www.elsevier.com / locate / cardiores www.elsevier.nl / locate / cardiores
Effects of interleukin-10 on monocyte / endothelial cell adhesion and MMP-9 / TIMP-1 secretion
a,c b c a
El Mostafa Mtairag , Sylvie Chollet-Martin , Mounia Oudghiri , Nathalie Laquay ,
a a a ,
*
Marie-Paule Jacob , Jean-Baptiste Michel , Laurent J. Feldman
aU460 INSERM, X. Bichat School of Medicine, Paris, France
bImmunology Department and U479 INSERM, Bichat Hospital, Paris, France
cHassan II University, School of Sciences Ain chok, Department of Biology, Casablanca, Morocco Received 20 June 2000; accepted 8 November 2000
Abstract
Objective: Monocyte adhesion to endothelial cells and subsequent secretion of matrix metalloproteinases (MMPs) by activated macrophages are key events in arteriosclerosis and restenosis. We tested the hypothesis that interleukin-10 (IL-10), a potent anti- inflammatory cytokine, inhibits monocyte-endothelial cell interactions. Methods: The effect of IL-10 on monocyte / endothelial cell adhesion, as well as on the expression of MMP-9 and the tissue inhibitor of MMP-9, TIMP-1, were first tested in vitro in coculture systems. In addition, we used an ex vivo binding assay to study the inhibitory effect of IL-10 on monocyte adhesion to carotid arteries obtained from either normal, orL-nitro arginine-methyl ester (L-NAME)-treated rats. The effect of IL-10 on the expression of monocyte adhesion molecules (CD18 and CD62-L) was studied by flow cytometry. Results: IL-10 (150 ng / ml) inhibits monocyte adhesion to endothelial cells (by 35%) and to carotid arteries (by 40 and 50%, in normal and L-NAME-treated rats, respectively), via direct modulation of the expression of CD18 and CD62-L. Moreover, IL-10 dose-dependently decreases MMP-9 activity and increases TIMP-1 levels in coculture systems, both at the transcriptional level. Conclusions: Our results suggest that IL-10 is an important modulator of monocyte–endothelial cell interactions. 2001 Elsevier Science B.V. All rights reserved.
Keywords: Atherosclerosis; Cell culture / isolation; Cytokines; Leukocytes
1. Introduction
group of zinc-dependent neutral endoproteases able to
hydrolyze all the components of the ECM [6]. Increased Monocyte adhesion to endothelial cells, plays a crucial MMP secretion may facilitate migration of inflammatory role in the pathogenesis of arteriosclerosis and restenosis cells into the intima [7–10]. In particular, MMP-9 is [1]. Recruited monocytes transform into activated macro- expressed in the most symptomatic coronary artery lesions phages, which synthesize various pro-inflammatory cyto- [9], but not in the normal arterial wall [11]. MMP-9 kines and modulate extracellular matrix (ECM) turnover activity is inhibited when MMP-9 binds to its tissue [2]. For example, macrophage infiltration of the athero- inhibitor TIMP-1, which preserves the extracellular matrix sclerotic plaque is associated with an increased risk of homeostasis in the arterial wall. An imbalance between plaque rupture [3], the principal cause of acute coronary MMPs and TIMPs is likely to participate in atherogenesis syndromes [4]. Conversely, suppression of monocyte [6].
adhesion to endothelial cells may be protective [5]. The role of monocyte adhesion and the MMP/ TIMP Migration of monocytes in the subendothelial space balance in vascular disease is best studied by experimental requires protease expression and activity. MMPs are a models, in which a direct contact between monocytes and endothelial cells is used to induce monocyte activation.
This can be performed in vitro, as well as ex vivo, using
*Corresponding author. Tel.: 133-1-4485-6160; fax: 133-1-4485- 6157.
E-mail address: [email protected] (L.J. Feldman). Time for primary review 23 days.
0008-6363 / 01 / $ – see front matter 2001 Elsevier Science B.V. All rights reserved.
P I I : S 0 0 0 8 - 6 3 6 3 ( 0 0 ) 0 0 2 8 7 - X
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
monocyte / endothelial cell coculture [12] and monocyte / incubated for 18, 24 or 48 h. At each time point, culture whole artery culture [13] systems, respectively. medium was collected and centrifuged at 400 g for 5 min Interleukin-10 (IL-10) is a potent anti-inflammatory to eliminate nonadherent cells, then subjected to SDS–
cytokine, which inhibits the synthesis of pro-inflammatory PAGE gelatin zymography, Western blot analysis, or cytokines by activated monocytes. IL-10 was shown to ELISA. In all experiments, protein concentrations in reduce the adhesiveness of monocytes to stimulated endo- culture media were determined using the Bradford assay thelial cells in vitro [14,15], via an inhibitory effect on (Bio-Rad), and equal amounts of protein were used for endothelial cell adhesion molecules ICAM-1 and VCAM-1 each sample.
[14]. In addition, IL-10 knock-out mice develop severe
atherosclerosis in response to hypercholesterolemia 2.3. In vitro binding assays [15,16], and systemic administration of recombinant IL-10
prevents intimal hyperplasia after stent implantation in MM6 were fluorescently labeled with 0.75
ml / mlhypercholesterolemic rabbits [17]. In the latter case, the PKH2-GL (Green Fluorescent Cell Linker Kit, Sigma) for protective effect of IL-10 was mediated by a dramatic 10 min at room temperature and washed twice.
decrease in macrophage infiltration of the injured arterial Fluorescent MM6 (5.10 cells) were seeded onto con-
5wall [17]. Furthermore, IL-10 inhibits MMP-9 expression fluent HUVEC, with or without recombinant human IL-10 and enhances the production of TIMP-1 in human mono- (kindly supplied by Schering-Plough Research Institute,
cytes [18]. Kenilworth, NJ), then incubated at 378C for 24 h. Increas-
The aims of the present study were: (1) To determine ing IL-10 concentrations (50, 100, 150 ng / ml; n53 the effects of pharmacological concentrations of IL-10 on experiments for each concentration) were tested. Cocul- monocyte / endothelial cell adhesion, in vitro, as well as on tures were washed four times, and fluorescence was monocyte / arterial wall adhesion ex vivo; and (2) To counted with a spectrofluorimeter (Fluo-star) at 480 nm examine the effects of IL-10 on the MMP-9 / TIMP-1 excitation and 510 nm emission. In additional experiments, balance in monocyte–endothelial cell coculture systems. HUVEC were pre-treated with identical concentrations of IL-10 for 30 min (n53 experiments for each concen- tration), then washed and incubated with fluorescent MM6.
2. Methods
Results were expressed as a percentage of the fluorescence
measured in 5.10 MM6.
52.1. Cell cultures
2.4. Ex vivo binding assays Peripheral blood monocytes were obtained from healthy
donors by phlebotomy. Monocytes were purified by All experimental protocols were performed in accord- Ficoll–Hypaque gradient centrifugation (Pharmacia Fine ance with the recommendations of the French Accredita- Chemicals), then isolated by adherence to plastic at 378C tion of Laboratory Animal Care (authorization N8 00577).
for 1 h in the presence of RPMI 1640 medium (BioMedia), Male Wistar rats (Iffa Credo) weighing 120–130 g were as described [19]. In these conditions, adherent cells used. One group (control, n512) was fed a normal diet.
contained
.95% monocytes [20].The second group received the nitric oxide suppressor Mono Mac6 (MM6), a human monocytic cell line with
L-nitro arginine-methyl ester (
L-NAME) in the drinking characteristics of mature monocytes [21], were cultured in water (50 mg / kg / day for 8 weeks, n512). We have shown RPMI 1640, containing 10% fetal calf serum (FCS), 1% that this regimen induces chronic hypertension [23] and PSA (50 UI / ml Penicillin, 50
mg / ml Streptomycin, 25increases ex vivo adhesion of monocytes to the endo-
mg / ml Amphotericin) and 2 mmol / lL-glutamine (all from thelium [24]. Rats were euthanized by pentobarbital over-
Sigma). dose, and both carotid arteries were excised and used for
Human umbilical vein endothelial cells (HUVEC) were ex vivo monocyte binding assays. MM6 in HBSS buffer harvested and cultured, as described [22]. At confluency, were fluorescently labeled with 0.75
ml / ml PKH26-GLcells were trypsinized then transferred to 24-well cluster (Red Fluorescent Cell Linker Kit, Sigma), preincubated plates. In all experiments, endothelial cells were used at with or without IL-10 (50, 100, 150 ng / ml) for 30 min, second or third passage. then seeded on carotid arteries (endothelial side up), with or without LPS (1
mg / ml). After 30 min incubation,2.2. Cocultures carotid arteries were washed with HBSS and adherent
MM6 were counted as described [24]. For each experimen- Two culture systems were studied. In the first system, 1 tal condition, n54 carotid arteries were studied.
ml of medium containing 5.10
5MM6 was seeded onto
confluent HUVEC in serum-free RPMI 1640. In the 2.5. MM6 adhesion molecule expression second, MM6 were cultured in a 1 ml conditioned medium
obtained from serum-free HUVEC cultures. Cultures were Five hundred
ml of 10 / ml MM6 in HBSS were either6by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
left on ice or preincubated with IL-10 (150 ng / ml) or recommended by the manufacturer and 100-ng cDNA HBSS at 378C for 30 min before cell stimulation with LPS templates were amplified. The primers used to measure (1
mg / ml) for an additional 30 min at 378C (n53IL-10 receptor (IL-10R, 25 PCR cycles), MMP-9 (26 experiments).
b2 integrin and L-selectin expressions were cycles), TIMP-1 (22 cycles) and GAPDH (18 cycles) quantified using FITC-conjugated antibodies directed mRNA levels are listed in Table 1. Semiquantitative against CD18 (Becton Dickinson) and CD62-L (Immuno- analyses were performed using
g-ATP- P-radiolabeled33tech coultronics), respectively. Non-specific binding was primers. Results of n53 experiments are expressed in determined with isotypic control antibodies. After a 30 arbitrary units and adjusted for GAPDH mRNA levels.
min-incubation on ice, cells were washed with HBSS,
resuspended in 1% paraformaldehyde and immediately 2.10. Statistical analysis analyzed by flow cytometry (FACScan, Becton Dickin-
son). Results were expressed as median fluorescence Data are presented as mean6S.D. Comparisons were intensity (MFI), as described [25]. performed by one-way ANOVA followed by a Fisher test, when appropriate. When two parameters may have in- 2.6. SDS–PAGE zymography fluenced MMP-9 / TIMP-1 expression – i.e., incubation time, culture system, or IL-10 treatment – a two-way Gelatinolytic activities in cell culture media were mea- ANOVA was performed to test the effect of each parameter sured as described [26]. Each sample was loaded with 5
mgand their interaction on MMP-9 / TIMP-1 expression. A of protein. Results of n53 experiments are expressed as value of P,0.05 was considered statistically significant.
percentage of gelatinolytic activity in unstimulated mono- cytes. To discriminate between MMP and serine protease
activity, additional gels prepared in presence of inhibitors
3. Resultsof MMPs (EDTA 30 mmol / l) or serine proteases (Pefab-
loc 2 mmol / l), were loaded with the same protein tem- 3.1. Effect of IL-10 on in vitro monocyte adhesion plates and electrophoresed in parallel. Monocytes stimu-
lated with phorbol-12 myristate-13 acetate (PMA, 10 ng / The presence of IL-10R on MM6 was demonstrated by ml) for 18 or 24 h were used as positive controls for RT-PCR analysis (data not shown). In MM6 / HUVEC
MMP-9 activity. cocultures, 150 ng / ml IL-10 (but not lower IL-10 con-
centrations) significantly reduced MM6 adhesion to
2.7. Western blot HUVEC from 60 to 40% after 24 h incubation (Fig. 1).
Pre-treatment of HUVEC with IL-10 for 30 min had no Standard procedures were used [27]. MMP-9 was de- effect on MM6 / HUVEC adhesion.
tected in cell culture media (n54 experiments) using an
anti-MMP-9 antibody (Ab-1, Calbiochem; 1:2000 dilu- 3.2. Effect of IL-10 on ex vivo monocyte adhesion tion). Gels were exposed to X-ray films, and quantification
of the autoradiograms was performed by densitometric Non-stimulated MM6 adhered weakly to rat carotid scanning using the NIH Image 1.61 software. arteries (Fig. 2). After a LPS challenge, the number of adherent MM6 increased by
|10-fold, but only by
|6-fold
2.8. ELISA in presence of IL-10.
L
-NAME treatment for 8 weeks induced a significant TIMP-1 levels were measured in culture media by increase in systolic blood pressure (211615 vs. 146610 ELISA (BiotrakE TIMP-1, Amersham). mmHg, P,0.05). The number of adherent MM6 to the carotid artery of
L-NAME-treated rats increased by
|4-
2.9. RT-PCR fold, but only by
|2-fold in presence of IL-10 (Fig. 2).
Preincubation of carotid arteries (from normal or
L- Total RNA was extracted from MM6 and HUVEC using NAME-treated rats) with IL-10 did not significantly alter TRIzolE (Life Technologies), and reverse transcribed as the number of adherent MM6 (data not shown).
Table 1
Nucleotide sequences of the primers used for PCR
mRNA Sense primer Antisense primer
IL-1OR 59CTCACCACAACTCCAGAAAGC39 59AGAGAAGGCAACCCAAGAGACAGG39
MMP-9 59GGCGCTCATGTACCCTATGT39 59TCA AAG ACC GAG TCC AGC TT39
TIMP-1 59CCTGTGTCCCACCCCACCCAC39 59TGTAGGTCTTGGTGAAGCCCC39
GAPDH 59TGACCCCTTCATTGACCTCAACTAC39 59AAAGTTGTCATGGATGACCTTGG39
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
Table 2
Effect of IL-10 on the expression ofb2 integrin (CD18) andL-selectin (CD62-L) in LPS-stimulated MM6a
Anti CD18 (MFI) Anti CD-62L (MFI)
Baseline 4463 56610
LPS (1mg / ml) 10664* 561*
† †
LPS1IL-10 (150 ng / ml) 3064 50610
aMFI, median of fluorescence intensity; n53 experiments.
* P,0.001 vs. baseline.
†P,0.001 vs. LPS.
Fig. 1. Effect of IL-10 on MM6 / HUVEC adhesion in vitro. Bar graph
3.4. Effect of MM6 /HUVEC interaction on MMP-9
representing spontaneous adhesion of MM6 to HUVEC monolayers for
secretion
24 h, in the absence or presence of increasing concentrations of IL-10.
Results of n53 experiments are expressed as percentage of total MM6.
In these experiments, both freshly isolated human
At 150 ng / ml, IL-10 reduces significantly MM6 adhesion to HUVEC. *,
P,0.05 vs. no IL-10. Lower IL-10 concentrations had no effect on
monocytes and MM6 were used. Stimulation of MM6 with
MM6 / HUVEC adhesion.
PMA (10 ng / ml) resulted in
|4- and
|9-fold increase in
MMP-9 activity at 18 and 24 h, respectively (Fig. 3A, lanes 8 and 9), and served as positive controls. Similar 3.3. IL-10-induced modulation of adhesion molecule results were obtained with human monocytes (data not
expression by MM6
shown).
MM6 / HUVEC and monocyte / HUVEC cocultures, as As shown in Table 2, MM6 expressed CD18 and CD62- well as incubation of MM6 and monocytes with HUVEC- L at baseline. After LPS stimulation, CD18 expression conditioned medium, time-dependently increased MMP-9 increased
|2.5-fold and CD62-L expression decreased activity (two-way ANOVA: P,0.05), with a greater effect
|
11-fold, as expected [25]. In contrast, the expressions of of cocultures (Fig. 3). There was no interaction between CD18 and CD62-L were not significantly different from the effects of time and culture systems on MMP-9 activity the baseline when MM6 were preincubated with IL-10 (interaction term P50.5). In contrast, incubation of
before LPS stimulation. HUVEC with MM6 and monocyte-conditioned medium
Fig. 2. Effect of IL-10 on ex vivo adhesion. A–C: LPS-stimulated MM6 adhesion to rat carotid arteries. A, Non-stimulated MM6 (red fluorescence) adhere weakly to the luminal aspect of carotid arteries from control rats; B, LPS stimulation of MM6 at a concentration of 1mg / ml for 30 min, results in massive adhesion to the arterial wall; C, This effect is partially reversed by IL-10 (150 ng / ml); D, Bar graph showing that IL-10 (150 ng / ml) partially reversed this effect; E, Bar graph showing that MM6 adhesion is markedly increased inL-NAME-treated rats. In presence of IL-10 (150 ng / ml), this effect is partially reversed. Bar graphs show the results of n54 experiments. *, P,0.05.
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
Fig. 3. Effect of MM6 / HUVEC interactions on MMP-9 activity. A, Representative gelatinolytic activities detected by SDS–PAGE zymography in cell culture media. Gelatinolytic activities at 92 kDa (pro-MMP-9) and 72 kDa (pro-MMP-2) were detected. Lane 1: MM6 alone, 48 h incubation; Lanes 2–4:
MM6 / HUVEC coculture for 18, 24 and 48 h, respectively; Lanes 5–7: culture of MM6 in HUVEC-conditioned medium for 18, 24 and 48 h, respectively;
Lanes 8 and 9: PMA (10 ng / ml) stimulation of MM6 for 18 and 24 h, respectively. B, Graph indicating time-dependent percent increase of MMP-9 activity (over MM6 and monocytes alone), in MM6 / HUVEC and monocyte / HUVEC cocultures (black and white diamonds, respectively), and MM6 and monocytes cultured in HUVEC-conditioned medium (black and white squares, respectively). n53 experiments. *, P,0.05 vs. 18 h; †, P,0.05 vs. 24 h; ‡, P,0.05 vs. MM6 and monocytes cultured in HUVEC-conditioned medium.
had no effect on MMP-9 activity (data not shown). MMP-2 IL-10 increased significantly TIMP-1 levels in MM6 and activity remained unaffected. monocytes, but not in HUVEC. In MM6 / HUVEC and monocyte / HUVEC cocultures, as well as in cultures of 3.5. Effect of IL-10 on MMP-9 in coculture systems MM6 and monocytes in HUVEC-conditioned medium for 24 h, the high TIMP-1 levels were further increased by IL-10 reduced by
|50% (two-way ANOVA: P,0.05) IL-10 (two-way ANOVA: P,0.05). The effect of IL-10 on MMP-9 activity induced either by MM6 / HUVEC and TIMP-1 was independent of the culture system (interaction monocyte / HUVEC cocultures or cultures of MM6 and term: P50.5).
monocytes in HUVEC-conditioned medium for 24 h (Fig.
4A and B). In addition, Western blot analyses indicated a
similar reduction in MMP-9 protein levels in both systems 3.7. Dose-effect of IL-10 on MMP-9 and TIMP-1 in (Fig. 4C and D). The effect of IL-10 on MMP-9 was
MM6 /HUVEC coculturesindependent of the culture system (interaction term: P5
0.6). Zymography analyses (Fig. 6A) indicated that the
Addition of IL-10 to MM6 and monocytes reduced by inhibitory effect of IL-10 on MMP-9 activity in MM6 /
|
25% basal MMP-9 activity, whereas IL-10 did not affect HUVEC cocultures was dose-dependent (one-way MMP-9 activity in HUVEC (data not shown). ANOVA, P,0.01), with maximal MMP-9 inhibition at 150 ng / ml for 24 h incubation. IL-10 also stimulated 3.6. Effect of IL-10 on TIMP-1 TIMP-1 secretion in a dose-dependent manner (one-way
ANOVA, P,0.01; Fig. 6A).
Basal levels of TIMP-1 were detected by ELISA, both in To investigate whether IL-10 modulates MMP-9 and MM6-, monocyte- and HUVEC-conditioned medium. TIMP-1 gene expression, we performed RT-PCR analyses.
MM6 / HUVEC and monocyte / HUVEC cocultures for 24 Basal MMP-9 mRNA levels were found in MM6, but not h, as well as culture of MM6 and monocytes in HUVEC- in HUVEC. MMP-9 mRNA levels increased by
|3-fold in conditioned medium, significantly increased TIMP-1 levels MM6 / HUVEC cocultures (Fig. 6B). Addition of IL-10
(Fig. 5). resulted in a dose-dependent decrease in MMP-9 expres-
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
Fig. 4. Effect of IL-10 on MMP-9 activity and protein levels. A and C: Representative gelatinolytic activities at 92 kDa (pro-MMP-9) detected by SDS–PAGE zymography (A) and Western blot analysis of MMP-9 protein levels (C) after 24 h incubation. Lane 1: MM6 alone; Lanes 2 and 3:
MM6 / HUVEC coculture without and with IL-10 (100 ng / ml), respectively; Lanes 4 and 5: MM6 cultured in HUVEC-conditioned medium (HUVEC-CM) without and with IL-10 (100 ng / ml), respectively. B and D: Bar graphs showing MMP-9 activity (B) and protein levels (D), in MM6 / HUVEC and monocyte / HUVEC cocultures and MM6 and monocytes cultured in HUVEC-CM. n54 experiments. *, P,0.05 vs. MM6 / HUVEC and monocyte / HUVEC cocultures without IL-10; †, P,0.05 vs. MM6 and monocytes cultured in HUVEC-CM without IL-10. Black bars, MM6; Hatched bars, isolated human monocytes. Results are expressed as percent increase over MM6 (or human monocytes) alone.
sion (one-way ANOVA, P,0.01), which returned to baseline levels for IL-10 concentrations
$50 ng / ml.TIMP-1 mRNA levels were
|4-fold higher in MM6 / HUVEC cocultures than in MM6 (Fig. 6B). IL-10 further increased TIMP-1 mRNA levels in MM6 / HUVEC cocul- tures in a dose-dependent manner (one-way ANOVA, P, 0.01).
4. Discussion
In the present study, we have demonstrated that IL-10 inhibits monocyte / endothelial cell interactions at two levels. First, IL-10 reduces the adhesion of monocytes to endothelial cells in vitro and to the arterial wall ex vivo.
Second, IL-10 regulates the MMP-9 / TIMP-1 balance at the transcriptional level, with lower MMP-9 activity and higher TIMP-1 protein levels in IL-10-treated monocyte / endothelial cell cocultures.
Fig. 5. Effect of IL-10 on TIMP-1 protein levels. MM6 (black bars) and
isolated human monocytes (hatched bars) were cocultured with HUVEC
IL-10 is a potent anti-inflammatory cytokine, with
or in HUVEC-conditioned medium (HUVEC-CM) without and with
protective effects against atherosclerosis [15,16] and post-
IL-10 (100 ng / ml) for 24 h. TIMP-1 production was quantified by
injury intimal hyperplasia [17]. The mechanisms of IL-10
ELISA. n53 experiments. *, P,0.05 vs. MM6 and monocytes alone; †,
vasculoprotective effect [15–17,28], however, remain un-
P,0.05 vs. MM6 / HUVEC and monocyte / HUVEC cocultures without
clear. IL-10 expression is found in the most unstable
IL-10; ‡, P,0.05 vs. MM6 and monocytes cultured in HUVEC-CM
without IL-10.
atherosclerotic plaques in humans, and colocalizes with
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
cells, may be involved in this protective effect. Important- ly, acute – LPS activation – or chronic –
L-NAME treatment [24,27] – inflammatory stimuli were included in the design of these ex vivo experiments, in order to mimic the inflammatory reaction associated with severe arterio- sclerosis. The
|50% inhibitory effect of IL-10 on ex vivo monocyte adhesion to the arterial wall suggests that the anti-inflammatory effect of IL-10 on the arterial wall may operate in vivo, as well. It is unlikely that the high concentrations of IL-10 required to inhibit monocyte–
endothelial cell adhesion in vitro and ex vivo (150 ng / ml) may be achieved spontaneously in the vicinity of the atherosclerotic plaque in vivo. However, such high con- centrations of IL-10 have been measured in live animals after systemic injections of IL-10 [17]. Therefore, our results may be relevant to the pharmacological modulation of arterial inflammation by IL-10, which has been demon- strated both in established atherosclerotic plaques [28] as well as in in-stent restenosis [17]. The results of these ex vivo binding assays should be interpreted cautiously since the interaction between the human monocytic cell line MM6 and rat carotid arteries may not fully replicate the
Fig. 6. Dose effect of IL-10 on MMP-9 and TIMP-1. A: MMP-9 activity
adhesion of human monocytes to human arteries. In
(gelatin zymography) and TIMP-1 secretion (ELISA). Results are ex-
addition, a direct inhibitory effect of IL-10 on the arterial
pressed as percent increase over MM6 alone. B: MMP-9 and TIMP-1
wall cannot be ruled out by our ex vivo experiments, since
mRNA levels. MM6 / HUVEC cocultures were treated with increasing
the effect of human IL-10 on rat carotid arteries may be
concentrations of IL-10 (10–150 ng / ml) for 24 h. Results are normalized
‘sub-optimal’ due to species specificity.
to GAPDH mRNA levels. n53 experiments. One-way ANOVA analyses
indicated a dose-dependent effect of IL-10 on each tested parameter.
Our data suggest that, in addition to its effect on cell
Black bars, MMP-9; Hatched bars, TIMP-1.
adhesion, IL-10 profoundly modulates the MMP-9 / TIMP- 1 balance. IL-10 is a known inhibitor of MMP-9 and plaque areas showing low-grade inflammation [28]. More- activator of TIMP-1 in LPS-stimulated monocytes [18].
over, transgenic expression of IL-10 reverses [16] or However, the influence of IL-10 on the MMP-9 / TIMP-1 prevents [15] the development of atherosclerosis in hy- balance has never been investigated in monocyte / endo- perlipidemic IL-10 knock-out mice. More recently, we thelial cell coculture systems, which recapitulate more demonstrated that IL-10 inhibits macrophage infiltration closely the process of monocyte activation associated with after stent implantation in hypercholesterolemic rabbits the first stage of atherogenesis. Overall, both MMP-9 [17], resulting in a dramatic reduction of intimal growth. activity and TIMP-1 levels increased in monocyte / Altogether, these results suggest a direct anti-inflammatory HUVEC cocultures. IL-10 reduced MMP-9 activity and effect of IL-10 on the arterial wall in vivo, but do not increased TIMP-1 levels in this system, suggesting that provide a mechanistic insight on IL-10 effects on the IL-10 modulates the protease–antiprotease balance in- interaction between inflammatory and vascular cells. volved in the penetration of inflammatory cells within the Data on the impact of IL-10 on monocyte / endothelial arterial wall. Interestingly, MMP-9 activity and TIMP-1 cell adhesion are scarce. In previous studies, protracted levels also increased in monocytes cultured in HUVEC- (.5 h) pre-treatment of endothelial cells with pharmaco- conditioned medium, suggesting that direct monocyte / logical concentrations of IL-10 were shown to dose-depen- endothelial cell contact is not mandatory for MMP-9 / dently reduce the adhesion of monocytes to stimulated TIMP-1 activation in monocytes. Rather, a soluble factor endothelial cells in vitro [14,15]. In contrast with these may be released by endothelial cells to stimulate MMP-9 / previous studies, no effect of IL-10 on MM6 / HUVEC TIMP-1 expression in monocytes [12]. In addition, the adhesion was observed in the present study after a brief inhibitory effect of IL-10 on MMP-9, as well as the (30 min) pre-treatment of HUVEC with IL-10. Further- stimulatory effect of IL-10 on TIMP-1, were of similar more, in ex vivo binding assays, pre-treatment of MM6, magnitude in monocyte / HUVEC cocultures versus mono- but not of carotid arteries, with IL-10 inhibited MM6 cytes cultured in HUVEC-conditioned medium. Hence, adhesion to the arterial wall, suggesting a direct effect of monocytes are likely the principal cellular target of IL-10 IL-10 on MM6. Flow cytometry analysis suggest that both in our coculture system. Finally, our findings that the the downregulation of
b2 integrins (CD18) and theeffects of IL-10 on the MMP-9 / TIMP-1 balance are prevention of
L-selectin (CD62-L) shedding in monocytic similar when MM6 or freshly isolated human monocytes
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
G, Humphries S. Localization of stromelysin gene expression in
are used, indicate that these effects are not specific to the
atherosclerotic plaques by in situ hybridization. Proc Natl Acad Sci
transformed MM6 cell line.
USA 1991;88:8154–8158.
Overall, our data provide two distinct mechanisms – i.e.,
[8] Galis ZS, Sukhova GK, Lark MW, Libby P. Increased expression ofinhibition of monocyte adhesion and modulation of MMP-
matrix metalloproteinases and matrix degrading activity in vulner-9 / TIMP-1 balance – which may be relevant for the
able regions of human atherosclerotic plaques. J Clin Invest 1994;94:2493–2503.protective effect of IL-10, at pharmacological dosage,
[9] Brown DL, Hibbs MS, Kearney M, Loushin C, Isner JM. Identifica-
against inflammatory vascular diseases, e.g., atherosclero-
tion of 92-kD gelatinase in human coronary atherosclerotic lesions.
sis [16] and restenosis [17]. By reducing monocyte recruit-
Association of active enzyme synthesis with unstable angina.ment in the arterial wall, IL-10 may limit the inflammatory
Circulation 1995;91:2125–2131.burden of the plaque, the main cellular component associ-
[10] Sukhova GK, Schonbeck U, Rabkin E, Schoen FJ, Poole AR, Billinghurst RC, Libby P. Evidence for increased collagenolysis byated with plaque vulnerability [4,29], as well as the
interstitial collagenases-1 and -3 in vulnerable human atheromatous
exaggerated intimal hyperplasia after angioplasty [30]. In
plaques. Circulation 1999;99:2503–2509.
addition, IL-10-induced modulation of the MMP-9 / TIMP-
[11] Vine N, Powell JT. Metalloproteinases in degenerative aortic
1 balance towards reduced MMP-9 and increased TIMP-1
disease. Clin Sci (Colch) 1991;81:233–239.expressions, is likely to prevent excessive extracellular
[12] Amorino GP, Hoover RL. Interactions of monocytic cells with human endothelial cells stimulate monocytic metalloproteinasematrix degradation [31], a deleterious biological event
production. Am J Pathol 1998;152:199–207.
implicated in plaque rupture [10], as well as intimal growth
[13] Tsao PS, McEvoy LM, Drexler H, Butcher EC, Cooke JP. Enhanced
[32]. It must be underscore, however, that these potentially
endothelial adhesiveness in hypercholesterolemia is attenuated by
protective effects of IL-10, even at the highest concen-
L-arginine. Circulation 1994;89:2176–2182.trations, were only partial. Their clinical relevance is
[14] Krakauer T. IL-10 inhibits the adhesion of leukocytic cells to IL-1-activated human endothelial cells. Immunol Lett 1995;45:61–therefore uncertain.
In conclusion, the present study demonstrates that the
65.[15] Pinderski Oslund LJ, Hedrick CC, Olvera T, Hagenbaugh A, Territo
anti-inflammatory cytokine IL-10 is a potent inhibitor of
M, Berliner JA, Fyfe AI. Interleukin-10 blocks atherosclerotic
monocyte / endothelial cell interactions. Both the reduction
events in vitro and in vivo. Arterioscler Thromb Vasc Biolin monocyte adhesion to endothelial cells and the favorable
1999;19:2847–2853.modulation of the MMP-9 / TIMP-1 balance induced by
[16] Mallat Z, Besnard S, Duriez M, Deleuze V, Emmanuel F, Bureau MF, Soubrier F, Esposito B, Duez H, Fievet C, Staels B, DuvergerIL-10, may participate to the protective effect of IL-10
N, Scherman D, Tedgui A. Protective role of interleukin-10 in
against arteriosclerosis and restenosis.
atherosclerosis. Circ Res 1999;85:e17–e24.
[17] Feldman LJ, Aguirre L, Ziol M, Bridou JP, Nevo N, Michel JB, Steg PG. Interleukin-10 inhibits intimal hyperplasia after angioplasty or stent implantation in hypercholesterolemic rabbits. Circulation
Acknowledgements
2000;101:908–916.
[18] Lacraz S, Nicod LP, Chicheportiche R, Welgus HG, Dayer JM.
The authors are grateful to Alexandre Lebeaut, MD
IL-10 inhibits metalloproteinase and stimulates TIMP-1 production(Schering-Plough, Kenilworth, NJ), for providing recombi-
in human mononuclear phagocytes. J Clin Invest 1995;96:2304–2310.
nant human IL-10. This study was supported in part by
[19] Freundlich B, Avdalovic N. Use of gelatin / plasma coated flasks for
grants from the Fondation de l’Avenir (ET6-167) and the
isolating human peripheral blood monocytes. J Immunol Methods
Fondation de France (97003880 and 98004139).
1983;62:31–37.[20] Tucker S, Pierre R, Jordon R. Rapid identification of monocytes in mixed mononuclear preparations. J Immunol Methods 1977;14:267–
References [21] Ziegler-Heitbrock HW, Thiel E, Futterer A, Herzog V, Wirtz A,269.
Riethmuller G. Establishment of a human cell line (Mono Mac 6) [1] Ross R. Mechanisms of disease: atherosclerosis – an inflammatory with characteristics of mature monocytes. Int J Cancer
disease. N Engl J Med 1999;340:115–126. 1988;41:456–461.
[2] Welgus HG, Campbell EJ, Bar-Shavit Z, Senior RM, Teitelbaum [22] Minter AJ, Dawes J, Chesterman CN. Effects of heparin and SL. Human alveolar macrophages produce a fibroblast-like collagen- endothelial cell growth supplement on haemostatic functions of ase and collagenase inhibitor. J Clin Invest 1985;76:219–224. vascular endothelium. Thromb Haemost 1992;67:718–723.
[3] van der Wal AC, Becker AE, van der Loos CM, Das PK. Site of [23] Arnal JF, Warin L, Michel JB. Determinants of aortic cyclic intimal rupture or erosion of thrombosed coronary atherosclerotic guanosine monophosphate in hypertension induced by chronic plaques is characterized by an inflammatory process irrespective of inhibition of nitric oxide synthase. J Clin Invest 1992;90:647–652.
the dominant plaque morphology. Circulation 1994;89:36–44. [24] Gonzalez W, Fontaine V, Pueyo ME, Laquay N, Messika-Zeitoun D, [4] Libby P. Molecular bases of the acute coronary syndromes. Circula- Philippe M, Arnal JF, Jacob MP, Michel JB. Molecular plasticity of tion 1995;91:2844–2850. vascular wall during N -nitro methyl ester-induced hypertension.G
[5] Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion Modulation of proinflammatory signals. Hypertension 2000;36:103–
formation in CCR22/2mice reveals a role for chemokines in the 109.
¨
initiation of atherosclerosis. Nature 1998;394:894–897. [25] Taıeb J, Mathurin P, Elbim C, Cluzel P, Arce-Vicioso M, Bernard B, [6] Dollery CM, McEwan JR, Henney AM. Matrix metalloproteinases Opolon P, Gougerot-Pocidalo MA, Poynard T, Chollet-Martin S.
and cardiovascular disease. Circ Res 1995;77:863–868. Blood neutrophil functions and cytokine release in severe alcoholic [7] Henney AM, Wakeley PR, Davies MJ, Foster K, Hembry R, Murphy hepatitis: effect of corticosteroids. J Hepatol 2000;32:579–586.
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from
[26] Badier-Commander C, Verbeuren T, Lebard C, Michel JB, Jacob of coronary artery disease and the acute coronary syndromes MP. Increased TIMP/ MMP ratio in varicose veins: a possible (Second part). N Engl J Med 1992;326:310–318.
explanation for extracellular matrix accumulation. J Pathol [30] Moreno PR, Bernardi VH, Lopez-Cuellar J, Newell JB, McMellon
2000;192:105–112. C, Gold HK, Palacios IF, Fuster V, Fallon JT. Macrophage infiltra-
[27] Luvara G, Pueyo ME, Philippe M, Mandet C, Savoie F, Henrion D, tion predicts restenosis after coronary intervention in patients with Michel JB. Chronic blockade of NO synthase activity induces a unstable angina. Circulation 1996;94:3098–3102.
proinflammatory phenotype in the arterial wall: prevention by [31] Zaltsman AB, George SJ, Newby AC. Increased secretion of tissue angiotensin II antagonism. Arterioscler Thromb Vasc Biol inhibitors of metalloproteinases 1 and 2 from the aortas of choles-
1998;18:1408–1416. terol fed rabbits partially counterbalances increased metalloprotein-
[28] Mallat Z, Heymes C, Ohan J, Faggin E, Leseche G, Tedgui A. ase activity. Arterioscler Thromb Vasc Biol 1999;19:1700–1707.
Expression of interleukin-10 in advanced human atherosclerotic [32] Forough R, Koyama N, Hasenstab D, Lea H, Clowes M, Nikkari ST, plaques: relation to inducible nitric oxide synthase expression and Clowes AW. Overexpression of tissue inhibitor of matrix cell death. Arterioscler Thromb Vasc Biol 1999;19:611–616. metalloproteinase-1 inhibits vascular smooth muscle cell functions [29] Fuster V, Badimon L, Badimon JJ, Chesebro JH. The pathogenesis in vitro and in vivo. Circ Res 1996;79:812–820.
by guest on February 1, 2016http://cardiovascres.oxfordjournals.org/Downloaded from