HAL Id: hal-01229902
https://hal.sorbonne-universite.fr/hal-01229902
Submitted on 17 Nov 2015HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
Differential expression of interleukin-17 and
interleukin-22 in inflamed and non-inflamed synovium
from osteoarthritis patients
C. Deligne, S. Casulli, A. Pigenet, C. Bougault, L. Campillo-Gimenez, G.
Nourissat, F. Berenbaum, C. Elbim, X. Houard
To cite this version:
C. Deligne, S. Casulli, A. Pigenet, C. Bougault, L. Campillo-Gimenez, et al.. Differential expression of interleukin-17 and interleukin-22 in inflamed and non-inflamed synovium from osteoarthritis patients. Osteoarthritis and Cartilage, Elsevier, 2015, 23 (11), pp.1843-1852. �10.1016/j.joca.2014.12.007�. �hal-01229902�
1
Differential expression of interleukin-17 and interleukin-22 in inflamed and
non-inflamed synovium from osteoarthritis patients
Claire Deligne1, 2, 3, Sarah Casulli1, 2, Audrey Pigenet1, 2, 3, Carole Bougault1, 2, 3, Laure
Campillo-Gimenez1, 2, Geoffroy Nourissat 1, 2, 3, 4, Francis Berenbaum1, 2, 3, 5 ‡, Carole Elbim1, 2* and Xavier Houard1, 2, 3*
1 Sorbonne University, UPMC Univ Paris 06, UMR_S 938, F-75005, Paris, France 2 INSERM UMR_S938, UPMC, Univ Paris 06, F-75012, Paris, France
3 Inflammation–Immunopathology–Biotherapy Department (DHU i2B), 184 rue du Faubourg
Saint-Antoine, F-75012 Paris, France
4 Department of Orthopaedic Surgery and Traumatology, Assistance Publique – Hôpitaux de
Paris, Saint-Antoine Hospital, 184 rue du Faubourg Saint-Antoine, F-75012 Paris, France
5 Department of Rheumatology, Assistance Publique – Hôpitaux de Paris, Saint-Antoine
Hospital, 184 rue du Faubourg Saint-Antoine, F-75012 Paris, France Running title: IL-17 and -22 in human OA synovitis
Word count: 3776
* contributed equally
‡ Address for correspondence:
Francis Berenbaum, MD, PhD.
UMR_S938 “Metabolism and Age-associated joint diseases” Université Pierre et Marie Curie,
7, quai Saint-Bernard 75252 Paris Cedex 5 France
2 ABSTRACT
Objective. Synovitis associated with osteoarthritis (OA) is directly responsible for several
clinical symptoms and reflects OA’s structural progression. This study sought to analyze the expression of proinflammatory mediations, including IL-17 and IL-22, which play key roles in regulating inflammatory processes, in inflamed and non-inflamed areas of osteoarthritic synovium.
Methods: synovium from knees of 32 OA patients were collected at surgery. Macroscopic
evaluation of inflammation enabled inflamed and non-inflamed areas to be separated. Samples were incubated to obtain tissue-conditioned media. Quantitative mRNA expression of proinflammatory mediators was analyzed by RT-PCR and protein levels by ELISA and gelatin zymography. Immunohistochemistry and histology were performed.
Results. Inflamed synovium were characterized by increased leukocyte infiltration and a
higher vessel-to-tissue area ratio than non-inflamed tissues. Macrophages, T and B
lymphocytes, and some neutrophils were found only in the inflamed tissue, and only in the subintimal layer. Levels of proinflammatory cytokines and MMP-9 were significantly higher in tissue-conditioned media from inflamed than non-inflamed tissues. Inflamed areas were associated with higher expression of IL-17 and IL-22, both correlated with the combined release of IL-6, IL-23, and TGFβ1.
Conclusion. Our results showed that inflammatory cytokines, including IL-17 and IL-22, are
expressed at higher levels by inflamed OA synovium and suggest IL-22 involvement in OA pathophysiology. This study will help identify new therapeutic strategies for OA, especially the targeting of IL-22 to decrease inflammation.
Key words: osteoarthritis, synovial inflammation, IL-17, IL-22 Abbreviations:
FLS: fibroblast-like synoviocytes; IL: interkeukin; MPO: myeloperoxidase; MMP:
metalloproteinase; OA: osteoarthritis; PsA: psoriatic arthritis; RA: rheumatoid arthritis; TGF: transforming growth factor; TNF: tumor necrosis factor
3 INTRODUCTION
Osteoarthritis (OA), one of the most common rheumatic disorders, is a degenerative
joint disease characterized by cartilage breakdown, the formation of bony outgrowths at joint margins (osteophytes), subchondral bone sclerosis, impairments of the joint capsule and inflammation of the synovium 1, 2. The latter results in synovitis, which is directly responsible
for several clinical symptoms and mirrors OA’s structural progression. Hence treatments that specifically target this previously neglected component of OA could help to prevent or reduce both the symptoms and structural changes of OA. Synovitis in OA is not uniform and diffuse, but appears to be anatomically restricted and to vary in intensity3. Neither OA’s etiology nor
its pathophysiology is well understood, but it is believed that secreted inflammatory molecules (such as proinflammatory cytokines) are among the critical mediators of the pathophysiological processes. Nonetheless, the differential release of proinflammatory cytokines by inflamed and non-inflamed areas, as defined by histological characteristics, has never been investigated, although Lambert et al. recently showed the differential mRNA expression of several inflammatory cytokines by cultures of fibroblast-like synoviocytes (FLS) isolated from inflamed and normal/reactive OA synovium 4.
Interleukin (IL)-1β and tumor necrosis factor (TNF)-α are two major cytokines known
to be involved in OA pathogenesis. Both can also stimulate chondrocytes and synovial cells to produce other potent proinflammatory cytokines, including IL-6 and IL-8, as well as matrix metalloproteinases (MMPs) and prostaglandin E2
5. All of these are thought to diffuse into the
synovial fluid and act on the cartilage matrix and chondrocytes.
IL-17, produced mainly by IL-17-secreting CD4+ cells (called Th17), is also reported
to be closely associated with OA pathogenesis 6-12. IL-17 is defined by its ability to induce the
expression of proinflammatory cytokines and inflammatory chemokines and is a critical mediator in neutrophil recruitment, migration and activation.
IL-22 is secreted mainly by Th17 cells, but also by special immune cell populations,
including Th22, Th1, classical and non-classical (NK-22) NK cells, NKT cells, and lymphoid tissue inducer cells13. IL-22 belongs to the IL-10 superfamily of cytokines and signals through
a heterodimeric receptor complex composed of the IL-22R1 and IL-10R2 chains14. Unlike the
IL-10R2 chain, which is ubiquitous, IL-22R1 is expressed only by non-immune cells13,
including joint FLS15. The main biological functions of IL-22 are to increase innate immunity,
protect against damage, and enhance regeneration16-19. The role of IL-22 in inflammatory
disorders is still controversial, and both protective and highly pathogenic functions have been described20,22,23. Constitutive expression of IL-22 in FLS from OA patients has recently been
reported21.
The aim of our study was thus to analyze the differential expression of IL-22 in
inflamed and non-inflamed areas of synovium from OA patients. At the same time, we evaluated the expression of IL-17 and various other proinflammatory cytokines, especially those involved in the emergence of IL-22+ cells (IL-1β, IL-6, IL-18, IL-23 and TGF-β1) and
MMPs. We also investigated associations between these indicators and the histological grade of the corresponding inflammatory processes.
MATERIAL AND METHODS
MaterialsHuman osteoarthritic knee samples (n = 32) were obtained from the orthopedics department of Saint-Antoine Hospital, Paris, as surgical waste. Informed consent was
obtained before surgery. Experiments using human samples have been approved by a French Institutional Review Board (Comité de Protection des Personnes Ile de France V). The investigation complied with the principles outlined in the Declaration of Helsinki. Patients
4
(75.8% of women) were 70.3±9.8 years (range 54-88). Inflamed areas of the synovium were isolated from adjacent non-inflamed areas after macroscopic evaluation of inflammation, defined as hypervascularized areas with hypertrophic and hyperemic villi (Fig. 1A, a and e)4, 22. The remaining synovial tissue was considered non-inflamed. Synovium from both types of
areas was cut into small pieces (~1 mm3) and incubated (6 mL/mg wet tissue) for 24 hours at
37°C in RPMI-1640 culture medium containing 1% L-glutamine, 1% penicillin, and streptomycin without serum, as previously described23. At the end of the incubation period,
tissue samples were stored at -80°C and tissue-conditioned medium samples were centrifuged at 3000 g for 5 minutes. Aliquots of supernatant were stored at -80°C. Fresh tissue samples for gene expression analysis were immediately frozen in liquid nitrogen after dissection and stored at -80°C until RNA extraction.
Histology and immunohistochemistry
Pieces of the inflamed and the non-inflamed area of each synovium sample (n = 20) were fixed for 48 hours in 3.7% paraformaldehyde at 4°C. Samples were embedded in
paraffin and serially sectioned (5 μm). Tissue morphology was evaluated by hematoxylineosin
staining. Immunohistochemistry was performed with mouse monoclonal antibodies
(mAb) to CD31 (PECAM, JC70A, Dako), CD45 (leukocytes, clone 2B11+PD7/26, Dako), CD3 (T lymphocytes, clone F7.2.38, Dako), CD15 (neutrophils, clone H198, eBiosciences), CD20 (B-lymphocytes, clone L26, Dako) and CD68 (macrophages, clone PG-M1, Dako) as primary antibodies and a peroxidase Dako LSAB+ kit for detection. Irrelevant control
antibodies (Dako) were applied at the same concentration to assess non-specific staining. Sections were counterstained with Mayer’s hematoxylin.
Morphometric analysis
After the endothelial cells were immunostained with anti-CD31 mAb and the areas
quantified with MultiGauge V3.O software (Fujifilm), the ratio of vessel-to-tissue area was calculated. Leukocyte infiltrates were quantified on slices immunostained with anti-CD45 mAb. Each cluster of 4-5 CD45-positive cells was numbered. Synovium were histologically graded according to the scale established by Haywood et al.24: 0 = normal (synovial lining < 4
cells thick, sparse cellular distribution, with few or no inflammatory cells), 1 = mild
inflammation (synovial lining 4 or 5 cells thick, increased cellularity with some inflammatory cells), 2 = moderate inflammation (synovial lining 6 or 7 cells thick, dense cellularity with inflammatory cells but no lymphoid aggregates), 3 = severe inflammation (synovial lining > 7 cells thick, dense cellularity and inflammatory cell infiltration, may contain perivascular lymphoid aggregates).
Zymography
Gelatin zymography was performed as previously described25. Samples were loaded
onto 8% SDS/PAGE gels containing bovine skin gelatin (1.2 mg/mL). After electrophoresis, SDS was removed by two 1-h washes in 12.5 mM Tris/HCl, pH 7.4, 2.5% Triton X- 100, followed by one 30-min wash in a buffer containing 50 mM Tris/HCl, pH 7.4, 100 mM NaCl, and 5 mM CaCl2. The washed samples were then incubated overnight at 37°C in the same
buffer. Lysis bands were revealed by Coomassie brilliant blue R-250 staining. Gelatinase activity was quantified by densitometry with MultiGauge V3.O software (Fujifilm).
Measurement of cytokine levels in synovial membrane-conditioned media
Biochemical analysis of synovium-conditioned media for the known proinflammatory
5
6, IL-8 and TNF-α (Sankin Pelikine); IL-17, IL-22 and IL-23 (eBiosciences); IL-18 (MBL) and TGFβ1 (R&D Systems)].
RNA extraction, reverse transcription and real-time quantitative PCR
Total RNA was extracted with the RNeasy mini kit (Qiagen, Courtaboeuf, France), including a DNase digestion step (RNasefree DNase set, Qiagen), according to the manufacturer’s instructions. Total RNA (0.3 to 1 μg) was reverse-transcribed with the Omniscript kit (Qiagen) in a final volume of 20 μL containing 50 ng of oligodT; cDNA was quantified by real-time quantitative PCR with LC480 Light Cycler Real Time PCR (Roche Diagnostics, Meylan, France). PCR reactions were performed with Go Taq qPCR Master Mix (Promega, Charbonnières-les-Bains, France), under the following PCR amplification
conditions: initial denaturation for 5 min at 95 °C followed by 40 cycles consisting of 10 s at 95 °C, 15 s at 60°C and 10 s at 72°C. Product formation was detected at 72°C in the
fluorescein isothiocyanate channel. The generation of specific PCR products was confirmed by melting-curve analysis. For each PCR, cDNAs were run simultaneously in duplicate with serial dilutions of a cDNA mixture tested for each primer pair to generate a standard linear curve, which was used to estimate amplification efficiency. Relative quantities of eachdetermined by the E-method (efficiency) method of LightCycler 480 software. The following specific oligonucleotide primers were used: IL-17A, sense
5’CCTATAAGCAAAACAAAGCATGTC3’ and anti-sense
5’CGAGAACTTGGAATTTTGGGTA3’; IL-22, sense 5’TTCTCTTGGCCCTCTTGGTA3’ and
anti-sense 5’GCTGCTGGAAGTTGGACTTG3’ and human GAPDH, sense 5’CCATCACCATCTTCCA3’ and anti-sense 5’CCTTCTCCATGGTGGT3’.
Statistical analysis
Paired Wilcoxon non-parametric tests (Statview software, version 4.57) were used to compare the results for inflamed and non-inflamed OA synovium from the same sample. Correlations were established with Spearman’s rank test. Statistical significance was defined as P < 0.05.
RESULTS
Histological evaluation of inflamed and non-inflamed OA synovium
Macroscopic evaluation of osteoarthritic synovium showed tissue heterogeneity, with inflammatory areas characterized by hypervascularized areas containing hypertrophic and hyperemic villi, and adjacent areas showing no apparent signs of inflammation (Fig. 1A, a and e). Consistent with the description by Ayral et al.22, the non-inflamed areas appeared reactive
with a proliferation of opaque villi of normal morphology or somewhat more thick and squat. Loss of translucency prevented visualization of the vascular network22. Non-inflamed areas
could also show a normal appearance, with few translucent and slender villi22, although they
originated from diseased tissues.
Microvessels were localized in the subintimal layer of synovium as revealed by CD31- positive immunostaining (Fig.1A, b and f). In inflamed areas, microvessels appeared larger than those found in non inflamed areas. This result was confirmed by the quantification of the area occupied by vessels (Fig.1B). A 2.4-fold increase in vessel area / tissue area was
measured in inflamed as compared to non inflamed areas (p = 0.009), consistent with the hyperemic appearance of inflamed synovium.
The histological changes that occurred in inflamed areas also included hypertrophy
and hyperplasia, with an increase in the number of cells lining the synovium. These changes were accompanied by the infiltration of scattered foci of leukocytes (CD45+ cells) in the
6
subintimal layer (Fig. 1A, g). The number of leukocyte infiltrates was significantly greater in inflamed than in non-inflamed tissues (P = 0.001) (Fig. 1C). Leukocyte infiltration and the ratio of the vessel-to-tissue area were positively correlated (ρ = 0.726, P = 0.006) (Fig.1D); this finding underlines that their hyperemic appearance distinguishes inflamed OA synovium from non-inflamed tissues.
In inflamed tissues, leukocytes preferentially accumulated within the subintimal layer (Fig. 1A, g). In particular, we observed aggregates of T (CD3+) and B (CD20+) lymphocytes
and macrophages (CD68+ cells) (Fig. 2 e-g). Some neutrophils (CD15+ cells) were also
detected (Fig. 2h). In contrast, in the non-inflamed areas, leukocytes were localized in the intimal layer (Fig. 1A, c) and were exclusively represented by macrophages, as revealed by CD68-positive immunostaining (Fig. 2a). However, CD68-positive immunostaining was weaker in non-inflamed compared with inflamed synovium (Fig. 2 a and e). We did not observe the presence of either neutrophils or T or B lymphocytes (Fig. 2 b-d).
Higher release of myeloperoxidase and MMP-9 by inflamed osteoarthritic synovium
We next sought to characterize the biochemical features corresponding to these
histological findings, by assessing two markers of inflammation — myeloperoxidase (MPO) and MMP-9 — in inflamed and non-inflamed OA synovium. MPO was detected in tissueconditioned
media from both types of tissues (Fig. 3A), but significantly higher levels were
released by the inflamed ones (Fig. 3A). Similarly, MMP-9 was barely detectable in media conditioned by non-inflamed media, but was found at much higher levels in the media conditioned by inflamed tissue (Fig. 3B and C). In contrast, MMP-2, which is expressed constitutively, was found at similar levels in both types of media (Fig. 3B).
Interestingly, the levels of both MPO and MMP-9 released by synovium correlated positively with the inflammation grade, according to the histological scale established by Haywood et al. 24 (ρ = 0.459, P = 0.031 for MPO and ρ = 0.614, P = 0.007 for MMP-9) (Fig.
3D and E). That is, the biochemical findings confirmed the histological data: higher quantities of inflammatory markers were released by inflamed compared with non-inflamed synovium.
Expression of classical pro- and anti-inflammatory cytokines in inflamed and non-inflamed OA synovium
We next analyzed tissue-conditioned media from inflamed and non-inflamed
synovium from each sample to determine whether either set released specific cytokines. IL- 1β, IL-6, IL-8, IL-18, IL-23, TGFβ1 and RANTES were detected in synovium-conditioned
media (Fig. 4 and 5). The level of TNF-α was at the limit of detection, and IL-12p70 was not detected (data not shown). Concentrations of IL-1β, IL-6, IL-8, IL-18 and TGFβ1 were
significantly higher in media conditioned by inflamed, compared with non-inflamed, tissues (Fig. 4). In contrast, similar amounts of IL-23 (Fig. 4E) and RANTES (data not shown) were released by both types.
The strong and positive correlations between IL-1β, IL-6, IL-8, IL-18 and IL-23 levels and TGFβ1 levels in tissue-conditioned media by inflamed and non-inflamed OA tissues
analyzed together provided further evidence of the inflammatory potency of OA synovium (Supplemental Table). Moreover, the concentration of MPO in conditioned media correlated with the levels of several cytokines released by OA synovial tissues, including IL-8, IL-18, IL-23 and TGFβ1 (Supplemental Table), while MMP-9 levels were associated with IL-1β and
IL-6 concentrations (ρ = 0.370, P = 0.038 for IL-1β and ρ = 0.380, P = 0.037, for IL-6). In addition, the release of each of IL-1β, IL-6, IL-8, IL-18, IL-23 and TGFβ1 by OA synovium
7
0.439, P = 0.05; IL-8 ρ = 0.481, P = 0.035; IL-18, ρ = 0.448, P = 0.035; IL-23, ρ = 0.538, P = 0.016; and TGFβ1, ρ = 0.556, P = 0.015) (Fig. 5).
Higher release of IL-17 and IL-22 by inflamed OA synovium
As IL-17 and IL-22 play key roles in the regulation of inflammatory processes, we
next investigated their expression and release by OA synovium (Fig. 6). Both inflamed and non-inflamed tissues expressed IL-17 and IL-22 mRNA and released both proteins. A trend toward stronger expression of IL-17 and IL-22 mRNA was observed in inflamed compared with non-inflamed tissues (p = 0.079) (Fig. 6A and B). At the protein level, both cytokines were preferentially released by inflamed OA synovium: media conditioned by inflamed, compared with non-inflamed tissue, contained significantly higher concentrations of IL-17 and IL-22 (Fig. 6C and D). In addition, their release was linked to the inflammatory status of the tissues, as suggested by the significant positive correlation observed between MPO and both IL-17 (ρ = 0.514, P = 0.023) and IL-22 (ρ = 0.363, P = 0.025) (Fig. 7A and B and Supplemental Table). Nevertheless, we did not observe any correlation between either IL-17 or IL-22 levels and the inflammatory grade of the synovium.
Strong positive correlations were found between the levels of IL-17 and IL-22 in
conditioned media (ρ = 0.478, P = 0.002) (Fig. 7C and Supplemental Table) and between IL- 17 and IL-22 mRNA expression (ρ = 0.588, P = 0.022); this finding suggests an association between their expression. Studies of their individual correlations with IL-1β, IL-6, IL-18, IL- 23 and TGFβ1 found significant positive associations only between levels of IL-23 and both
IL-17 and IL-22 levels, and between the levels of TGFβ1 and IL-17 (Supplemental Table). In
contrast, significant correlations were found between the combined release of IL-6, IL-23 and TGFβ1 and levels of both IL-17 ((ρ = 0.562, P = 0.0035) and IL-22 (ρ = 0.434, P = 0.0301)
(Fig. 7C and D). These results show that IL-17 and IL-22 were produced by OA synovium and related to synovial inflammation. They also provide evidence that IL-6, IL-23 and TGFβ1
contribute to the release by OA synovium of IL-17 and IL-22.
DISCUSSION
Although OA synovitis is an integral component of OA1, 26, we are far from a clear
understanding of either the mechanisms responsible for its development or its exact
contribution to OA initiation and progression. It is suggested that OA synovitis is initiated by cartilage degradation products and mediators produced by chondrocytes 1. Recent data also
support a role for infrapatellar fat pad, which specifically releases factors 27-29 able to induce
synovial inflammation 30. Synovitis may favor OA progression via the release of factors
inducing cartilage degradation and synovitis perpetuation 1, 31, 32.
In contrast to rheumatoid arthritis (RA) synovium, which shows diffuse inflammation, OA synovium appears heterogeneous with patchy areas of inflammation3, 22. To understand
the molecular and cellular events responsible for this heterogeneity in OA and the
contribution of synovium in OA progression, it is necessary to study the inflamed and noninflamed
areas of OA synovium separately. Taking advantage of the clear macroscopic
differences between these two types of synovial tissue, as described by Ayral et al.22, we
separated them and analyzed them independently. Our results showed that this macroscopic discrimination clearly enabled us to distinguish between inflamed and non-inflamed areas of the synovial tissues. The ratio of vessel-to-tissue area was significantly greater in inflamed tissue, as the hyperemic appearance of those areas led us to expect. The number of leukocyte clusters was also significantly higher in these tissues and was positively correlated with the vessel-to-tissue area ratio. Haywood et al.24 previously reported an association between the
8
Moreover, the presence of higher levels of MPO and MMP-9, as well as of
proinflammatory cytokines such as IL-1β, IL-6, IL-8 and IL-18, in inflamed, compared with non-inflamed areas, points out the correspondence between the biochemical, histological and macroscopic characterizations of OA synovium and thus validates our technique.
Accordingly, Lambert et al.4, 33, using a similar approach of macroscopic discrimination
between inflamed and normal/reactive OA tissues, recently reported a differential gene expression pattern between cultured FLS from these two types of synovium. Notably, they showed that FLS from inflamed areas overexpressed some inflammatory cytokines and angiogenic factors.
As previously decribed3, 34, 35, areas of synovial inflammation in OA were
microscopically similar to those seen in rheumatoid arthritis although the intensity of inflammation was lower. Leukocyte infiltration in the inflamed tissues consisted mainly of macrophages and T and B lymphocytes. Macrophages were localized in the intima and the subintima, whereas T and B lymphocytes that were organized as clusters were found only in the subintima. Some neutrophils were also detected in the subintimal portion of the synovium. Gelatinases have recently emerged as potential important factors in OA pathogenesis,
through their generation of subchondral bone resorption and microvascular invasion33,34. In
our study, we clearly observed higher levels of MMP-9 in media conditioned by tissue from inflammatory compared with non-inflamed areas. Many cell types, including the neutrophils present in inflamed areas can release MMP-9. Consistently with previous data demonstrating that MMP-9 is controlled by various proinflammatory mediators, such as IL-1β36, we found a
positive correlation between MMP-9 and IL-1β levels.
We clearly demonstrated that IL-17 and IL-22 were both expressed at higher levels in inflamed, compared with non-inflamed, synovium from OA patients. This finding suggests that these cytokines may be among the critical mediators of the processes implicated in OA pathophysiology. Activated memory CD4+ T cells are the primary secretors of IL-17. TGFβ1
in combination with IL-6, both found in inflamed areas, is known to promote the
differentiation of Th17 cells37, which in turn secrete IL-17A and IL-22. IL-23 is an important
cytokine required for Th17 cell maintenance38. In addition, IL-1 and IL-23 synergistically
enhanced the production of IL-22 during Th17 differentiation. Interestingly, significant correlations were found between IL-17 and IL-22 or both and the combined release of IL-6, IL-23 and TGFβ1.
IL-17 is present in synovial fluid from patients with OA8, 39, and the correlation of its
concentration with OA disease activity and MMP expression in synovial fibroblasts suggests that it plays a role in cartilage destruction40, 41. In addition, IL-17 also induces chondrocytes
and synovial fibroblasts to release proinflammatory cytokines such as IL-1, TNF-α, IL-6 and IL-8, which contribute to inflammation, cartilage breakdown and synovial infiltration in OA12, 42. Others have demonstrated that IL-17 inhibits proteoglycan synthesis in rat cartilage43. It
also increases the secretion of vascular endothelial growth factor (VEGF)12 by synovial
fibroblasts from OA patients. VEGF is an up-regulator of angiogenesis, a process that is stimulated in inflamed synovium of OA patients and which contributes to disease progression. IL-17 is known to promote neutrophil recruitment and activation. In early rheumatoid
arthritis, the presence of Th17 cells is associated with neutrophil recruitment44. Neutrophils
play an important role in the onset and perpetuation of RA, contributing to joint erosion by the release of proteolytic enzymes such as MMPs but also by the production of high quantities of reactive oxygen species45, especially by MPO. Interestingly, MPO and IL-17 concentrations
were positively correlated in media conditioned by OA synovium. The presence of neutrophils in the inflamed synovium of OA patients might thus be involved in OA pathogenesis.
9
levels of IL-22 have been found in the synovial fluid of both psoriatic arthritis (PsA) and RA patients46, 47, and it has been reported to induce significant proliferation of FLS in PsA15 and
RA patients48. Moreover, IL-22-deficient mice, compared to wild-type mice, tend to be less
susceptible to collagen-induced arthritis with lower levels of visible (swelling, redness) and histologic (pannus formation, bone destruction) joint pathology, as well as decreased synovial expression of IL-1β, IL-6, TNF-α and MMP-949. IL-22 expression has previously been shown
in the synovium of RA patients48, 50. The pathogenic role of IL-22 in this model was inferred
by the authors because this cytokine increased osteoclastogenesis in vitro, a process that might be related at least in part to the induction of RANKL in synovial fibroblasts47. IL-22
levels in synovial fluid are significantly lower in OA patients than in people with PsA and RA. Furthermore, activated synovial T cells from OA patients produce significantly lower levels of IL-22 than those from PsA and RA patients15. A recent study nonetheless reported
that IL-22 and IL-22R1 are constitutively expressed in FLS from OA patients and that IL-22 enhances FLS proliferation and upregulates the expression of MMP, as well as alarmins, which are mediators involved in regulation of the cytoskeleton, cell migration and inflammation21.
The release of IL-17 and IL-22 is linked to the inflammatory status of the synovium, as suggested by the significant positive correlation observed between MPO and both IL-17 and IL-22. However, we did not find any correlation between the expression of these
cytokines and histological grade. The effect of IL-22 and IL-17 likely depends on the stage of synovial inflammation: previous studies of RA have reported IL-22-induced
osteoclastogenesis in the later phases of the disease47, and a recent work describes the
contribution of IL-22 in the later phase of inflammation51. In contrast, IL-17 plays a critical
role in the initial phase of RA44.
This study includes some limitations. It is a descriptive study focusing on the
characterization of OA synovitis without any data on the functional importance of synovitis in OA. No control tissue, including synovium from healthy and inflamed disease donors, was studied in parallel to OA synovium. In the literature, “healthy” synovium are obtained from symptomatic patients who suffer from traumatic knee lesions. These donors are younger than OA patients operated for total knee arthroplasty, young and aged tissues displaying different characteristics in term of cell to matrix content, of cell metabolism and production of
inflammatory mediators 52, 53. We separated inflamed and non-inflamed areas based on the
hyperemic appearance of the inflamed areas as described by Ayral et al. 22. There was an
obvious heterogeneity in the inflammatory degree of the synovium between patients. Samples for some patients contained only inflamed or non-inflamed tissues. It could be due either to the size of the samples, which varied upon donors and did not include all the synovium, or to different pathological mechanisms leading to OA from one patient to the other 54. Further
studies are necessary to investigate the inflammatory status of the synovium upon the etiology of OA. This heterogeneity in the inflammatory degree of the synovium between patients implies that the inflamed area of some patients could be similar to the non-inflamed area of other ones. Moreover, some non-inflamed and inflamed areas from different synovium were graded as 2 in the histological evaluation of the synovium established by Haywood et al. 24.
The partial overlap in cytokine concentrations of inflamed and non-inflamed tissue
conditioned media also reflects this phenomenon. This underlines the variable intensity of synovitis in OA, as shown by correlations between cytokine levels released by OA synovium and the inflammation grade of the tissues. To better characterize this point, it would be informative to study the link between the cytokine levels and the infiltration of the different types of leukocyte into OA synovium. Despite its efficacy, this macroscopic evaluation is therefore a relative discrimination between two apparent different areas and can only be considered in studies where a paired analysis is performed.
10
In conclusion, inflamed areas of synovium in OA secrete a wide range of cytokines,
including IL-17 and IL-22. This study suggests for the first time that IL-22 plays a key role in synovitis in OA patients.
ACKNOWLEDGMENTS
The authors thank the Department of Orthopaedic Surgery and Traumatology of Saint- Antoine Hospital for providing human OA tissues.
CONTRIBUTIONS
• Conception and design: FB, CE, XH
• Collection and assembly of data: CD, SC, AP, CB, LCG, GN, XH
• Analysis and interpretation of the data: CD, SC, AP, CB, LCG, GN, CE, XH • Drafting of the article: FB, CE, XH
• Critical revision of the article for important intellectual content: CD, SC, AP, CB, LCG, GN, FB, CE, XH
• Final approval of the article: CD, SC, AP, CB, LCG, GN, FB, CE, XH
ROLE OF THE FUNDING SOURCE
The present work was supported by French state Transimmunom funds managed by
the ANR within the Investissements d’Avenir program under reference ANR-11-IDEX-0004- 02. Authors declare that the sponsor was not involved in the study design, collection, analysis and interpretation of data; in the writing of the manuscript; and in the decision to submit the manuscript for publication.
COMPETING INTEREST STATEMENT
All authors disclose any financial and personal relationships with other people or
organizations that could potentially and inappropriately influence their work and conclusions.
REFERENCES
1. Sellam J,Berenbaum F. The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. Nat Rev Rheumatol 2010;6(11):625-35.
2. Samuels J, Krasnokutsky S,Abramson SB. Osteoarthritis: a tale of three tissues. Bull NYU Hosp Jt Dis 2008;66(3):244-50.
3. Lindblad S,Hedfors E. Arthroscopic and immunohistologic characterization of knee joint synovitis in osteoarthritis. Arthritis Rheum 1987;30(10):1081-8.
4. Lambert C, Mathy-Hartert M, Dubuc JE, Montell E, Verges J, Munaut C, et al.
Characterization of synovial angiogenesis in osteoarthritis patients and its modulation by chondroitin sulfate. Arthritis Res Ther 2012;14(2):R58.
5. Bondeson J, Wainwright SD, Lauder S, Amos N,Hughes CE. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res Ther 2006;8(6):R187.
6. Benderdour M, Tardif G, Pelletier JP, Di Battista JA, Reboul P, Ranger P, et al. Interleukin 17 (IL-17) induces collagenase-3 production in human osteoarthritic chondrocytes via AP- 1 dependent activation: differential activation of AP-1 members by IL-17 and IL-1beta. J Rheumatol 2002;29(6):1262-72.
7. Chabaud M, Durand JM, Buchs N, Fossiez F, Page G, Frappart L, et al. Human interleukin-17: A T cell-derived proinflammatory cytokine produced by the rheumatoid synovium. Arthritis Rheum 1999;42(5):963-70.
11
osteoarthritis and serum and synovial fluid interleukin 17 concentrations. J Int Med Res 2014;42(1):138-44.
9. Chen L, Li DQ, Zhong J, Wu XL, Chen Q, Peng H, et al. IL-17RA aptamer-mediated repression of IL-6 inhibits synovium inflammation in a murine model of osteoarthritis. Osteoarthritis Cartilage 2011;19(6):711-8.
10. Honorati MC, Bovara M, Cattini L, Piacentini A,Facchini A. Contribution of
interleukin 17 to human cartilage degradation and synovial inflammation in osteoarthritis. Osteoarthritis Cartilage 2002;10(10):799-807.
11. Honorati MC, Cattini L,Facchini A. VEGF production by osteoarthritic chondrocytes cultured in micromass and stimulated by IL-17 and TNF-alpha. Connect Tissue Res 2007;48(5):239-45.
12. Honorati MC, Neri S, Cattini L,Facchini A. Interleukin-17, a regulator of angiogenic factor release by synovial fibroblasts. Osteoarthritis Cartilage 2006;14(4):345-52. 13. Zenewicz LA,Flavell RA. Recent advances in IL-22 biology. Int Immunol 2011;23(3):159-63.
14. Ouyang W, Rutz S, Crellin NK, Valdez PA,Hymowitz SG. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu Rev Immunol 2011;29(71-109.
15. Mitra A, Raychaudhuri SK,Raychaudhuri SP. Functional role of IL-22 in psoriatic arthritis. Arthritis Res Ther 2012;14(2):R65.
16. Liang SC, Tan XY, Luxenberg DP, Karim R, Dunussi-Joannopoulos K, Collins M, et
al. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance
expression of antimicrobial peptides. J Exp Med 2006;203(10):2271-9.
17. Pitta MG, Romano A, Cabantous S, Henri S, Hammad A, Kouriba B, et al. IL-17 and IL-22 are associated with protection against human kala azar caused by Leishmania donovani. J Clin Invest 2009;119(8):2379-87.
18. Scriba TJ, Kalsdorf B, Abrahams DA, Isaacs F, Hofmeister J, Black G, et al. Distinct, specific IL-17- and IL-22-producing CD4+ T cell subsets contribute to the human antimycobacterial
immune response. J Immunol 2008;180(3):1962-70.
19. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, et al. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 2008;14(3):282-9.
20. Sonnenberg GF, Fouser LA,Artis D. Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22. Nat Immunol 2011;12(5):383-90.
21. Carrion M, Juarranz Y, Martinez C, Gonzalez-Alvaro I, Pablos JL, Gutierrez-Canas I,
et al. IL-22/IL-22R1 axis and S100A8/A9 alarmins in human osteoarthritic and rheumatoid
arthritis synovial fibroblasts. Rheumatology (Oxford) 2013;52(12):2177-86.
22. Ayral X, Mayoux-Benhamou A,Dougados M. Proposed scoring system for assessing synovial membrane abnormalities at arthroscopy in knee osteoarthritis. Br J Rheumatol 1996;35 Suppl 3(14-7.
23. Laiguillon MC, Houard X, Bougault C, Gosset M, Nourissat G, Sautet A, et al. Expression and function of visfatin (Nampt), an adipokine-enzyme involved in inflammatory pathways of osteoarthritis. Arthritis Res Ther 2014;16(1):R38. 24. Haywood L, McWilliams DF, Pearson CI, Gill SE, Ganesan A, Wilson D, et al. Inflammation and angiogenesis in osteoarthritis. Arthritis Rheum 2003;48(8):2173-7. 25. Houard X, Monnot C, Dive V, Corvol P,Pagano M. Vascular smooth muscle cells efficiently activate a new proteinase cascade involving plasminogen and fibronectin. J Cell Biochem 2003;88(6):1188-201.
12
26. Attur M, Samuels J, Krasnokutsky S,Abramson SB. Targeting the synovial tissue for treating osteoarthritis (OA): where is the evidence? Best Pract Res Clin Rheumatol 2010;24(1):71-9.
27. Conde J, Scotece M, Lopez V, Abella V, Hermida M, Pino J, et al. Differential expression of adipokines in infrapatellar fat pad (IPFP) and synovium of osteoarthritis patients and healthy individuals. Ann Rheum Dis 2014;73(3):631-3.
28. Distel E, Cadoudal T, Durant S, Poignard A, Chevalier X,Benelli C. The infrapatellar fat pad in knee osteoarthritis: an important source of interleukin-6 and its soluble receptor. Arthritis Rheum 2009;60(11):3374-7.
29. Klein-Wieringa IR, Kloppenburg M, Bastiaansen-Jenniskens YM, Yusuf E, Kwekkeboom JC, El-Bannoudi H, et al. The infrapatellar fat pad of patients with osteoarthritis has an inflammatory phenotype. Ann Rheum Dis 2011;70(5):851-7.
30. Eymard F, Pigenet A, Citadelle D, Flouzat-Lachaniette CH, Poignard A, Benelli C, et
al. Induction of an inflammatory and prodegradative phenotype in autologous fibroblastlike
synoviocytes by the infrapatellar fat pad from patients with knee osteoarthritis. Arthritis Rheumatol 2014;66(8):2165-74.
31. Conde J, Scotece M, Abella V, Lopez V, Lazzaro V, Pino J, et al. IL-36α: a novel cytokine involved in the inflammatory response in human chondocytes. Osteoarthritis Cartilage 2014;22(S):289.
32. Haslauer CM, Elsaid KA, Fleming BC, Proffen BL, Johnson VM,Murray MM. Loss of extracellular matrix from articular cartilage is mediated by the synovium and ligament after anterior cruciate ligament injury. Osteoarthritis Cartilage 2013;21(12):1950-7. 33. Lambert C, Dubuc JE, Montell E, Verges J, Munaut C, Noel A, et al. Gene expression pattern of synovial cells from inflammatory and normal areas of osteoarthritis synovial membrane. Arthritis Rheum 2014;66(4):960-68.
34. Kraan MC, Haringman JJ, Post WJ, Versendaal J, Breedveld FC,Tak PP.
Immunohistological analysis of synovial tissue for differential diagnosis in early arthritis. Rheumatology (Oxford) 1999;38(11):1074-80.
35. Revell PA, Mayston V, Lalor P,Mapp P. The synovial membrane in osteoarthritis: a histological study including the characterisation of the cellular infiltrate present in
inflammatory osteoarthritis using monoclonal antibodies. Ann Rheum Dis 1988;47(4):300- 7.
36. Horton WE, Jr., Udo I, Precht P, Balakir R,Hasty K. Cytokine inducible matrix metalloproteinase expression in immortalized rat chondrocytes is independent of nitric oxide stimulation. In Vitro Cell Dev Biol Anim 1998;34(5):378-84.
37. Korn T, Bettelli E, Oukka M,Kuchroo VK. IL-17 and Th17 Cells. Annu Rev Immunol 2009;27(485-517.
38. McGeachy MJ, Chen Y, Tato CM, Laurence A, Joyce-Shaikh B, Blumenschein WM,
et al. The interleukin 23 receptor is essential for the terminal differentiation of interleukin
17-producing effector T helper cells in vivo. Nat Immunol 2009;10(3):314-24. 39. Wu CW, Morrell MR, Heinze E, Concoff AL, Wollaston SJ, Arnold EL, et al. Validation of American College of Rheumatology classification criteria for knee osteoarthritis using arthroscopically defined cartilage damage scores. Semin Arthritis Rheum 2005;35(3):197-201.
40. Agarwal S, Misra R,Aggarwal A. Interleukin 17 levels are increased in juvenile idiopathic arthritis synovial fluid and induce synovial fibroblasts to produce
proinflammatory cytokines and matrix metalloproteinases. J Rheumatol 2008;35(3):515-9. 41. Neogi T,Zhang Y. Epidemiology of osteoarthritis. Rheum Dis Clin North Am
2013;39(1):1-19.
13
IL-17RC receptors are essential for IL-17A-induced ELR+ CXC chemokine expression in synoviocytes and are overexpressed in rheumatoid blood. J Immunol 2008;180(1):655-63. 43. Pacquelet S, Presle N, Boileau C, Dumond H, Netter P, Martel-Pelletier J, et al. Interleukin 17, a nitric oxide-producing cytokine with a peroxynitrite-independent inhibitory effect on proteoglycan synthesis. J Rheumatol 2002;29(12):2602-10. 44. Cascao R, Moura RA, Perpetuo I, Canhao H, Vieira-Sousa E, Mourao AF, et al. Identification of a cytokine network sustaining neutrophil and Th17 activation in untreated early rheumatoid arthritis. Arthritis Res Ther 2010;12(5):R196.
45. Cascao R, Rosario HS, Souto-Carneiro MM,Fonseca JE. Neutrophils in rheumatoid arthritis: More than simple final effectors. Autoimmun Rev 2010;9(8):531-5.
46. Fiocco U, Sfriso P, Oliviero F, Roux-Lombard P, Scagliori E, Cozzi L, et al. Synovial effusion and synovial fluid biomarkers in psoriatic arthritis to assess intraarticular tumor necrosis factor-alpha blockade in the knee joint. Arthritis Res Ther 2010;12(4):R148. 47. Kim KW, Kim HR, Park JY, Park JS, Oh HJ, Woo YJ, et al. Interleukin-22 promotes osteoclastogenesis in rheumatoid arthritis through induction of RANKL in human synovial fibroblasts. Arthritis Rheum 2012;64(4):1015-23.
48. Ikeuchi H, Kuroiwa T, Hiramatsu N, Kaneko Y, Hiromura K, Ueki K, et al.
Expression of interleukin-22 in rheumatoid arthritis: potential role as a proinflammatory cytokine. Arthritis Rheum 2005;52(4):1037-46.
49. Geboes L, Dumoutier L, Kelchtermans H, Schurgers E, Mitera T, Renauld JC, et al. Proinflammatory role of the Th17 cytokine interleukin-22 in collagen-induced arthritis in C57BL/6 mice. Arthritis Rheum 2009;60(2):390-5.
50. Benham H, Norris P, Goodall J, Wechalekar MD, FitzGerald O, Szentpetery A, et al. Th17 and Th22 cells in psoriatic arthritis and psoriasis. Arthritis Res Ther
2013;15(5):R136.
51. van Hamburg JP, Corneth OB, Paulissen SM, Davelaar N, Asmawidjaja PS, Mus AM,
et al. IL-17/Th17 mediated synovial inflammation is IL-22 independent. Ann Rheum Dis
2013;72(10):1700-7.
52. Ershler WB, Sun WH, Binkley N, Gravenstein S, Volk MJ, Kamoske G, et al. Interleukin-6 and aging: blood levels and mononuclear cell production increase with advancing age and in vitro production is modifiable by dietary restriction. Lymphokine Cytokine Res 1993;12(4):225-30.
53. Goldring MB,Otero M. Inflammation in osteoarthritis. Curr Opin Rheumatol 2011;23(5):471-8.
54. Bijlsma JW, Berenbaum F,Lafeber FP. Osteoarthritis: an update with relevance for clinical practice. Lancet 2011;377(9783):2115-26.
LEGEND OF FIGURES
Figure 1. Macroscopic and histological evaluation of inflamed and non-inflamed synovium from OA patients
A) Macroscopic views of OA synovium (S) and its adjacent adipose tissue (AT) (a and e).
Inflamed (Infl) and non-inflamed tissues (NI) are from the same synovium. The dashed line separates the synovium (S) from the adipose tissue (AT). Inflamed areas are characterized by the presence of hypertrophic and hyperemic villi (e). Immunohistochemical analysis of inflamed and non-inflamed OA synovium (n = 9) to identify endothelial cells (CD31) (b and f) and leukocytes (CD45) (c and g). The red dashed line separates the intimal from subintimal part of the synovium. Note the thickening of the intima in inflamed tissues due to increased cellularity. Vessels (arrows) are present in the subintimal layer of synovium (b and f). Vessels are larger in inflamed areas (f). Few leukocytes are observed in non-inflamed synovium (c). They are found as isolated cells (thin arrows) in the intimal and subintimal layers.
14
Inflammatory areas of OA synovium are characterized by the presence of foci of CD45- positive infiltrates (asterisk) in addition to isolated cells (thin arrows) (g). Panels d and h: negative controls. Bar = 200 μm. Quantification of the ratio of vessel-to-tissue area (B) and of the leukocyte infiltrate (C) in inflamed and non-inflamed OA synovium (n = 9). Inflamed areas have significantly greater vessel area and leukocyte infiltrates. Data are expressed as mean SD. D) The ratio of vessel-to-tissue area is strongly and positively correlated with the leukocyte infiltrate.
Figure 2. Histological characterization of leukocyte infiltration in inflamed and noninflamed
OA synovium.
Paraffin sections (5 μm) of non-inflamed (a-d) and inflamed tissues (n = 5 to 12) (e-l) were stained for CD68 macrophages (a and e), CD3 T-lymphocytes (b and f) and CD20 B-lymphocytes
(c and g), CD15 neutrophils (d and h) or with irrelevant antibodies as negative
controls (i-l). CD68-positive staining is observed in the intima of non-inflamed tissues (a). In the inflamed areas of these OA synovium, macrophages are localized both in the intima, where staining is stronger than in the non-inflamed areas, and in the subintimal space (arrows) (e). Non-inflamed synovium contain no T or B lymphocytes (c) and no neutrophils (d). The leukocyte infiltrate of the subintima of inflamed synovium also contains T (f) and B
lymphocytes (g), organized in clusters. In the inflamed synovium, some CD15 neutrophils (arrows)can be observed in the subintima where they are found within leukocyte infiltrates and vessels (h). (h, inset) Higher magnification view of the delimited area showing a neutrophil with its typical polylobular nuclei. Bars = 200 μm.
Figure 3. Biochemical evaluation of inflamed and non-inflamed synovium of OA patients.
Conditioned media from inflamed and non-inflamed areas of OA synovium were tested for MPO (n = 20) (A) and gelatinases (n = 16) (B) by ELISA and gelatin zymography,
respectively. A) A significantly higher level of MPO was released by inflamed areas of OA synovium, compared to adjacent non-inflamed areas. B) Representative activity of gelatinase released by inflamed and non-inflamed areas of synovium from two patients. Gelatin
zymography allowed detection of two principal gelatinases: MMP-2 and MMP-9. No
difference in MMP-2 activity was observed between the inflamed and non-inflamed areas. In contrast, MMP-9 activity appeared stronger in media conditioned by inflamed areas. C) Densitometric analysis of MMP-9 activity revealed by gelatin zymography. Significantly higher MMP-9 activity was detected in media conditioned by inflamed, compared with noninflamed,
areas. D and E) Positive associations between the release of MPO and MMP-9 by
OA synovium and the tissue inflammation grade of inflamed and non-inflamed areas (n = 21 and n = 19, for MPO and MMP-9, respectively).
Figure 4. Differential release of cytokines by inflamed and non-inflamed synovium from OA patients.
Levels of IL-1β (n = 19) (A), IL-6 (n = 17) (B), IL-8 (n = 17) (C), IL-18 (n = 21) (D), IL-23 (n = 22) (E) and TGF-β1 (n = 16) (F) were measured by ELISA in tissue-conditioned media
from inflamed and non-inflamed synovium from OA patients. Significantly higher
concentrations of all cytokines except IL-23 were measured in media conditioned by inflamed OA synovium.
15 Figure 5. Associations between the inflammation grade of OA synovial tissues and the concentrations of cytokines measured in synovium-conditioned media.
Positive associations were found between the inflammation grade of OA inflamed and noninflamed
synovial tissues and the concentrations of IL-1β (n = 20) (A), IL-6 (n = 20) (B), IL-8 (n = 20) (C), IL-18 (n = 23) (D), IL-23 (n = 25) (E) and TGF-β1 (n = 20) (F) measured in
synovium-conditioned media.
Figure 6. Differential expression of IL-17 and IL-22 in inflamed and non-inflamed synovium from OA patients.
A-D) Relative quantification of IL-17 (A) and IL-22 mRNA expression (B) in inflamed and
non-inflamed synovium from OA patients (n = 8). mRNA expression was determined by quantitative RT-PCR. The amount of mRNA was normalized against the amount of GAPDH mRNA measured in the same cDNA. C and D) Measurement of IL-17 (n = 22) (C) and IL-22 (n = 22) (D) levels in tissue-conditioned media from inflamed and non-inflamed synovium from OA patients. IL-17 and IL-22 concentrations were significantly higher in media conditioned by inflamed compared with non-inflamed tissues. E) IL-17 and IL-22
concentrations in media conditioned by OA inflamed and non-inflamed synovial tissues were strongly and positively correlated.
Figure 7. The release of IL-17 and IL-22 by OA synovium is linked to MPO levels and is associated with the combined release of IL-6, IL-23 and TGF-β1.
A and B) Correlations of IL-17 (n = 38) (A) and IL-22 release (n = 39) (B) by OA inflamed
and non-inflamed synovium with the release of MPO. C and D) Analysis of the combined release of IL-6, IL-23 and TGF-β1 by OA inflamed and non-inflamed synovium according to
the release of IL-17 (n = 28) (C) and IL-22 (n = 26) (D). The secretion of IL-6, IL-17, IL-22, IL-23 and TGF-β1 was ranked for all tissues analyzed, and the mean rank of IL-6, IL-23 and
TGF-β1, which corresponded to their combined release by each inflamed and non-inflamed
tissue, was calculated. Data are expressed as the secretion rank of IL-17 or IL-22 according to the rank of combined release of IL-6, IL-23 and TGF-β1.
