditions.Theenzyme exhibitsnearmaximallevelsofactivitybetweenpH8–10,at10–20mMMgCl2,100–150mMNaCland 1mMDTT.TheresultsalsoshowthatinNEBBuffer3theenzymeisactiveoverabroadtemperaturerange from0to70^◦C,andintheabsenceofDNA,enzymethermostabilityisobservedupto50^◦Cfor20min, whilemostoftheoriginalactivityisconservedin50%glycerolforweeksatroomtemperature.Single anddoubledigestioninpresenceofcommercialrestrictionenzymesofknownDNAsubstrates(lambda, pBR322,pET21,pTrcHisB,pPB67)showedthatthepurifiedSepIIrecognizedandcleavedthesamesiteas EcoRV.GenomicDNAmodificationstatuswasalsodetermined.

© 2011 Elsevier GmbH. All rights reserved.

1. Introduction

Surviving is the principal directive for all living organisms either as individuals or as a species, one of the most challenges that bac- terial populations encountered is the phages attack. To prevent this dramatic end bacteria have developed restriction–modification (R–M) systems to destroy invading DNA (Bourniquel and Bickle 2002; Pingoud and Jeltsch 2001). Restriction modification systems are composed of two activities: a methyltransferase (Cheng 1995;

Jeltsch 2002) that modifies adenine or cytosine residues at certain recognition sites and a restriction endonuclease that recognizes and catalyzes double strand cleavage of the same sequence if it is unmodified (Pingoud and Jeltsch 1997, 2001). The restriction enzyme is not harmful to the host cell, because its DNA is protected from cleavage by methylation, but incoming DNA will be cleaved.

Usually cognate methylation of one strand alone is sufficient to pre- vent cleavage by the corresponding endonuclease. Thus, this will protect the cell’s own DNA during the synthesis of the new strand in the replication.

R–M systems are mainly classified into four types I, II, III and IV depending on the recognition sequence, cutting position, cleavage requirements and structure. Type II restriction enzymes produce

∗Correspondingauthor.

E-mailaddresses:[email protected](A.Belkebir), [email protected](H.Azeddoug).

double stranded DNA cleavage within or close the recognition sequence which consists of 4–8 defined nucleotides that can be symmetric, asymmetric, unique or degenerated (Roberts et al.

2003a). They require Mg

as a cofactor to catalyze DNA cleavage and specific fixation for some restriction enzymes (Pingoud et al.

2009). An estimated 25% of bacteria examined contain at least one restriction endonuclease (Williams 2001) and some strains may contain many restriction enzymes. Neisseria gonorrhaeae seems to be particularly rich in restriction endonucleases its genome encodes for 7 restriction enzymes and 16 methyltransferases (Stein et al. 1955). Genomic analysis of Helicobacter pylori 26,695 and J99 predicted 14–15 putative type II restriction endonucleases (Xu et al.

2000; Alm et al. 1999). Currently there are 3945 biochemically or genetically characterized restriction enzymes in REBASE with 299 distinct specificities and of the 3698 type II restriction enzymes, 641 are commercially available, including 262 distinct specifici- ties according to available data in REBASE (http://rebase.neb.com) (Roberts et al. 2010). In this paper, we describe isolation, purifica- tion procedure and biochemical properties of the type II restriction endonuclease SepII from Staphylococcus epidermidis.

2. Materialsandmethods

2.1. Bacterial strains, growth conditions, and reagents

All chemicals were reagent grade and were made up in Nanop- ure water and passed through a 0.2

m pore size filter. Lambda

doi:10.1016/j.micres.2011.03.005

DNA was purchased from Promega (Madison, WI). Commercial restriction enzymes, CIP phosphatase and T4 ligase were from New England Biolabs. AmpliTaq Gold DNA polymerase from Applied BioSystem (California, USA). Q-sepharose FF, heparin FF and MonoQ columns were from Pharmacia.

E. coli BL21 (

DE3) was used to prepare all plasmids used in this study as described elsewhere (Sambrook and Russell 2001).

Pure strains were isolated from human urine samples and screened for the presence of restriction activity. Bacteria were cultivated in LB medium at 37

C with vigorous aeration and the identifica- tion was made on the basis of morphological analyses, substrates utilization and degradation of biopolymers using Api Staph kit (BioMerieux, France). Genomic DNA was isolated and 500 bp long fragment of 16S rDNA was sequenced with the following primers 27f AGAGTTTGATCCTGGCTCAG and 519r GWATTACCGCG- GCKGCTG. Sequence homologies were searched in the BLASTN database (Basic Local Alignment Search Tool) of the National Centre for Biotechnology Information.

2.2. Screening for restriction endonuclease

Crude extract of 20 ml overnight grown cultures, were assayed for restriction endonucleases activity on unmethylated

DNA as a substrate. The digestion reaction was carried out at 37

C for 1 h in 30

l reaction mixture containing the following composition:

1

of NE Buffer 1, 2, 3, or 4, 0.1 mg/ml BSA, 1

g of lambda DNA and 1

l of crude extract. Reactions were stopped by the addition of ficoll gel loading dye, containing 0.1% (w/v) SDS, 10 mM EDTA, 10 mM Tris–HCl and aliquot of 25

l of each sample was loaded on 1% agarose gel.

2.3. Protein purification

12 l of LB medium was inoculated with a 1:100 dilution of an overnight culture of S. epidermidis and grown at 37

C with vig- orous aeration in a 16 l New Brunswick fermentor. The cells were harvested by centrifugation (10,000

g for 10 min) at the end of the log phase and the pellet was resuspended in storage buffer (50 mM Tris–HCl (pH 7.5), 10% (w/v) glucose) and frozen at

80

C. Thawed cells were resuspended in (50 mM Tris–HCl, pH 7.5, 25 mM EDTA, 25% sucrose, 0.3% Brij-35, 1 mM DTT) and disrupted by 15 cycles of sonication (Bronson Sonifier, USA) of 30 sec each with an interval of 1 min. After sonication, the slurry was centrifuged at 48,000

g for 90 min at 4

C to remove cellular debris. Cleared lysate was adjusted to 50 mM NaCl and 1.5% streptomycin sulfate and stirred at 4

C for 30 min before centrifugation at 34,000

g for 20 min to remove nucleic acids and total protein content was spectrophotometrically determined at 280 nm. Proteins in the supernatant were precipi- tated by the addition of the ammonium sulfate to 70%. The pellet formed after centrifugation at 34,000

g for 30 min was resus- pended in buffer B-100 (20 mM Tris–HCl (pH 7.5), 0.1 mM EDTA, 1 mM DTT, 100 mM NaCl) and dialyzed overnight against the same buffer at 4

C. the dialyzed sample was loaded onto a 30 ml Q- sepharose FF column, washed with buffer B-100 until the OD

absorbance reached the baseline then proteins were eluted with a linear NaCl gradient (100–800 mM; volume 300 ml). Fractions of 3 ml each were analyzed for the presence of restriction activity as described above and by SDS-PAGE.

Actives fractions, which eluted at 280–400 mM NaCl, were pooled and dialyzed overnight against buffer B-100 (20 mM Tris–HCl (pH 7.5), 0.1 mM EDTA, 1 mM DTT, 100 mM NaCl). Fol- lowing dialysis, the protein sample was loaded onto a 20 ml heparin FF column and proteins eluted with a linear NaCl gradi- ent (100–1200 mM; volume 200 ml). The fractions containing the active restriction endonuclease were eluted from the heparin col- umn at 750–900 mM NaCl.

The dialyzed enzyme was applied onto a 1 ml MonoQ 5/50 GL on an FPLC system and eluted with a linear NaCl gradi- ent (100–1200 mM; volume 20 ml). Clean restriction enzyme was eluted at 450–500 mM and dialyzed overnight against storage buffer (10 mM Tris–HCl, 1 mM EDTA, 100 mM NaCl, 50% glycerol).

Aliquots of homogeneous preparation of the enzyme were stored at

80

C.

2.4. Denaturing polyacrylamide gel electrophoresis

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described previously (Laemmli 1970) on one-dimensional 12% polyacrylamide slab gels containing 0.1% SDS. Columns fractions were loaded on the gel and proteins after electrophoresis were visualized by Coomassie Brilliant Blue staining and silver staining kit (Pierce) according to the manufac- turer’s instructions.

2.5. Recognition sequence determination of the purified restriction endonuclease

The recognition sequence of the purified endonuclease was inferred from restriction mapping of lambda DNA, pBR322, pET21, pTrcHisB and pPB67 plasmids. DNAs were digested into well defined fragments using SepII and double digestion reactions also were performed in the presence of a second restric- tion endonuclease (BamHI, BsaI, BglIII, EcoRV, MluI and NcoI), which permitted to locate SepII cleavage sites in these DNAs.

The sizes of the DNA fragments produced by digestion were entered into the REBpredictor program available into the web- site (http://tools.neb.com/REBpredictor/index.php) (Roberts et al.

2005), which predicts recognition sequences. The locations of these potential recognition sequences were compared with the sites mapped by double endonuclease digestions. Then, the fragments predicted by cleavage at the putative recognition sites were com- pared with the observed restriction fragments from SepII cleavage of the DNAs.

To confirm the predicted recognition sequence a 2 kb SepII frag- ment from pET21a plasmid was ligated into the EcoRV precut and dephosphorylated pTrcHisB. The ligation mixture was used to transform E. coli BL21 (

DE3) competent cells as described previously (Sambrook and Russell 2001). The junctions sites were identified after sequencing with the following primers 85F1 AATGAGGGCATCGTTCCCACTGC and 7R1 GCGAAAATCCT- GTTTGATGGTGG and comparing the sequence with both plasmids sequences.

2.6. Determination of genomic DNA modification status of S.

epidermidis

Digestion of genomic bacterial DNA from one single colony was used for determination of modification activities. The genomic DNA was prepared from overnight grown S. epidermidis by the enzymatic lysis method (Sambrook and Russell 2001). 1

g of purified DNA was digested for 2 h with 10 units of purified restriction enzyme SepII as well as commercially available isoschizomer and other restriction endonucleases with different specificities in optimal conditions.

2.7. Optimal conditions determination of SepII restriction activity

Influence of physicochemical parameters on the restriction

activity of SepII was determined at different temperatures, ionic

strength, pH, and Mg

ion concentrations. Since the enzyme

showed a high activity over broad reaction conditions, time point

measurement was performed to determine the accurate optimal

conditions. Different enzyme quantities were tested to determine a range of proteins showing a complete digestion in optimal condi- tions, and 1 unit is defined as the amount of enzyme to completely hydrolyze 1

g of lambda DNA at 37

C in 1 h in a volume of 30

l.

2.8. Effect of optimal pH and temperature dependent SepII restriction activity

To determine the optimal pH, digestion reactions were made over a pH range from 4 to 11.5 using different buffers with dif- ferent pK

(acetate, HEPES, MES, Tris, TAPS and sodium phosphate buffer) and adjusted to the same salt concentration. The reaction mixture contains 250 ng of pPB67 plasmid, 0.1 mg/m BSA, 10 mM Mg

, 100 mM NaCl and 1 mM DTT. The reaction was carried out at 0

C for 30 min. The optimal temperature was determined for the purified restriction enzyme by incubating the reaction at dif- ferent temperatures (0, 20, 37, 40, 50, 60, 70, 80

C) in a reaction mixture containing 1

NE Buffer 3, 250 ng of pPB67, 0.1 mg/ml BSA and 1 unit of enzyme. Thermostability was also determined by pre- incubating the enzyme at different temperatures (20, 37, 40, 50, 60, 70, 80

C) for 20 min in 1

NE Buffer 3 and reaction were started by adding 250 ng of pPB67 and 0.1 mg/m BSA.

2.9. Dependence of the restriction activity on the NaCl and divalent ions concentrations

Effect of NaCl was studied by incubating 1 unit of enzyme with 250 ng of pPB67 at different concentration of NaCl (0, 10, 20, 50, 100, 150, 200, 400, 500 mM). Divalent ion dependent DNA cleavage was essayed in the presence of Mn

, Ca

, and Mg

at various concentrations (0, 1, 2, 5, 10, 15, 20, 40, 50 mM). Reactions were carried out at 0

C for 30 minutes then, aliquot of each sample was loaded onto a 1% agarose gel and subjected to electrophoresis in TAE buffer (40 mM Tris–acetate (pH 9.0), 2 mM EDTA) at 700 V/h.

Gels were stained with ethidium bromide (0.5

g/ml) for 1 h and subsequently destained twice in water for 10 min. Destained gels were photographed using a DIGI-DOC gel documentation system (UVP, Inc.) and analyzed using ImageQuant v 5.0 software.

3. Result

Then strains were isolated from different human urine samples and screened for the presence of type II restriction endonucleases.

Only one strain indentified as S. epidermidis showed restriction activity on lambda DNA and the crude extract of this strain was found to be nuclease free. This enzyme was named SepII according to the suggested nomenclature rules (Roberts et al. 2003b).

3.1. Enzyme purification

A type II restriction enzyme named SepII was purified from the crude extract of S. epidermidis to electrophoretic homogeneity, the purification procedure included a 70% ammonium sulfate precipi- tation followed by a passage through Q-sepharose, HiPrep Heparin FF 16/10 and MonoQ 5/50 GL column. Purity of SepII was analyzed

Fig.1.ElectrophoreticanalysisofSepIIondifferentstagesofitspurification.Pro- teins(25␮g)ateachpurificationstepwereresolvedbySDS-PAGEandstainedwith CoomassieBrilliantBlue.Line1:molecularmarker,lane2:70%ammoniumsulfate precipitationfraction,line3:Q-sepharosecolumnfractionspool,line4:heparin columnfractionpool,line5:MonoQfraction(pureproteinpreparation).

by 12% SDS-PAGE which showed only one protein band of 29 kDa in the final enzyme preparation (Fig. 1). The specific activity was 500

10

U/mg of protein and the enzyme was purified 1449-fold with a recovery around 21% (Table 1).

3.2. Determination of the recognition sequence and genomic DNA modification status

To determine the recognition sequence, several Known DNAs were used as a substrate (lambda DNA, pBR322, pET21, pTrcHisB and pPB67 plasmids). The patterns of the well defined fragments from SepII-digested DNA were analyzed, using the REBpredictor program (Roberts et al. 2005), which predicted the recognition sequence GATATC. The sizes of digested fragments predicted cleav- age occurrence at the GATATC palindromic sites in each DNA substrate. Double digestion with commercial restriction enzymes is also in agreement with the predicated recognition sequence (Fig. 2).

Sequencing the recognition sequence revealed that SepII recog- nized the sequence 5

GAT

ATC3

, cleaved as shown with the arrow and produces blunt end product. Thus, we concluded that SepII is an isoschizomer of EcoRV.

The presence of methyltransferase activity was assayed by the resistance of genomic DNA to cleavage. S. epidermidis dis- played methylation protection against his endogenous restriction enzyme as well as commercially available isoschizomers, while

Table1

PurificationstepsofSepIIfromS.epidermidis.

Totalprotein(mg) Totalactivity(U×10³) Specificactivity(U/mg) Purificationfactor(fold) Yield(%)

Crudeextract 4488 1550 0.345×10³ 1 100

70%Ammoniumsulfate 496 1050 0.520×10³ 1.5 67.7

Q-sepharose 53 500 9.433×10³ 27.3 32.2

Heparin-sepharose 2.3 420 182.6×10³ 529 27

MonoQ 0.64 320 500×10³ 1449 20.6

Fig.2. DigestionprofileoflambdaDNAon1%agarosegel.Lines1and10are1kb DNAsizemarker,lane2:uncutlambdaDNA.Lines3,4,6,and8:lambdaDNA digestedwithSepII,EcorV,MluIandNcoIrespectively.Lines5,7and9:double digestionoflambdaDNAwithEcoRV,MluIandNcoIrespectivelyinthepresenceof SepII.

restriction endonucleases with different specificities showed a smearing pattern. This data indicated the existence of bacterial methyltransferase activity and confirmed the presence of a com- plete type II restriction–modification system.

Fig.3.Timecourseofcleavageactivity.SupercoiledpPB67DNA(250ng)wasincu- batedwith1unitofSepIIfordifferentperiodsoftimeandtheassaywasperformed asdescribed.Lane1:1kbDNAladder,lines2–10arerespectively0,0.5,1,2,5,10, 20,30,60min.OC:opencircle,FLL:fulllengthlinear,SC:supercoiledplasmid.

Fig.4.EffectoftemperatureontherestrictionactivityofSepII.Reactionwascar- riedoutatdifferenttemperatures.Lines1–9are0,20,37,40,50,60,70,80,90^◦C respectively.OC:opencircle,FLL:fulllengthlinear,SC:supercoiledplasmid.

Like other type II enzymes, SepII cleaves supercoiled plasmids (SC) with one single site in a sequential manner. First the cleav- age occurs in one strand to give the open circle (OC) form of the DNA then in the other strand, to give the full-length linear (FLL)

4 5 6 7 8 9 10 11 12

0 20 40 60 80 100

Reaction pH

% of activity

0 100 200 300 400 500

0 20 40 60 80 100

mM NaCl

% activity

10 20 30 40 50 60

0 50 100

mM Mg

Cl

% activity

Fig.5.BiochemicalpropertiesofSepII:(a)OptimalpHwasdeterminedbyestimating%activityatdifferentpHvalues(4–11.5)understandardassayconditions.(b)Effectof divalentmetalion(Mg²⁺)withvaryingconcentrationsfrom0to40mM.(c)OptimumionicstrengthforrestrictionactivitywasdeterminedbyvaryingNaClconcentration (0–500mM)inthereactionmixture.

form (Fig. 3). The cleavage of both strands is often faster than the dissociation of enzyme from the DNA (Gormley et al. 2000).

3.3. Optimal conditions for restriction activity

The optimal temperature for SepII enzyme was determined by carrying out reactions with constant amounts of pPB67 DNA (250 ng) and 1 unit of purified enzyme at different temperatures ranging from 0 to 90

C. The restriction activity was active over a broad temperature range from 0 to 70

C, while only 15% of activity was observed at 80

C (Fig. 4). In the absence of DNA, enzyme ther- mostability was observed up to 50

C for 20 min. The optimum pH was determined by calculating % of activity at different pH values ranging from 4 to 11.5 and results showed that pPB67 plasmid was linearized between pH 7 and 10 with a maximal level of activity at pH 8.0 (Fig. 5).

3.4. Effect of ions on the activity of SepII

The effect of ionic strength on restriction activity of SepII was estimated by varying the NaCl concentrations from 0 to 400 mM.

The enzyme was active between 0 and 200 mM NaCl and exhibit- ing maximal activity level at 100 mM NaCl. Endonuclease activity was also carried out in the presence of different divalent cations such as Mg

, Mn

and Zn

. SepII showed maximal activity with 10–15 mM Mg

(Fig. 5), while no detectable activity was observed with any other divalent ions used.

4. Discussion

A large number of restriction–modification systems have been discovered and well characterized during the past few decades, they occur ubiquitously among bacteria and their phages (Roberts et al. 2003a). Different methods can been used to detect R–M sys- tems, classical bacteriophage efficiency of plating (EOP) assay is a simple method to detect restriction enzymes. However, phages from many bacterial strains have not yet been isolated and antire- striction systems, present in many phages, can mask the presence of R-M systems. A good alternative method to screen for type II restriction endonucleases involves incubation of cell extracts with known DNA substrates. However, several strains show high level of nuclease activity which requires additional steps to remove con- taminating activity (Williams 2001).

In this work a type II restriction endonuclease named SepII was isolated from S. epidermidis. The enzyme was purified after pas- sage through Q-sepharose, heparin-sepharose and MonoQ column.

Purity and molecular weight of the enzyme were determined by 12% SDS-PAGE which revealed one single band of 29 kDa. The size of this protein is in the range typical for type II endonucleases (Wilson and Murray 1991). This enzyme was free from any nonspe- cific nucleases as evidenced by restriction analysis of different DNA.

SepII showed restriction activity over broad reaction conditions, the enzyme was functional at temperature varying from 0 to 70

C and maximal activity level was obtained at 30–50

C. thermostabil- ity was also investigated and showed that the enzyme has a high stability and conserve most of the original activity when stored at room temperature for weeks. Type II restriction enzymes are known to require Mg

ions as a cofactor for DNA hydrolysis (Cowan 2004), It is evident that divalent ions play a major role in phosphodi- ester bond cleavages however, it is still unclear what function such cations have in hydrolysis and why only one is needed in some cases

and two in others (Fothergill et al. 1995). In our case SepII effectively cleaves DNA in the presence of 10 mM Mg

. NaCl was also required for restriction activity and the enzyme was fully active in 100 mM NaCl. When compared with EcoRV, SepII showed similar properties such as thermostability, pH and ions requirements. However crude extract of S. epidermidis was nuclease free. Several DNA subtracts were used to determine the recognition sequence of this enzyme. As expected, fragments observed experimentally after single and dou- ble digestions with different enzymes (BamHI, BsaI, BglIII, EcoRV, MluI and NcoI) were in close agreement with computer-generated fragments. Sequencing indicates that SepII recognizes and cleaves 5

GAT

ATC3

and is a new isoschizomer of EcoRV.

Acknowledgments

This work was supported by the (Programme thématique d’Appui à la Recherche Scientifique-Morocco, no. 3) and the cen- tre national de recherche scientifique et technique. The authors are grateful to Dr. Driss mountassif and Bennani Mohamed for their help in bacterial identification.

References

AlmRA,LingLS,MoirDT,KingBL,BrownED,DoigPC,etal.Genomic-sequence comparisonoftwounrelatedisolatesofthehumangastricpathogenHelicobacter pylori.Nature1999;397:176–80.

BourniquelAA,BickleTA. Complexrestrictionenzymes:NTP-drivenmolecular motors.Biochimie2002;84(11):1047–59.

ChengX.StructureandfunctionofDNAmethyltransferases.AnnuRevBiophys BiomolStruct1995;24:293–318.

CowanJA.RoleofmetalionsinpromotingDNAbindingandcleavagebyrestric- tionendonucleases.In:PingoudA,editor.Restrictionendonucleases.Berlin:

Springer;2004.p.339–60.

FothergillM,GoodmanMF,PetruskaJ,WarshelA.Structure–energyanalysisofthe roleofmetalionsinphosphodiesterbondhydrolysisbyDNApolymeraseI.JAm ChemSoc1995;117:11619–27.

GormleyNA,Bath AJ,Halford SE.Reactions ofBglI andothertype IIrestric- tion endonucleases with discontinuous recognition sites. J Biol Chem 2000;275(10):6928–36.

JeltschA.BeyondWatsonandCrick:DNAmethylationandmolecularenzymology ofDNAmethyltransferases.Chembiochem2002;3(4):274–93.

LaemmliUK.Cleavageofstructuralproteinsduringtheassemblyoftheheadof bacteriophageT4.Nature1970;227(5259):680–5.

PingoudA,JeltschA.RecognitionandcleavageofDNAbytype-IIrestrictionendonu- cleases.EurJBiochem1997;246(1):1–22.

PingoudA,JeltschA.StructureandfunctionoftypeIIrestrictionendonucleases.

NucleicAcidsRes2001;29(18):3705–27.

PingoudV,WendeW,FriedhoffP,ReuterM,AlvesJ,JeltschA,etal.Onthedivalent metaliondependenceofDNAcleavagebyrestrictionendonucleasesoftheEcoRI family.JMolBiol2009;393(1):140–60.

RobertsRJ,BelfortM,BestorT,BhagwatAS,BickleTA,BitinaiteJ,etal.Anomencla- tureforrestrictionenzymes.DNAmethyltransferases,homingendonucleases andtheirgenes.NucleicAcidsRes2003a;31(7):1805–12.

RobertsRJ,VinczeT,PosfaiJ,MacelisD.REBASE:restrictionenzymesandmethyl- transferases.NucleicAcidsRes2003b;31(1):418–20.

RobertsRJ,VinczeT,PosfaiJ,MacelisD.REBASE–adatabaseforDNArestriction andmodification:enzymes,genesandgenomes.NucleicAcidsRes2010;38:

D234–6.

RobertsRJ,VinczeT,PosfaiJ,MacelisD.REBASE–restrictionenzymesandDNA methyltransferases.NucleicAcidsRes2005;3:D230–2.

SambrookJ,RussellDW.Molecularcloning:alaboratorymanual.3rded.NewYork:

ColdSpringHarborLaboratoryPress;2001.

SteinDC,GunnJS,RadlinskaM,PiekarowiczA.Restrictionandmodificationsystems ofNeisseriagonorrhoeae.Gene1955;157:19–22.

WilliamsRJ.Isolationandcharacterizationofanunknownrestrictionendonuclease.

MethodsMolBiol2001;160:431–42.

WilsonGG,MurrayNE.Restrictionandmodificationsystems.AnnuRevGenet 1991;25:585–627.

XuQ, Stickel S,Roberts RJ,Blaser MJ,Morgan RD.Purification ofthe novel endonuclease.Hpy188I,andcloningofitsrestriction-modificationgenesreveal evidenceofitshorizontaltransfertotheHelicobacterpylorigenome.JBiolChem 2000;275(22):17086–93.