• Aucun résultat trouvé

PeC of

N/A
N/A
Protected

Academic year: 2022

Partager "PeC of"

Copied!
203
0
0

Texte intégral

(1)
(2)
(3)
(4)
(5)

SI.JOM'S

Expressionand Characterisation of a GeneEncodingRbpD, an RNA-Bind ingProteininAnabaenasp. strain PeC 7120

by

RobinleeTremblay

A lhesis submitted tothe Scltool ofGradualeStudies

in partial fulfilmentof the requirements fOl" the degree of

Master ofScience

Departmen t ofBiochemistrylFacultyofScience MemorialUniversit yof Newfoundland

Jan uary 2000

Newfoundland

(6)

Abstra ct

The RNA-bindingprote inRbpD,from the cyanobacteriumAnabaenasp, strain PeC 7120wasexpressed in£Sch~richiacoliandsuccessfullypurifiedusing

me

IMPACTIsystem(NewEngland Biolab s). TherbpDgene wasclonedintothepCYBt expressionvector by usingpolymerasechainreaction to introduceNde l andSapI restriction sitesatthe 5' end3' endsof thegenerespectively. The3'.-end mutagenesis alsochanged thestopcodoninto acystein ecodon.Theresultinggene encoded a fusion protein consisting ofRbpD,the SaccharomycescerevisiaeVMAinte inandachitin binding domain.. Expressi on ofthe fusion proteinwasobservedin£ colistrainMCI06 1 butWesternblotanalysis using an intein-directed antibody indicated that significant invivofmeln-direcredsplicing of thefusionproteinoccurred. We wereunable to eliminatethisproblem;nofusionproteinexpression was observed in 8otherEcoli strains tested.Wild-typeRbpDwas purifiedfollowingbindingof the fusion protein10a chitin columnandovernightcleavage in thepresence of areducingagent, dlthicthrehc l.

Anumberofmodificationstothemanufacturer'spurification protocol were found to be necessary forsuccessful purification.The NaCIconcentration in thecleavage and elution bufferwasincreased from SOmM to 500ruMtoeliminateproblemsof RbpDsolubility.

AninC~in the dithiothreirolconcentrationof the cleavagebufferfrom30mMto SOmMwasrequired for full cleavage.

AmodifiedformofRbpDcontaininganhexa-histidinetaginloop 3 oftheRNA recognition motif, Rbp D I,was alsosuccessful!ypurified.The rbpD/gene,previously

(7)

constructed by CynthiaSlade,wasclonedinfo the p'ffiC99Aexpressionvector.AnNee!

sitewasintroduced at theS'-endof thegene usingsite-directed mutagenesis. This modi fication also changed the secondcodonof the genefromserine to alanine.The RbpDl protein wasexpressedin£coli strainBUI( DEJ )PlysSfollowinginduction withIPTGand purified using a nickel-NfA agarose affinitycolumn.The protein was eluted with lOa roM imidazo leand appeared to be pure upon analysis using polyacry lamide gelelec trophoresis.

The RNA-bindingactivityof RbpOandRbpD I ....erefirstdetermined using Sepharose-4B-,polyacrylhydrazid.o-agarose-.oragarose-bound RNA homopolymers.

Bothproteins bound stronglytopoly(U),lessstronglyto poly(O),weakly to poly(A).and not atallto pely(e). Thispatternis consistent with thatobse rved forother cyanobacterialRNA-bindin gproteins.Therewas noapparentdifferencein the binding affinities ofRbpD and RbpD Iindicatingthatthepresenceof the6x-hist idinetag hadno effect.Experimentsto detectbindingbetweenRbpD and aconservedsequence element inthe S'- untranslaredregion ofrbp Dusingboth electrophoretic mo bility shift assaysand nitrocell ulose filter binding were unsuccessful. Similarly,attemptstodetect binding between RbpDandsize-fractionatedradioactivelylabelled poly(U)byelectrophoretic mobility shift assays were unsuccessful. Two SElEXexperiments were also unsuccess ful. Inbothcases,noincrease inspecificbinding over background was detected throughfour roundsofselection.

iii

(8)

This thesisisdedicatedtomy parents.KerryandLeeTremblay who have always supportedmeinanythingIhaveput mymindto.

(9)

I wouldlike tothank Dr.MartinMulligan.my supervisor on this project. forall the belp be has provided. and also forthe emotionalsupport. I'd also like to thank Tom Belbin for question answering,Kerry Tremblayfor editing the writinginthis thesis (and learning lots of biochemistry white doing so!),LeeTremblay forcomputer support, and Dr.lohn Bros nan who has gone aboveand beyondthe call of dutyinhis roleasHead of the Department. I also thankDr.MargaretBro snan and Dr.David Heeley who were on my advisorycommittee.

r

would like to thankmyfiance JasonChurch illfor being therethroughallthe stress.

iv

(10)

Table ofConte nts

StttiOD Abstnci

Ac:kn owl rdgem en u TableorCon te n t s Lisl orTables Lisl orFigu res

Lisl orAb b rev iationsan dSym bol!

CHAPTE R I:INTR ODUCTIO N 1.1 Cyanobacteria 1.2 Anabaenasp.strainPCC 7120

1.2.1 General t.2.2 Heterocysts

1.2.3 Mechani smofHeteroc ystFormation

Pagr:

iv

viii

ix xii

t.3. RNA·BindingProteins 10

t.3.1 RNP·TypeRNA-BindingProteins 10

1.3.2 RNA-BindingProleins in Cyanobacteria l 3

1.3.3 RbpD in Anabaena 7120 15

1.3.4 UIA 18

1.3.5 Heterogeneous NuclearR..ibonucteopro teins 21

13.6 Glycine Loops 24

13.7 EvolutionaryTrends in RNA-Binding 26 Proteins

1.4 Cold-Shock Prote ins 28

1.5 lnte ias 30

1.5.1 General 30

1.52 Ratio nale for thePlacementofIrueins 31

1.5.3 MechanismofInteinExcision 32

1.5.4 InteinsinCyanobac teria 33

1.5.5 InreinsforProteinExpressionSystems 36

(11)

S«tion

1.6 SELEX 1.7 Aims

CHAPTER2:MATERIALSANDMET HODS

Page 37 43

2.1 Materials 45

2.2 Culturingand Cloning 45

2.2.1 Media 45

2.2.2 Competent Cells 50

2.2.3 Transfonnations 50

2.2.4 lsclatlon of PlasmidDNA 51

2.2.5 Cloningof DNA 52

2.3 SequencingofONA 53

2.4 Detectionof Proteins 55

2.5 ExpressionofRbpD 56

2.5.1 Cloningo f r bpD lntopCYBI 56

2.5.2 Expression andPurification ofRbpD 57 2.5.3 WesternBlottingofFusionProtein 60

2.6 Expression of RbpDI 61

2.6.1 SiteDirectedMutagenesiso fr bpDl a 61

2.6.2 Expression of RbpD1 65

2.7 Storage ofprote ins 66

2.8 BindingExperiments 66

2.8. 1 PolymerBindi ng 66

2.8.2 Binding of S'-Untrans lated Region- DNA 67 2.8.3 Binding of5'-UnuanslatedRegion-RNA 68

2.8.4 Bindingof Poly(U) 70

2.9 SELEX 71

CHAP TE R3:RESULTSANDDISCUSSIO N - PROTEIN EXPRESSION 3.1 ExpressionofRbpD

3.1.1 Cloningofrbp DIntopCYBI

vi

76 76

(12)

Pa ge 3. 1.2 Expression of the Fusion Protei nin£.coli 79

MCI061

3.1.3 Expression o flheFus ion ProteininE.coli 84 BL2 1(DEJ)p LysS

3.1.4 WesternBlotting 92

3. 1.5 ExpressionofRb p DinOtherStrainsof 96 E.coli

3.1.6 Purification of RbpD 99

3.2 Expressionand Purificationof Rb p D1 102

3.2.1 Background 102

3.2.2 Site-Directed Mutage nesis 110

3.2 .3 AffectsoftheNcolSiteinrbp D / 113 3.2.4 Expressi onandPurifica tionofRbpDl 114 CHAPTE R 4:RESULT SAND DISC USSION-CHARACTERJSA

nos

OFRbpD

4.1 Bind ing to Agarose-Bound Polyme rs 123

42 Bind ing to5'-Untranslate<lRegi onofr bp D -DN A 127 4.3 Bindingto5'-Untransla tedRegion o frbpD-RNA 131

4.4 Bind ingof RbpDtoPoly(U) 139

4.5 SELEX 140

CHAPTER5: GENERAL DlSC USIOS 5.\

5.2

GeneralDiscussion FutureWork

lSI

1S6 1S8 AppendilI:Clon in g andSeq ue nci n gof nifH*from

Chlorogl oeopsiJsp.PCC6192

vii

174

(13)

Listof Tables Tab le

2.1 2.2 2.3

Plasmidsusedin thiswork Bacterial Suainsusedinthiswork Oligonucleotidessynthesisedinthiswork

viii

Page

46 48 54

(14)

List of Figures Figun Ch a p lcr I

1.1 PhotoofAnabaena7120

1.2 1.3

1.4 1.5

Cha p ter 2 2.1

VIARNA-Recognitio n motifbound10 anRNAhairp in Nucleotidesequenceof therbpD genefromAnabaena7120 anditsinferred aminoacidsequence

Schematic diagram of themech anism ofintein splicing Sch ematicdiagramillustratin gthetheoryof SEL EX

Protocolforexpress ion and purification ofRbpD

12 17

3S 40

59 2.2 Schematicdiagram of theAlteredSitesIImutagenesisprocedure 63

3.I Schematic drawi ng ofthe splicin g mechani smcfthe[MPACT [ 78 system

3.2 CloningrbpD in pC YB I 81

3.3 pRLTl digestedwith Ndel andKpnl 83

3.4 Ind uct ionof Rb pDfusionproteinexpressio nin£.coliMCI06 1 86 3.5 ExpressionoftheRbpDfusionproteinfrompRLTlin E.coli 88

strainMCI061

3.6 Expression ofthe RbpD fusion proteininE.coli 91 BL2I(DE3)pLysS

3.7 Westernblot analysis of theRbpDfusion proteininE.coli 94 strain MCI061

ix

(15)

Figure Page 3.S Expression ofthe RbpDfusion protein frompRLTl in eight 9S

strainsof£coli

3.9 RbpD elutionwith0.1%Triuln*X IOOinCleavage Buffer 101

3.10 Expres sion andelutio nof Rbp D 104

3.1 1 Illustration of RbpD sho wi ng the sites of attempted 6xHis-lag 107 insertion

3.12 Pictureof UIARRMIbound toanRNAligand 109

3.13 Mutagenesisofl'bpDla 112

3.14 pRLT3 digestedwithNcol and HindIII 116

3.15 RbpDI expressionunderinductionof ImMand2mMIPT G liS

3.16 Expression and purification ofRbp DI 120

Cbapte r4:

4.1 Binding of RNA-bindingprotein stoRNAhomopolymers 125 4.2 Cons ervedportion ofthe5'- untranslated region fromrbpD 129 4.3 Bindingof RbpD tothe 5' -untrans latedregionintheDNA form 133 4.4 Transcriptionof the 5'-untranslated regionofrbpD 135 4.5 Bindi ng of RbpDto the S'-untrans lated region in the RNAfo rm 138

4.6 Po ly(U) binding experiment 142

4.7 SELEX - Experiment# 1 14 6

4.S SELEX - Experim en t #2 149

Appendix I:

A.I Sequence of theChlorogl oeopsis69 12ni,j1rgene 179

(16)

Figure Pa ge A..2 CcrnpariscnbetweenNiff-lvsequencesofCh!orogloeopsis6912 181

andAnabaena 7120andthe NilH sequence ofAnabaena 7120

(17)

ListofAb b r evi a tio ns

Be lP S-bromo-4-<:hloro-3 -indolyl phosphate bZLM Leucinezippermotif in hnRNP C

cAMP CyclicAMP

CAPS 3-[cyclohex ylamino]-I-propanes ulfonicacid CBO Chitin-bindingdomain

ClRP Cold induced RNA-bi ndingprotein dNTP Deoxynucleoude triphosphate dsDNA Double-strandedDNA DTT Dithiolhrei tol EDTA Ethylcnediarninotetrac ericacid EMSA Electro phore tic mobilityshiftassay

Gravitationalforce

His-tag proteincon tai ning an insertion ofsixadjacent histidineresidu es hnRNP Heterogeneo us nuclearribonucleoprotein

IMPACTI InteinMediatedPurificationwithanAffi nityChitin-bindingTag (New EnglandBiolabs)

[PTG Isopropylp-D-dtiogalactopyranoside MCS Multiple cloningsite

MOP S 3-(N-morpholi no]propanes ulfonic acid NBT Nitro bluetetrazolium

xii

(18)

NMR Nuclear magnetic resonance NTP Nucleotidetriphosphate PABP Yeastpolyadenylatebindingprotein PCR Polymerasechainreaction PMSF Phenylmethylsulfonylfluoride Poly(A) Polyadenylicacid Poly(C) Polycytidylicacid Poly(G) Polyguanylic acid Poly(U) Polyuridylicacid PVDF Polyvinylidine difluoride RBP RNA~bindingprotein RNP Ribonucleoprotein RRM RNA-recognitionmotif

RT·P CR Reverse transcriptionpolymerase chainreaction SOS PAG E Sodiumdodecyl sulphatepolyacrylamidegelelectrophoresis SELEX Systematic EvolutionofLigands byEXponential enrichme nt snRNP Smallnuclear ribonucleoprotein

ssONA Singe stranded DNA

TE Tris-EDTA

UIA HumanUIA protein fromtheVIspliceoso malcomplex:

UTR Untranslatedregion

VMA Vacuolar ATPase subunitfromSaccharomycescerevisiae

xlii

(19)

Chapter I: Introduction

(20)

1.1 Cyano ba cte ria

The cyanobacteria are ancienL Fossil records arefragmented.buttheearliest unicellularand filament o us cyanobacteriafo und 10 date arefromsedime ntary rocks formed 3500 millionyears ago. Theheterocysto us and branchingfonns ofthis phylum develo pedla ter,after the Precambrianera. Thesefossilsare morpho logically very similar tothemodemday cyanobac teria(Wilmo t. (994).

Based on sequence analysisfrom165 RNA,. cyanobacte ria fonn oneof eleven majorphylaof eubacteria. However,verylittleis known about the taxonomy of the cyanobac teria themselves. Asof 1989.over50% of the cyanobacterialstrains in collectionsdid notcorrespond 10 the diagnosisof thetaxa 10 whichtheywere supposed to belong(Komarek and Anagnostidis.1989). Onthe basisof DNA-DNAhybridisa tio n studies,evenAnabaenasp.strai n

pce

7120. the organism of study inthis thesis,should properlyberenamedNostoc sp.strai n

pec

7120.

Rippkaetaf.(1979)first classified the cyanobacteri a lstrains in thePasteur CultureCollectionintofive sectionsbasedontheirmorphologyand method of cell divisio n.By this method of classification, SectionsIandIIcorrespondtounicellular organisms that multiplybybinary ormultiple fission. Section III ismadeup of filam entous strains whichhaveonlyvegetative cells.SectionsIVand Vcorres po ndto the heterocystandakinete fo nn ing strainswhichdiffer by whe ther the cellsdivideinone planeor multip leplanes.

(21)

From the molecular biologypointofview however.thereclassification of thefive cyanobacteri al sections bypartialsequenc ingof16StRNAbyGiovanno nitlal.(1988)is more useful. Thisclassificationdemonstra testhatSectionsIand IIIarenOIreallytrue:

lines of descent ,butare made up of anum ber differentlineagesaswellas some lineages that weremixedtogether.Sections II,IVandVhowever, are madeup of coherent phylogen etic clusters.The clusterscontainanumber of short branchesdivergingatthe base of theevolutionarytree,which probablyrepresentsthe period whenoxyge n concentrationsin theair andoceanswere: risingduringthePrecambrianera.allowing the colonisationofnew biotopes.Thisled to agreat divergenceinthecyano bacterialstrains (W ilmot.1994).

Cyanobac teria areimportantgloballyas a source of fixednitrogen.Econom ica lly the)' are important both as a sourceof fixednitrogen in"gree n"fertilisersand in supplementingreservesof fixednitrogenin Asianricefields(Rice et ai.,1982).

Additionall y,as thepopulationofthe worldgrows,nitrogen-fixingcyanobacteriaare findingmoreusein sustainable agric ulture due 10the expense and environmentalcostsof makingammonia chemically. Replacing the fixed nitrogenmade naturallybynitrogen fixingbacteriainlegumesalonewould take288IOnnesof fueland closeto$30billion U.S.annually (Vance,1991).Theideaoftransgenic cropplantsthat contain nitrogen.

fixingnodul es isthusbecoming moreattracti ve (vanKammen., 1997;Mani nez-Romero etal.,1997).

(22)

1.1 A" llbllt' IU'Sp.smil! rc c7120 1.1.1 General

Anabaenasp.strainPCC7120(Anabaena 7120)(Figure1.1)is a filamentous.

heterocyst-forming cyanobacterium. Ithas arelatively large genomicsizeat 6.4 million base-pairs(Bancroftet al., 1989). Unlike mostprckeryotes,thecells within the Anabaena7120filamentareableto communicale with oneanother,partlyin orderto facilitate theintercellularexchangeofmetabolites betweenthe heterccystsand vegetative cells (Wolketof.• 1993). Becauseof the flexibility allowed by intercellular communication ,certain cellsarc able to differentiate into anaerobic,nitrogen fixing heterocysts when afixed source of nitrogenisnot available(Haselkom,1998;Yoonand Golden, 1998;Wolk1989).

1.2.2 Heterocyst'

In the time before oxygen existedinthe atmosphere.around2.2billionyears ago.

micro-organismslivedanaerobically.utilising energy from the sunlight,carbon and nitrogenfromtheatmosphere.Overtime,theuse ofw-aterasa reductant polluted the atmospherewithoxygen; thistransition was detrimentaltonitrogen fixationbecause of thenegative reducing potentialrequiredfor thefixationprocess (Zhouetaf. ,1998b).

Some micro-organisms adaptedto thepresence ofoxygenbymodifyingaportionof their cellsinto nitrogenfixationspecialists(Giovannonietal,1988).In doingso,thesecells became unableto performphotosynthesis and lostthe ability10produce oxygen (Wolk, 1996;Wolket al.,1994;Thiel,1993).The specialisedcellsare calledhete rocysts.

(23)

Figure1.1: Photo ofAnaba ena 7120. This species growsas a filament,and experiencessomeconununication betweencells. Underconditions wherea sourceof fixednitrogen is lacking, everytenthcellwillundergoaseriesofreactionsto becomean anaerobic,nitrogen-fixingheterocyst. Theheterocystsinthispictureareexpressing green fluorescent proteinWIderthecontrol ofapromoteractiveintheheterocyst.(Photo byBillBuikem a fromhttp;lIwww.thewcbpros.comlccblscience.html)

(24)

-f\- ,, -

r •

1', . p r , t , r

,;

Heterocyst

Vegetative cell

(25)

Because the van derWaal ' sradiiofNand 0 are so similar (ISAandl4A respectively), it wasnot possibleinnature topermit nitrogenentryintothe heterocyst without also permittingentryto oxygen.,which woulddestroy

me

nitro ge n fixation reaction. The heteroc yst cells therefore posses s a barrie r made of a layer of polysaccharid e.surrounding alayer of glyco lipid.whichin nunsurro unds awalllayer correspond ingto the vegetative cell wa ll. Thelaye rs effectivelyblock the entrance of both the oxygenand nitrogen(wolk,1996;Walketal..•1988).Different species of the cyano bacteriapermit entryofnitrogen (andoxygen) byhavingl, 2,or3 poresbetween theheterocyst and theadjacentvegetativecells. The oxygenlhatpasses through is reducedto watertopreven tit from destroyingthenitro genfixation enzymes (Wa lket al., 1994;BuikemaandHasel kom.199 1a).

Transcriptio nal regulation of heterocystdevelopme ntisimportan t inthe cell. In Anabaenacyl indrica, 15to 25%ofthe genomic space isreserved fo rge nes that are ex pressed onlyinheterocys ts(Wolket ai.,1994).

1.2.3 Mech anism of Het cr ocy stfor mation

Much ofthestudy into the differentiationof heterccysta has been donewith Anabaena7120. In this species.active heterocystsdevelop in thefilame ntwithin24 hours of nitrogenstep-down. Heterocysts developabout every tenth cel lalongthe filament(Wilcoxet al.,1973a;197J b;Wolk et ai..1974 ).

When the fixed sourceofnitrogen is removedfrom a cultureofAnabaena7120.

anunidentifiedgroup ofgenesbeginstorespo nd.Betw een2 and 3.5hoursafternitroge n

(26)

step-down.h~IRbecomes active. This coincides with the appearanceof proheterocysts alon g the filament(Caiand Wolk., 1997; Buikema and Haselkorn. 199Ib).

Four to tenhours after the step-down.othergenes begin tobeactive.A gene for proheterce yst matura tion.devA.,becomes active,as does Ju:pA.whichis responsible for thedeposit ionofthehetero c yst envelope(Wolk,1996). Ifhep A.is mutatedthenthe hererocysts which are fonned tend to bepermeable toO2andlackacohesive polysaccha ridelayer (Wolk ttl al., 199 3).The genefor helM, which is requiredforthe synthesisof heterocystglycolipideis also induced(Cai and Wolk.,199 7).

By 18 hours afternitrogen step-down. XisAhas removed an II kb fragment from thenifHDK opc:ron. This allows expressionof the dinitrogenasc: reductase(a dimer encoded bynif1/) and dinitrogenase (a le:tramc:r encoded by nijD and nifK). These enzymes are responsibleforfixingnitrogen. Twenty-fourhoursafterthe removal of a sourceoffixednitrogen. theheterocystsarefixingnitrogenfor the filament (Wolketal., 1994).

Fogg (1949)postulated that thepattern of heterocyst formatio nin thefilaments is based on a competitionbetween adiffusible inhibitorand a non-d iffusibleactivator. The inhibito r shouldbeproducedquicklyandmigratetoother cells to inhibitthe activator.

The activatorshouldbe:produced more: slowly. and havethe:abilityto activate a positive feedback looptoinitiate the process of differentiation. It should also activate synthesis of theinhibitor.1beinhibitor shoulddiffuse through the vegetativecells(perhapsbeing degrade d bythe cells],setting upa gradie ntof inhibitor whichwoulddecrease as the numbe rof cellsformtheexisting heterocyst increased.Atthe same time.the vegetative

(27)

cellsshould havemade the activatorsubstance. Whena cellis reachedthathasless lhan a thresholdleve l ofinhibitor, the activatorcouldsetup the positive feedbackloop.

inducing both celldifferentiationandproduction of more inhibitors so that othercells do notalso start the differentiation process. (Zhou el al.;1998a; Blacketat,1993;Wilcox et ai.;1973a; 1973b).

HetR istheorisedtobethe potentialactivator(Buikema and Haselkom, 1991a;

1991b). The expressionofheIRfrom a multi-copyplasm id causesthedevelopment of heterocystseveninthe presence orafixed nitro gen source(Cai andWolk,1997;Black andwclk,1994; Lianger ai.1992).Itis one of the earliest knO'NI\ genes to beactivated inthedifferentiati onprocess,andit isthoughttoactiva te itsO'NI\ synthesis withinthe he terocy st(Hase lkorn, 1998; YoonandGolden, 1998;Buikema andHaselkom.199 1a;

199tb). In immunoblotstudies,HetR has beenlocal ised to thedifferentiatingheterccysta and proheterocysts(Zho u et01.,1998a).

PatS, a 17 amino acid peptide. is thoughtto be the inhibitor (Yoon and Golden.

1998). Over-expression ofpaISprevents all heterocyst formation, while inactivating the geneallows heterocysts to form,eveninthe presence ofafixed nitrogen source.

Contiguous heterocysta develop in filaments ofpaiSmutants(Elhai,1999; Hase lkom., 1998; Yoon and Golden,1998).

Once the pattern ofheterocyst differentiation has been determined, the progress of the differentiationrelies onseveralinterloc kingsteps. Fo r example. developmentofthe matureheterocystcan onlybehaltedbythe addition of transcriptional inhibitorssuchas rifam pici n, fluorouracilorproflavin,Ito2or8 to 10hours afternitrogenstep-down.

(28)

Thefirsttime slotcorrespondstothe period in whichHetR is becomingactive.

Inactivation of the transcriptio nofh~tRprevents the formation of prohe leroc ysts andthus the creatio nof mature bereroe ysas.Oncetheprobeteroc yst isformed ,the chemicals have noeffec tontheformationofthemature heteroc ystunJesstheyace added 8totohours afternitrogenstep-down. Thisperiodof timecorresponds 10thetranscriptionof the envelopebiosynthesisgenes (Bradleyand Carr.1977 ).Theseresult s strong lyindicatea cascade eventsofthatrelyontheinitial step andthenon otherintermedia te stepsrather thanonenvironmentalpress ures.

1.3.1 RNP.TypeRl"A-Bind ingProteins

RNA bindingproteinsareubiquitousineukaryctes. The most commontypeof RNA- bindingprote insarethosecontaining theRNP domain,orribonucleoprotein do main. Theseproteins arecharacterisedby anRNA-recognitio n moti f (RRM) that is madeupof70-90res iduesthatparticipate in RNAbinding(Figure1.2).ln the protein, theRR.Mformsa domaincontainingtwoa-helices whichare arranged. across the back of fouranti-parall elj3-suands.Two sequencesintheRRMare more highlyconserved. than the rest of the domain andare thought 10 interactmostdirectlywiththe boundRNA.

These areRNPI,made upof eight aminoacids ,andRNP2,whichis madeof sixamino acids (Nagaier aJ.,1995;Hananoet aJ.,1996;Liand Sugiura,1991).TheRNP Iand RNP2sequenceslieonthethird andfirstl3-strandsrespectively.

10

(29)

Figure1.2: UIARNA~Recognitionmotif boundto an RNAhairpin. The diagram shows the first RRMinUIA bound to an RNA hairpin.TheRRM secondarystructureis composedofal3a l3l3o l3 motif. RNPIliesODp-strendthree of theRRM(green), and RNP2liesODl3-stran done (cyan).Themost variablepartof theRRMliesin loopthree of thedomain. InUl A, thisdomain protrudesthroughtheRNA hairpinandisessential for the RNA.protein interaction. The diagram was taken from hnp:/Iwww.tulan e.edu/-biochemJnolanllec tures/maiula.htm and is refer enced to Oubridgeetal (1994).

(30)

12

(31)

Most RRMs containsolvent-exposedtyrosine and phenylalanineside-c hainson p-strands 1 and 3.Themost conserved of these residues are phenylal anineresiduesat position 13 onp-sbandIand positions 54 and 56 on p.suand 3.The geometry of the residues suggests that they are involvedinbasestacking; it also accountsforthe abilityof manyRRM-eo ntainin g proteinstobe cross-linked with their RNAtargets(Kenan et 01., 199 1). X-raycrystallographystudies of the VIA protein RRM with thecognate RNA have confirm edthese interactions (Oubridgeet0/.,(994 ).

Thefirst RNA-binding proteinofthe RNPtypeto be identifie dwasthe yeast polyadenylat ebindingprotein whichcontainsfourtandem repeatsofthe RRM(Nagai.

(996).The RNP-domai n has sincebeenfoundin over 200otherprote ins.TheRNP-type RNA.bindingpro te ins are normallyinvolvedinpost-transcriptional metabolism. Some ofthefunctio ns for theseproteinsin eukaryo ticcells are capping.polyadenylatlon.

splicing and ahemanve splicing,transportofmRN A,localisation of RNA and RNA turnover (KimandBaker,1993;Haynes, 1992). Some of the RNP.type proteins are induced in response to cellular stresses, such ascold,both inpmkaryo tes (Sate,1995;

Maruyama et01.,1999) and eukaryotes (Dunn el 01.,1996;Breitenederet 01.,1994).

1.3.2 RNA·BindingProtein sinCyano ba cte ri a

The firstpaper showing that R..'"'JP.rype bindi ng proteinsmightnot be strictly eukaryotic camewith thepape r byMulliganetat.(1994); demonstratin ga gene encoding anRRM-eontaining proteininChtorogtoeopstssp.strain

pee

6912(rbpA). Mulligan et at.usedSouth ern blottingwith aDNAprobe forrbpAtodemonstratethat heterocy st-

13

(32)

formingcyanobacteri atendto have more copiesof these genes than do non-heteroc:yst- fonning unicellularcyanobacteria. Maruyamaetaf.(1999) postulatethat the nwnberof RNA.binding proteingenes in differentcyanobacteriamay berelatedtothe size ofthe genomes.Thisfitswiththe theorythat thesizeofthecyanobacterialge nomesarosefro m multiplication ofanoriginal genom e of1.2 mega base-pairs(Herdmaneral.,1979).

little is known aboutRNA-binding proteinsin cyanobacteria(Smith,et al..

1996).No binding sequences from RNA have beenidentifiedand nobindingconstants have been measured.Somecyanobacteria!RNA-binding proteins seemto beinvolvedin thecold-shockprocess. RNA.bind ingproteinscontainingglycine-richdomains are upregularedwhenthegrowingtemp eratureisdroppedfrom38°C to

noc.

However, thosethatdo notcontai nthe glycine-ric hregionarenot regulatedbytempe rature (Sato, 1995;Maruyamaetal.,1999;Charnotet 01.,1999). little is known about this temperature dependence except that under cond itions of cold shock.at leastinAnabaena vartabilisM3 andAnabaena7120,RbpA I seems to actas a repressor fortheinitial steps inheterocystformatio nwhen nitrate ions areprese nt(SatoandWada,1996).

Fromanevolutio nary point of view.the cyanobacte rialRNA-binding proteins are very interesti ngto study. Until this year,the conservednature of theRRMsequencesin chlo roplas tsand cyanobact eriahad researchersconvincedthatcyanobacterialRNA- bindingproteins weretheprecurso r forthe chloroplast versionof the proteins(Mulligan et 01.,1994;Sugita andSugiura,1994 ).Butin1999,Maruyam aet al.tookthisfurther.

They sho wed,using phylo genetic studies, that the chloroplast RNA-binding proteins probablydive rgedfrom eukaryc ticRNA-bindingproteinsbeforetheadditionof the

14

(33)

glycine-rich region or duplica tio n of me RRMs. rather than arisingfrom the cyanebacterdalproteins. Also.until recently.cyanobacteria were !he onlypro kary o tes found. to ha-ve RNP-typeRNA-binding prote ins . Most other bacteriaseemtocontain cold-shoc kdomainproteins.which perform the same jobasthe RRM-eonlaini ng RNA- bind ingproaeinsincyano bacteria. However . Maru yamaet af.found RRM-eontaining prote insin the genomeseque nces ofHeticobacterpylori (Tombet ai.,1997) and Treponema pallidum, (Frase ret ai.,199 8).This suggests the possibilitythat other bac teria maycontain theseproteins aswel l.

1.3.3 RbpD inAnalHlena7120

TheJbpDgeneis oneof eight genesinAnabaena 7120encoding an RRM- containingprotein.and corresponds to therbpC gene inAnabaena varabilis M3 (Maruy am a~I01.,1999).Itreside s on a 374base-pairfragm ent lying between EcoRI and HindlIIsites in thegenom e. The fragm entwascloned into a pBR322vectorby Chris Holden (1995) andsequenced. Theopenreading fram e in thefragment encodes a proteinthat is110 amino acids lo ng (Figure1.3).RbpDis interestingbecauseit conlains a slightlylonger glycine-richregionthanthe otherRRM-conlaining proteinsencodedby .-fnabaena .This region is shown inoutlined leiters in Figure1.3. The C-tenninal four amino acids also havethe sequence"RRS Y".whereas mostof these proteinshave the conservedse-quence"RNR¥".This gene was chosenasthe singlegeneto study because no neofitscflaracte rislicshave yet to be elucidated by any of the groupsworkinginthe areaof cyancebacteri alRNA-bindingproteins.

IS

(34)

Figure1.3: Nucleotide sequence of the rbpDgenefrom Anabaena 7120and its inferred aminoacid sequence . The gene resideson a374 base-pairEcoRI·Hi ndllI fragment.The openreadingframe is(10 aminoacidslong,and the calculatedmolecular weightofthe expressedproteinis12 03!kDa.The RNP2 hexapeptideis highlightedin redand the RNPI octapeptid eis highlightedinblue.The glycine-rich.auxiliary domain iswritten in outlineletters.Thisdatais fromHolden (1995).

(35)

::;

j,·RI

GAATTCGGAGACATTGTATGTCAATTTACATCGGTAACTTATCCTACCAAGTTACAGAGGAAGACCTAAAGCTGG MS I Y I G N L S Y Q V T E E D L K L A CCTT CGCAGAGTACGGAAAA GTT AGCCGCGTT CAAT TACCAA CCGACCGT GAAA CT GGCCGTCCT CGTGGGT TT G

F A E Y G K V 5 R V O L P T O R E T G R P

a

Q P A

CTTTTGT GGAAA T GGAAA CAGAAGCTCAA GAAACCGCAGCCATT GAAGCACT GGATGGT GATGAAT GGATGGGAC F V E M E T E A Q E T A A I E A L D G A E W M G R GTGAT TT AAAA GTCAAC AAA GCT AAA CCCCGT GAAGAAA GAAGTTC T TC TCC TCGT GGTGGCGGCGGTAGTT GGG

o

L K V N K A K P R E E R 5 8 8 P R Q G Q G B W G

GTAAT AATAA CCGT GGTGGTGGCGGCGGTGGTAAT CGCCGT AGTT ACTAAA TCCT ATTGC T GAAA CGCAAGCTT

~ I •

ceQ

Q G g I

a

8 1'- /III/d ill

(36)

1.3.4 UlA

The humanVIA protein isprobablythe best known andunderstood of the RNP- typeproteins;interactionofitsRRM with stem-loopIIofUIRNAisthe basis for much of the understanding ofhow RRMs and RNA interact.VI snRNP is made up ofVI RNA(165 nuclcotides),threeVIspecificprotein subunits (A,70 kDa, andC)and several coreSmproteinsthat are common tome otherspliceosomalsnRNPs. TheVI RNAis complementaryto me5'-endofmesplice siteat its own5'-end, contributingto thelocal isationof the splice site.VIRNA foldsinto a secondarystructurethatcontains four stem-loopstructures (Evanset at.,1993). VIA,a 283 aminoacid protein, bindsto stern-loopII(Scherlyet at.,1989). Itisableto regulateits own productionby also bindingto an intemalloop in its 3'-untranslated region, blocking polyadenylation of me pre-mRNA.The internalloop contains7 nucleotideswith a sequenceidenticaltothose found in theloopportionof stem-loopII inVIRNA. Polyadenylationisblockedwhen UIA (boundtothe 3'-untrans latedregion)interactsdirectly withthe poly(A)polymerase (Gubser and Varani,1996).

UlA consists of two RRMdomai ns joined by alinker. Onlythe N-terrninal domainis requiredfor bindingtoVI RNA.Inexamining thebinding of the firstRRMof the proteinwithhairpinIIofVI RNA byX-raycrystallography,Oubridgeet at.(1994) found that the RNAloop liesacross the p-sbeer of the RRM, fitting into thegroove between 13-strand2andf3-stran d3.Inthe structure,the N- and C-tenninalsofU IAare not well orderedin the free protein, nor isloop3 of the protein.However,whenUIAis boundto theRNA-hairp in,thenetworkofhydrogen bonds at themolecular interfa ce

18

(37)

keeps all thepartsoftheprotein in place. TheRNAbasesintheloopinteractextens ively with the side-chains oftheRNPI and RNP2amino acids(Jessen et al.,199 1).and also with the main-ebain amide andcarbonylgroupsinthe C-tenninairegio n ofthe peptide.

Amino acids 2 to 98inUIAaresufficient10bindtothe VIRNAwith full affini ty.butresidues uptoamino acid 114inthe proteinhelptoaddspec ificitytothe binding.This specificityintheC-tenninalend of the firstRRMhas been foundtobe critical [() RNA recognition in a numberof proteins.includingUIA. hnRNP and UI 70K (Allainetal..•1996).Multidimensionalbetercnuclear NMRofa peptide that included the:

first117 amino acidsallowedthediscoveryofathirda-helix(helixC)in theUIA RNP- domain. Thishelix forms from residues92-98.In the free protein,helixCinteractswith thep.sheet.forming a hydrophobiccore involving the residuesL44.158,F56. 193. 194 and M97. The positionof thehelixprevents exposure:ofthe hydrophobicresidues.

stabilising theprotein.Becausethehelixblockspartofthe bindingsite however.itmust rotate 1360uponthe interactio nof RNAwith the RRM.exposing the bindingsite(Avis et al.,I9%).

"Theloops between the p.strands are important aswell. Loop 3. betweenp.

strands2 and 3.contains oneofthemost variableregionsof theRRM.Ifafive amino acid sequence(residues 44 to48)ismovedfromthisregion inU2B"to thecorrespo nding positionin UIA.itchangesthe specificity of UIAso that it bindstheU2B"cognate R.NArather thanitsown(Scherly et al.,1990;Bentley andKeene,1991;Hoffinanet of.•

1991).Two loops,one between p.strandIand a-helixA,and onebetwee np-strands 2 and3(loop3), have anumberof basicaminoacids thatare essential forbindin g to RNA.

19

(38)

These include K22.K23.K27.R47,K50andKS2.Thesetwoloopsforma pair of basic

"jaws"thathold the backboneof the RNAinposition (Evans etaJ.•1993; Jessenet at.•

1991).

Itis noronlytheprotein thatexperiences conformatio nal changeson interaction withtheRNA. Using NMR 00 exam ineRNA resonancesincomplexwithU IA.Hall (1994)foundthat there weresignificantresonance shifts in both the nucleotidebases and ribosesugarsof the RNA.This indica ted that the environme ntof many ribonuclcosides wasbeing alteredon bindingtothe protein.HaIlconcluded that the format ionof the RNA-protein complex resultedfrom a number of interdependent interactions,wherethe failure 10make one contactaffected the formationof othercontacts.

Surprisin gly,the C-te nn inal RNA-recogn ition motif inUIA docs not appearto bindto RNA (RNA-polymers .snRNAs or random RNAsequences), at least not inits monomeric form. The domain has good sequenceandstructuralconservationwilt. theN- terminal RNA-binding domain andcontains all thecore hydrophobicamino acids .There are anumberof poss iblereasons forthislackofRNAbinding. The C-terminal recognition moti fmay have the wrong aminoacid residues atcritical positions .It may lack the necessaryelectrostati c contactsfor binding,orlac kthe appropriate amino acids displayedin the correctgeo metric arrangement. The tertiarystructure of the domain mightinhibitRNAcontact. Or.the domain may simplyrequireanauxiliaryproteinin ordertobeable to bindto the RNA.asdocs U2B"(Luand Hall,1995).

20

(39)

1.J.5 H~t~rog~D ~OUSnucl~a r Ribonudeoprot~iDJ

The heterogeneo us nuclear ribonu cleoprote inparticles (hnRNPs)are those proteinsthat bindtohnRNAs.but arenota stablepan ofsome othernuclear complex such as snRNPs(Dreyfusset al.,1993;Dreyfuss .~tal.,1988).At present aboutthirty hnRNPproteins varyingin size from 34 to120 kDa. havebeen ide nti fiedbytwo- dimensionalgel electrophores is (Krecicand Swanso n, 1999).The hnRNPscontainan RNP-typeRNA-bindingmo tifandmanyhavedem ons tratedRNA-binding activity.The twomoststudied hnRNPproteinsarc:hnRNPCand hnRNP AI. Most iskno wnabout the structure and binding of theCprotein.whichisimportantbecause itallo ws com pariso ns tobemadewith the informationkno wn about VIA.TheAlprotein isless well understood interm s ofits stru cture.but the cyanobacterial RNA-bind ing pro teinsare often comparedto hnRN PAIbecauseitcontainsa glycine-rich regionwhichma y affect itsprote in-pro te ininteractio ns or RNA-bindinginte ractio ns (Dreyfuss etal.,1993).

TheC proteinwilt bedisc ussed first.The proteinis 41-43 kDa and is confined to thenucle us of interphasecells. Itconsists oftwopans,an N-terminal RNA.binding domai nanda C-tenninal acidicdomain thatcontainsa putative NTP-bindingregion. HnRNPC is often post-ttanslationallymodified by phosphorylation. The proteinis involved in transcriptpacka ging,splicing,andnuclear retentio n(KrecikandSwanson.

1999).

ThesolutionstructureoftheRNA.binding domainofhnRNPC was determin ed bymultidimensio nalhete ronucle arNMR ofresidues 2·94. Theresulting struc turewas verysimi lar to that ofUIAwiththe exception that theresiduesintheloo pbetween

11-

21

(40)

strands 2and 3were miss ing(this is the variable loop whichisinvolvedindetennining RNA-bindin g specificity in U IA) (Wittekindet al.,1992).Pho tochemicalcross-linking and SELEX(see Section 1.6) experimentsdetermined thathnRNP C prefers a paly(U) sequence forbind ing(5and6 Usrespectively) (Gorl ach etal.,1994;Swanson and Dreyfuss,1988).The authors suggested that the RRM confers a generalRNA binding abilityand thatthe:vari able regions in thejeeps, and N-tenninalsandC-tenn inals (especiallyresid ues95-104)confer U1c: specificityofinteraction. Chemicalshifts from theNMR data suggest thattheRNApolymeris boundonthep-sheet of theRRM,with the:sheet acting as aplatformforbindingrather than as abindingpocket.Thisleav esthe bound RNAexposed forinteractionwithotherproteins(Dreyfusset aI.,1993;Gorlach et al.,1992).

Inthe past two years,mere has beenasuggestion thatme RRMof hnRNP Cis nottheprincipal portionofmeproteininvolved in RNA binding.Shahied -Milameral.

(L998)have shown that hnRNPCbinds in a cc-operarive mannerasatetram ertobloc ks of RNAthat are 700 nucleotideslong,andalso to snRNAsUI. U2,and.U6 as well as to a 116nucleotideribosomal RNA transcript. The winnerfrom the SELEXexperim ent (Gorlachetal.,1994) did notbind as strongly10ImRNPC as these sequences. possibly because ofthe shortoligonucleotide length used in the SELEXex peri ments .The binding of Uf.U2,U6andthe116nucleotid eRNAs is notmedi ated by theRRMas originally thought,but by a 28aminoacidleucine zipper motif(bZLM ). Usingcompetitionstudies, Shahied-Milamet a1.(1998)theoris ethat the RRM mayfunction as anegativealloste ric modulator ofhnRNPC-protein interactions.

22

(41)

Shahied--Milam elal.(1998)also made twoRRMdeletio nmutants in domains consideredimportantfor RNA·bindi ng. One mutan tcontai ned the first 115amino acids.

theRRM domain, and the othercontained amino acid residues 119·290.consistingof the bZLM and acidic carboxy-terminus.In the mutant ccnrainingonlythe RRM.therewas reducedaffinity fortarget RNA as comparedtothe wild-typeprotein. The affinityofthe mutantcontaining the bZLMandacidicdomain forthe RNA didnotles sen as compared tothe fulllength protein. butthis mutantdidshow severe defectsin RNA-activaled tetramer -formatic n. Taken withthe RNA- bindi ngdomai n'slowaffinity for RNA. the authorspostulate thaitheRRM maybeim portan tin proteln-p rc rein inte ractionsrather than protein-RNAinteractions . Thisdoes haveso me preced entintheU2B"snRNP prote in.which.interactswithU2AsnRN P protein throughitsRRM before being ableto bind toitscognat e RNA(HallandKranz,199 5).

Heterogeneousnucl ear ribonucleo protei nAl(34 kDa) isinvol vedinalternative splicing ofpre-mRNA.mRNAtransportandtelomere biogenesi s (Krec ikandSwanson, 1999).TheproteincontainstwoRNA-binding domains(Merri llet al.•1988).positioned with theirl3·shects orientedinoppo site directions.andaC·tenninal glycine-rich regio n (Dreyfusset al.,1993 ). There are a number of different isofonns ofthe protein, generatedbyallemativesp licing(Buvolietaf. ,1990).Thelength ofloo p 3 in the RRMs ofhnRNPAIisvaried byalternative splicing.This may beim portantin determiningthe specifici ty of RNA binding. Mo re diversity iscreated using post-tran slational modificationssuchasphosphorylationand arginineme th ylatio n.

23

(42)

SEtEX experimentsdemonstra ted thathnRNPAI binds tosequencesrese mbling S'and 3'splice sitesofpre- mRNA.Mutaucn of the ccnservedAG foundatthe 3'splice siteseverely inhibits thebinding ofhnRNPAI. If a SElEX experimentwas done using the N-term:inaland C-tenninalRRMsseparatelyfrom the wholeprotein.then different RNA sequences werebound in each experime nt.This indicatedthat the binding specificityof the Al protein is a resultof bothRNA-bindingdomainsacting as a single RNA-bindi ngcomposite(Burd and Dreyfuss . 1994). Shamoo etal. (1997)used multidimensionalheteroge neousnuclearNMR inorder[0dete rmin e the solution structure ofhnRNPAI.The twoRRMsstackagainstoneanoth erthrough an antiparall el interac tion of helix B in RRMI andthe correspon dinghelixinRRM2.The glycine-rich regionin theC-terminalregio nof the proteinseemstobeinvolvedin facilitating co- operative bindingof RNAbyahnRNPAl dimer (Dreyf uss,et ct.,1993).

1.3.6 Glycine Loops

Glycine-richregionsarc:commoninmanyproteinsincludinglocicrins,keratins and in the hnRNP proteins.In mostofthese proteins.glycines composeabout 40%of the regionandarc:interspersed with aromatic amino acids(Steinenet al.,1991).In hnRNPs the glycinerich regionisthoughttobeinvolvedin protein- protei ninteractions.and sometimesin protein-nucleic acidintera ctio ns, as with ImRNP AI(Haynes.1992).

Plantglycin e-richprote ins are verysimilartothe cyanobacterial RNA-bindin g proteins.The plantproteinsaregene ra lly 16-17kDainsize(comparableto the12-14 kDa seenincyanobacterialRNA-binding proteins) andcontain a singleRRM whichis

24

(43)

6O-80"A.identicaltoallother RRMs studied. The plantglycine-richauxiliarydomain containsabout 70% glycines,and10- 15% arginines .Italsocontains a numberof ROO boxeswhichhave previously beendefinedasRNA~bindingdomains(Alba andPages, 1998).The RNA-bind ingproteins in cyanobacteriado nothave the ROO box,but do tend to havefairlyhigh amounts of chargedamino acids,includingargin inesand asparagines(SeeFigure 1.3).

The variabilityin glycine-richregions does [endto be quitehigh,even withina specificgroup of proteins,becausethereis littleevolutionary pressure forsequence conservation ,aslong as the commonstructuralmotifof beingableto formglycineloop s intheinteraction with otherproteinsis maintained (Steinertet al.,199 1).

Whilethe actual function of these proteins isnot known,most of the proteinswith a singleRRM and a glycine-richregionareinducedunder conditionsof cold-shock.In barley,alfalfa,carrotand maize,a numberof proteinsthat contain the RNA-binding domainand glycine-richregionhave beenfound that are producedin responseto cold temperatures(Carpenteret 01., 1994;Hirose,etaI.,(99 3;Ludevid et aI.,1992). Similar proteinsin these organisms,andothers,are alsoproducedin responseto other stresses.

including drought, heavy metalstress and wounding (Dunnet al.,1996) . TheCIRP (Cold InducibleRNA-bindingProtein) protein in mouse,whichcontainsthe same domains, is alsoinvolved in a coldtemperature response(Nishiyama, et al.,1997).The significance of the inductionis not knownsince the proteinlevels in these respo nseshas not been measured(Alba and Pages,1998).

25

(44)

1.3. 7 Evolutio naryTrendsinRNA-Bind ingPrceems

In the far distant past, a cyanobacterium-likeorganism probably formed an endosymbioric-ryperelationship with anothermicro-organism which eventuallyled to the rise of the eukaryotic plant cell. The phylogeneticdata, from 16S rRNA sequences, supportthe hypothesisthatthe plant chloroplastsare one ofthe cyanobacterialsublines of descent and actually shouldbe included with the cyanobacteriaas aholop hy le tic group (Sugitaet al.,1997;Giovannoniet a/.,1988 ). Given the hypothesis that chloroplasts arose from cyanobacteria,the relationship between chloroplast and cyanobacterialRNA~

binding prote ins may be important to understanding the properties ofthe cyanobacterial RNA-bindingproteins.

In support of this hypothesis is the finding thatmany of the genes in cyanobacteria and plants are similar.Thismakes the comparison ofany protein foundin plants with the corresponding protein found in cyanobacteria (orvice-versa) desirable.to see ifthe proteins diverged before orafter the divergence of prokaryotes and eukaryotes, and also to look at the changes brought about through the millennia. Alba and Pages (1998)suggest thattheRRM from an earlycyanobacterium-likeorgan ismmay have been transferred from the endosymbiontto the nucleusof theear ly eukaryote .Thisgene may later have duplicatedand fusedto other genes,giving rise to nuclear-encoded,chloroplast RNA-binding proteins and glycine-richproteins.Support forthe theorythat the R..'l"A- binding proteinsdescend from a common ancestor comes from evidenc eof both the plant and cyanobacterialpo lymer-bind ing experiments. RNA-binding proteins from both types

26

(45)

oforgani s ms have astro ngpreferenceforbindingtoG andUnucleotide tracts (Ye and Sugfura,1992;Ludevid etai,1992;LiandSugiura. 1991).

Topological datafor the RNA-bindin g domain argue that the domainisancient.

Thedomain formsaglobular structurewith a conserved three-dimensional shape even between suchdiss imilarproteins assnRNPUIAand hnRNP Cwhichshare only20010 sequenceidentity.Tellin glythough,theidentity betweenthesetwoproteinsisfoun d mostlyinthehydrophobic residues whichinteract withthe cognate RNAs(Fukami- Koba yashier al.,1993).ManyofthemodemdayRNP-typeRNA.b indingproteinsarose througha combination ofgeneduplicationand intragenicdomain duplication. The phyloge neticdatashowthatsome ofthe RNA-bindingproteinswith multipleRRMs contain more conserv ation betweenthe RRMs ofthedifferentproteins thanbetweenthe RRMsofthe sameprotein (asinthepoly(A )-bindingproteins). Thisindicatesthat domain duplicationoccurred in acommo nancestor andthen eachRR.~evolved inde pendently (Bimey etal.,1993;Fukami- Kobayashies al.,1993).

Theglycine- richregions of plant glycine-rich proteinsand cyanobacterialRNA·

binding proteins arose separatelyfromthe RRMs.Because ofthesimilaritiesbetween the rwotypesof proteins (desc ribedinSection1.3.6),AlbaandPages (1998)sugges ted that thc protein.includinga singleRRM and glycine-ric h region,must bean extremely ancient structureoriginating beforethedivergence ofprokaryotesandeukaryctes.

However,phylogenetic studies by Maruyama et al.(1999) showed that within eukaryotes, theglycin e-richproteinsare monophyletic and compl etely independentofthe cyanobacterial lineage of RNA-binding proteinglycine-richregion. The analysis

27

(46)

indicated thatthe glycine-richdomain was probably addedduringthe divers ification of cyanobac terialRNA-bindingproteins .Thesimilaritybetween the two regions is acase ofconvergentevolution. Thisindicated that chloroplast RNA--binding proteins are not direct descendantsof cyanobacterialRNA-bind ingproteins.butdivergedfrom other eukarycticRNA-bind ingproteinsbeforeeither theduplicationof the RRMorthe additio noftheglycine- richdomain(Maruyamaet al.,1999 ).

1.4 Cold-5 hoc kProteins

Cold-shockproteinsare alsoof intere st becau setheydemonstrat e convergent evolutionwithRNA-bindingproteins. Bothpro teinfamilies contain RNPIand RNP2 sequences as wellasmanyofthe basicandaromaticaminoacidsthat form theRRM.

Both coldshock proteins and cyanobacterialRNA-binding proteins also have a glycine rich region(with the exceptionof RbpBinAnabaena7120 and RbpD inAnabaena variabilis)(Maruyamaelaf.,1999;Graumann andMarahiel,19963). Howe ver.the remai nder of the proteinshave linlein commo nwithone another in terms of sequence andtopology.The differencesin theremainderof the proleinsindicate thatthedomains haveconverged towardthe same function rather than having diverged from asingle ancestralprotein(GraumannandMarahiel, 199 6b).

Infact,threefamilies ofproteinshavebee n found mat containdomainswiththe RNPIandRNP2 seque nces. These familiesarethe coldshockproteins(Schnuchel, 1993; Landsman,1992).the RNA- binding proteins,andthebacterialRho factors.Inall threefamilies.theactivedomains containthe RNPmotifsontwospatiallyconserved p-

28

(47)

strands formingpartof an anti-parallel13-sheet (Schindeline.Ial.,199 3).Graum ann and Marahiei (1996b)proposed thatselection pressurehascreated a13-strand surface toallow single-stran ded oligonucl eotidebinding.where thebasic aminoacid residues attrac tthe negativephosphatebackbone oftheoligonucl eoti de.The aecmancresidues stackwith thebases,andthere areanumberofglycineresiduespresentcoallow close associationof the protein andoligonucleotidesequenceto facilita tespecificeeco gnitio n.

Both RNA.bindi ngproteins from cyanobacteriaand tilecoldshock proteins have experienced some degree of convergentevolutio n from the fumctionalperspective , aswell as from sequence speci ficity.Proteinsin both familiesare indu ced during a dropin temperature . There isalso some spec ulationthatproteinsin boothfamiliesmay operate as molecularchaperones(Maruyama etal.,1999; Sato.1995)_ Interestingly.one of the chloroplastRNA-bindingproteinsalsocontains a glycine-riojaregion.andisinvolv ed in responseto various stresses.

Someauthors (Graumann and Marahiel,1996a;Sate.1995) haveproposed that the cyanobacterialRNA·bindingproteins mightbethefumctlcnalequivalent of the bacterial coldshoc k proteins.Lending creden ce to thisspeculati on isthe factthat no cold shoc k proteinshave:been foundincyano bacte ria to date,and v-ice-versa,

The vast majori ty ofthestrainstested(Mulliganelal .,(994) havemultiple copies ofgenesencodingRNA-bindingproteinsintheir genomes. Grauman nandMarahie l (1996a) hypoth esisethat cold shockismorelikelyto occur and maypresenta greater obstac le to singlecell micro-o rgan ismsthan doesheat shock. Ha vingmultiple copiesof the cold shockgeneswould allowcoldshock adaptation evenifseveralofthegenes we re

29

(48)

knockedout. This same logicseems to holdfor theRNA.bindingproteingenesin cyanobacteria

1.S Intdns l.s . l GCDenl

Internsareprotein inrrcnsthat are encodedwithinthcamino acidsequenceof other proteins . Theyhavebeenfoundin mycobact eria.thennophi licarchaebacteria, yeast,chloroplasts(Pietro kovs ki, 1996), andmore recentlyin bacteriophage(Lazarcvic et al.,1998;Derbyshire andBelfort,(998).A singlegeneencodestheseq uencefortwo prot einswhich are transcrib edand translated together. Theintern alproteinsegment, or inrein (Perteret al.,1994),isprecisely excised from the N·and Ccexteins,usually resultingina functionalprotein being released from theprecursor protein.The N· andC- exteins ligatetogether tofonn a functionalproteinfrom theprecursorprotein (Clarke, 1994;Chong et al.,1996).

Many of the excisedlntelns act as homing endonucleases that catalyse the lateral transferofthe DNA sequence fortheimein intointeinlessallelesofthe gene. This endo nuclease activity isunrelated tothesplicin greaction impleme nted bythe intein (Xu, et ai.,1994;Clarke,1994;Chongetal.;(996).Whiletheamino acids required forthe splicing of theextein arepresent on the N-andC-tenni nalendsofthe lntein, the endonucleasedomain tends to beinthe centreof the intein(InBase:http://www.neb.com!

neblinteinslint_intro.html ).

30

(49)

1.5.2 Rational e(orthePlacemento( Inleins

There isanongo ing debat eabout whether inteins provide some sortof evolutionary advantagetothe gene.or whetherthey are molecular parasitesthat spread byduplicatingthemselves into Imeinless alleles ofthegenesin which they reside. lfthe introd uction ofan intein conferredaselectiveadvan tage.thenit wouldaccount forthe persistenceof inteins.If the imeins were molecular parasites. itwouldexplainthefast andefficientsplicing of themteins,asthis would provideminimaldisruptiontothe infectedgeneproduct. Spreadi ngintoinreinless alleleswouldincreasethesurvival chancesoftheparasite, explainingthe endonucleaseactivity(Pietrokov ski,1996).

In over70%oftheinteinsidentified,thespliced extelns make up a proteinthatis invol vedinDNA metabolismof some sort(DerbyshireandBelfcrt, 1998;Chong etal., 1996).Knowing that lnteins areveryefficientatspl icingoutofthehostpro teinsothat theydonot disruptthe functionoftheextelns, thequest ionarises astowhytherange of imein-cc ntain inggenes is so smal l.remaining mostly inthese metabolicgenes. Four reasonshave beenputforwardtoexplai nthenarrowness of range.The:firstis that the presence ofthe intein may confer a selective advantage to the organismby residing in thesegenes .However, thenature oftheadvantage has yettobedetermined.The second isthatcertai n DNA structuresprese nt onlyin these genes may facilitateentryofthe DNA encodingthe inrein. Thethirdisthatthesitescodingforinteinsequencesmight not read ilytoleratetheremoval of theDNA becauseof thechance ofimpro perexcision.

Fourthly,mostoftheplacesin whichinteinencodingDNA exists are geneswhichcode

1I

(50)

duplicatedfunctions,and which maynotupsetthe cellmuchifthe integrity of the expressedproteinis affected (Derbys hireand Belfort,1998).

1.5,3 MechanismofIntein Exc ision

Comparison ofthesplicejunctionsininteins showsa numberofconserved amino acids whichareinvolved in thesplicingreaction. There is a thiol- orhydroxyl-containing Cys, Thr or Ser residue at the upstream and downstream ends of the inteins.Inteinsfrom thermop hilic archaebacteria generally contain serine or threonine, whilethose from the mesophilicbacteria generally containcysteine. There is also gene rallya dipeptide motif, His-Asn,at the C-terminus of the intein precedingthe thiollhydroxylposition. The dipeptide is generally precededby a numberof hydrophobicresidues (Xu et al., 1994 ).

Most of the originalwork onthemechanism of intein splicing was done using the extremelythermophilic archaebacreriumPyrococcus sp.GB·D (whichgrowsat 95°C to 104°C (Xu et01.,1994». Intein-co ntaininggenes from this species werecloned into an E.coliexpression system and theintein precursors isolated.Each of the intermediates could be isolatedby carrying outin vitroreactions atlow temperature(12 to 15°q, and then thesplicingrea ction could be observedby raising thetemperature (Chonget01., 1996). However,ifthe inteinsplicingmechanismwas to be used as a method to express proteins from mesophilic organisms, theextre mes in temperatures required by the thermophilicinteinswould be detrimental. Instead, the resultsfromPyrocaccus sp GB-D were used as a guide to deduce the splicingmechanism in mesophilicorganisms.

32

(51)

Themechanism oftheexcis ion process for amesophilic intein isshowninFigure 1.4.Thefirststep involves theformationofathioesterintermedia te throughanN·Sacyl rearrangementatCyslin theupstream splice junction (Shao etal..1996). The second stepcreatesa branchedintermediate througha transthioesterificationreaction. This is followed byaveryfast eyclisaticnof Asn454(formingsucc:inimide)which allows the imein 10excisefrom the proteininthethirdstep. Step 4 consistsof an S-Nacyl rearrangemen t,so thatthe N· andC-exteinsarenow joinedby a peptidebond;the succinimlde alsohydro lysesback toAsn454(XuetaJ.,1994).

1.5.4 InleinsinCyanob act eri a

Recently, tWO inteins have been found in the cyanobacterial strain Synechacysttssp.

p ce

6803. Oneis in the dnaB gene (Pietrokovski,1996),and theother isa splitintein in the dna£ genes(Wuet aJ.,1998).These arethefirst inteins to have been foundin eubactenaoutsideof the Mycobaclerium genes.

TheDnaBinteinin Synechocystis shares the same integration point in the centre of15 conserved amino acidswiththeDnaB imein in the chloroplastof the red alga Porphyrapurpurea.Although there areanumberof silent substitutions in thenucleo tide sequence of theintegrati on area, thepresence of the inteinmightrepresent asinglc evolutionaryevent.Redalga arethought tohaveevolv edfromcyanobacteria1.25-2.1 billionyears ago.Thisimpliesthatinteinsarcextremely ancientand alsothatthe DnaB inteinshavesurvived in theirhostsavery long time (Pietrokovs kl, 1996).

J3

(52)

Figure 1.4: Schematicdiagram of themechanismof intein splicing .The

rust

residue of theIntein isdes ignated Cys l;the lastresidueis Asn454 ; positionsarethoseof the S. cere visiaeVMAintein.The firststepof inte inremovalinvolvesthe formationofa thioesterintermediate through anN·Sacyl rearrangement at Cystintheupstreamsplice junction. The second step creates a branched intermediate through a transthioesterificationreactionwithCys455.This isfollowedby a very fastcyclisatio n of Asn4 54(fonning succinimid e) whichallowstheintein toexcise from the protein inthe third step. Step4 accounts foran S-N acyl rearrangement. so that the N-andC-exteins arenowjoinedby a peptidebond;thesuccinimide alsohydro lyses back to Asn.

Mutation ofAsn45 4toalanine (N454A) can preventthe cyclisationstep,thus preventing thereleas eoftheinteinfrom theCcterminalextein,afeature usedin the isolationof proteinsusin gtheIMPACTIsystem(Chonger01.,1997 ).

(53)

1

1~SWeN-S acy l re" efT ano _me"'

I

sw ea riflc8tion to

Tr ..n$thio.S~~d intermed,ate

ft).mabran...

HS~

HN Inle;n

, NH

Su=,"'m~. / 0

hydrolysI s

HS~ ll

H.N ~

Step4;

1

N_~.'" ~~~:::::::::I

" HI'

' " S-Nac ylrearrangement

15 Sp liced." I..ins

(54)

As fortheOnaE intein, it was thefirstsplitlnte ln tohoefound.TheN-extein and portion ofintein areco ded by onestrand of ON A whilethe Cc-exteinand portionofintein arefound 745 226 base-pairsaway and are coded by the oppositestrandof ON A.After translation ofthe two genes, theproteinsundergoa trans.splie=ingreactionso that the two exteinsfo rm oneprotein . Thishas importantim plicatio ns for inteinevolution. The intein probablyarose from acontinuo us irueinthatlost its continuityduringa genomic rearrangement. Italso showsthat inteinscan havetran:;;--spli cin gactivityevenin biolo gical systems.The split inteinmayrepresenta novel mechanism for reg ula ting expre ssion of the OnaE protein (Wuet ai.1998).

1.5.5 Inteinsfor Protei n ExpressionSyste ms

Purification of recombinant proteins through the crse of affinitytags is a co nven ie ntandwide lyusedtechno logy. Some examplesolf this include themaltose- binding proteinsystem, glutathioneSctransferaseandpolyhisaid ine systems. How ever.

followingmost ofthe protein purification procedures.thetag mustbecleaved from the large r protein. Theproteases used in theseprocedure sare nestalwaysspeci fic and may cleaveataseco ndarysite as wellas theinte ndedsite. Many 0 fthe proteases also require elevated temperatures which mayaffectthe stabilityoftheprotein. Somet imescleavage is madeim possib le by secondary structure s in the protein.

Inrein s provid eanefficient way ofavoidingthese problemswhilestill providing theadvantagesofaffinity chromatography.The inclusionof an affinitytagin plac e of theOexteinofthe protein allowstilepurificationof the protein (C ho nget al.,199 7;

36

(55)

Severinov and Muir,t998). If the proteinof interest is fused to the inteininplaceof the Ncextein,thenthe intein cleaves the larger proteinat thecorrec tsitewithoutrelyingon a protease or chemical to do the cleaving. Preventingthe cyclisa ricnofAsn454 by muta tin gitto an alanine (N454A) (Chonget at.,(9 97),prevents the release of the intein

from the Ccrermlnalaffinity tag, a feature used inthe isolationof proteins using the IMPACT I (Inrein MediatedPuri fica tion with an Affinity Chitin-bind ingTag ) system.

RbpD fromAnabaena 7120 was expressed using the IMPACTI system from NewEngland Biolabs(1997).This system makes use of theinte in from the vacuolar ATPasesubunit(VMA) ofthe yeastSaccharomycescerivisae, andincorporatesthe use ora chiti n-bindingdomain inthe C-exteinposition as an affinitytag (Chonget aI.,1997;

New EnglandBiolabs,1997).

1.6 SELEX

In1990,threela bs independently developed ways to simultaneouslyscree n over lOISdifferentnucleic acid sequencesin order to select for different functionalities (Klug and Famulok,1994 ). "In vitro selection"was developedby

a.F.

Joyce,"in vitro evolution"was developed by J.W. Szostakand "SELEX"(SystematicEvol ution of Ligands using EXponential enrichment)was developed byL.Gold.

The theory behind thein vitro selectiontechniquesis fairly straightforward.The firststepof the processisto create a poolof oligonucleotidesfor selection,usinga DNA synthesiser.The oligonucleotides generallycontain a fullyran do m sequence flankedby definedprimerbindingsites. The oligonucleo tidesand the moleculeapplyi ngthe

37

(56)

selectionpressureareincubatedtogether .atwhichpoint the active apramersare isolated.

The aptarnersaresubject ed10reversetranscription-polymerase chain reaction(RT- PCR) inordertoamplifythose sequences thalbound .Subsequ ent roundsofselecti o n allowthe sectionof increasingly specificRNA species(Go ldet ot.,1993;Keene . 1996;Ouellette andWright. 1995;Tue rkandGold.1990).The systemas appliedtoRbpDis shown in Figure1.5.

In vitroselectio n techniq uescan be usedfor a number of purposes. They can be usedtofindsequences of RNA that will bindto certain proteins,and from these sequences the secondaryor tertiary structure thatthe RNA mustadoptforbindingcanbe determi ned. These methods have evenbeen used to selectfor ribozym cssuchasRL'lA- ligase ribozymesand RNA-cleavageribozymes(Lerschand Szostak.1996).

The techniqueshavefound a potentialdiagnos ticuse in measuring the levels of therapeuticdrugs (Allenet of..1996;Jenisonetal.,1994 ). Thecphyllin is used in patientsfor thetreatment of asthma.bronchiti sand emph ysema,butitis toxicathigher levels. Thetraditional way ofdetectin g the drug has beenwithantibodi es. but mon oc lonalantibodieshad the problemof cross-rea cting with caffeineand theobrom ine.

Invitro selecti on isolated anRNA sequencethat canbind totheophyllinwithato-fold highe rspecificity thantheantibody(Jenisonetal.,1994).As well,theRNAligands were negat ivel y selectedfor byrunning thetheoph yll ineaptamersovera column with caffeineattachedtothematrix,thus removingthecross-reactingRNAs(Goldetaf., 1995).Thistypeof detectionmightbeuseful for other drugsas well,orfor substances whichhave little antigenicity(Goldet al.,1993 ).

38

(57)

Figure1.5 : Schematicdiagram illustratingthetheory of SELEX.Anoligonucleotide (SLN7.l ) containinga T7 promoter(T7Pro)is hybridizedto theSELEXtemplatewhich containsa numberof randomnucleot idesinthemiddleportion. Klenow DNA polymerase is used toextend the 5LN7.1oligonucleotide.creating adouble stranded template.T7 RNA polymeraseisthenusedtotranscribeRNA from thetemplate.The RNAisisolatedandsubj ectedtobinding by RbpDin a nitrocellulosefilterbindingassay.

Bound RNA isisolatedfromthefilters. and reversetranscribed usingSuperscriptll (G ibeo BRL).peRisusedtoamplifythe cDNA containing the bound sequences using theSLN7.1 and3LN7.1.oligonuclotides as primers. Theamplified fragments are subjec tedtoinvitrotranscriptiontoinitiate thenextround ofSELEX(TuerkandGold, 1990 ).

(58)

~ .;

~ ~

00

n H g

~ ~

gl~~

~I .... ~ l

-.

i

!~t jt ~~ H H t 1

40

(59)

In vitro selectionhas beenuseful for the generation of ribozymes .This method relies on the changethatthe ribozymebrings about to identifyactive aptamers. One examplewas the isolationof an ATP-dependentkinase ribozyme (Lersch and Szostak, 1994).Inthis experiment, a sequence containingtwo constantregions of RNA, which madeup an A'TPcbindingdomain, and three random portions of RNA were used. The moleculesalso contained two primer-bindingsites atthe 5'·and)'·ends.The RNA was incubated with ATP-y-Sand then with activated thiopropyl agarose. Those RNA sequences forming active kinase-ribozymes formed a dithio-linkage through the y-th iophos pbate to which they had attached themselves. Since the active ribozymes were thus attached to the column,the inactiveRNA sequences could simplybewashed away.

l3-mercaptoethanol was usedto elute the active ribozymes.

Oneof the more recentadvances in SELEX has been the use of genomic SELEX.

This method creates the starting library from the organismofinterest so that the best aptamers found willcorrespond to those sequences available to the proteinin vivo (Gold et at.,1995; 1997).Thelibrary consists of sequences derived from the genome(starting from every nucleotide ofthe genome),flanked by fixed regionsto allow peR amplification(Singer et al.,1997). This adaptationof SELEX allowsresearc hers to be more confident that the sequences they are isolatingare recognised in vivo by the protein.

One of the problemswith in vitro selectionis that thelength of random nucleotides that can be synthesised is limited.However,this problem has been addressed withthe use of mutagenicpeRtointroduce additional mutations.If manganese ions and different ratios of deoxynucleosidetriphosphates are introduced, then Taq polymeraseis

41

(60)

forcedtonus-replicate the templateDNA. Inthecourse of thepeRsteps,additional mutationsareintroduc ed so that overmany rounds of in vitroselection,aptam eric species appearand then disappearastheyare replaced with more efficientRNA sequences (Klug and Famulok., 1994;Lersch and Szostak, 1996; SzostakandEllington,199 3).

A second limitationto in vitro selection methodsisthat some sequencesare not reverse transcribed well because ofhighle vels of secondaryor tertiary structure in the RNA.This introd ucessome bias tothe population of RNA moleculesthat are available forselectionandbindin g. Asa result, somesequencesmay be out-c o mpetedeven though theybind theprote in stro ng ly.PeR alsointroduces some bias sincesomeseque ncesdo not replicateas fastasothe rsunder the conditions af thepeR.The selectioncondi tion s themselvesalsoaffecttheresults.Varyin gthe saltconcentrat ion,thebuffer compos ition and eventheelution volumecanalter the resu lts ofthe select ion(Klug, andFamu lo k, 1994 ). Finally, smal l amounts of ligand require elutio n of thebound. RNA by denaturation. Thiscanleadto artefacts beingfonned when RNA bindsto thematrix.

especiallyif nitroe e lluloseis used as the matrix.Ifthishappens.thenmost of the species amplifiedfor the nextround \ViII be specificforthe filterrather than the moleculeor protein that is beingtargeted(Klug and Famulok., 1994).

In vitroselectionprocesses do havethe advantagethattheyintrod ucetheleast bias ofanymethod of selectionknown (Schneideretal.,1993 ). Amore important advantag e to theseme thods is that the processe s,with their multiplerounds of amplification, canbeappliedto almos t any conventionalpurifi cationscheme.Themost common schemes adapted to using the selectionand amplification are affinity

42

(61)

chromatograp hy,filter binding,gelmobility shift andimmunoprecipitation (Szostak and Ellington,1993). This makes in vitro selectionextremelyflexibleand convenientto apply to RNA-ligand problems.Mostimportantlythough.thesemethodsdo notrely on any knowledgeaboutthefoldingof the RNA. Asthe structuresfor moreaptamers are solved ,more complexstructures,which form as a resultofnon-can onicalbas e pairing , have been found.Secondary structures such as bulges,pseudo-knotsand 1-3-2 stacks (stackinginteractions betwee n threeadjacentnucleotides,where the bendis so sharp that the third nucleotideliesbetweenthe firsttwo)have beenfound (Gold,eta/.,1997;Davis etat.,1996).

1.7 Aims

The aim ofthis M.Sc .projectwas first to isolateand expressboth wild-typeand His-taggedRbpl), and then start tocharacterisethese proteins. The second goalof this studywas tobegintocharacterise RbpD in orderto determinationits function in the Anabaena7120 cell. Characterisationstudiesofthe wild-typeproteins involvedthe determinationof a bindingconstant forRbpD,and determining an RNA sequence to whichRbpD will bind.We also wantedtodeterminethe effectsof adding a tag to RbpD, andif possible,determine the in vivo and invitro effects ofremovingtheglycine rich regionofRbpD. Theexamination ofRbpDinAnabaena 7120 will add to theknowledge of theroleof RNAbindingproteins in cyanobacteria.andalsotothe knowledgeof why differentdomains ofthe proteinare required.

43

(62)

Chapter 2:

Materials and Methods

(63)

2.1 Mat erials

All chemicals were purchased from eitherSigma Chemicals orFisher Biotech and were reagent-gradeorbener.Media components werepurc hased fromDifco. Restriction and modification enzymes were purchased from MBIFermentas, New England Biolabs, Pbama cia-Am ers ham,Pro mega or GibcoBRL.The enzymeswere used according to the specifica tionsoftheman ufac turer . Oligon ucleotideswere synthesisedbyGibco BRL, Cortec(Queen'sUniversity,Kingston),or Opero nTechn ologies (California).

2.2 C10RingandCu ltu ringMet bods

All plasmidsused inthisworkareshownTable 2.1.and allstr ainsofEscherichia coliusedfo rdoningare shown in Table2.2.

2.2.1 Media:

E:colistrains were grown in LB broth (10gilBactctryptcne;5gilYeast Extract;

10gil NaC!. pH 7.5).Plateswere made by adding 15 g Bacto-Agar (Sambrooketot.:

1989). Antibiotics wereused in the following concentrations:ampicillin,carbenicillin.

and ticarcillinal100 Jlglml,tetracycline at 15J.1g1ml.kanamycin ar100 J.1g1ml. and chloramphe nicolat 50J.1g1ml.

45

Références

Documents relatifs

Escherichia coli-derived OMVs contain RNA We hypothesized that bacteria release intracellular RNAs into their extracellular milieu, either through the shedding of OMVs or by

23 LOPEZ P.F., SIPPY B.D., LAMBERT H.M.ET AL TRANSDIFFERENTIATED RETINAL PIGMENT EPITHELIAL CELLS ARE IMMUNOREACTIVE FOR VASCULAR ENDOTHELIAL GROWTH FACTOR IN SURGICALLY

Le croyant sait que Dieu a suscité les techniques de l'art, non pas seulement pour sa gloire aussi, mais pour sa gloire d'abord: pour que les fidèles puissent vivre leur

Figure 1: Représentation graphique proposée par le package Capushe pour vérifier la qualité des résultats obtenus par la méthode d’estimation de pente guidée par les données.

Total particle number concentrations and size distributions were measured during different stages of the assembling process to show that the SLA 3-D printed generator did not gener-

trochimiques classiques qui sont de type métall igue (.::;s Ul:dll: une bonne conduction électronique), notre matière active étan d'origine organique (peu

Joëlle Flamand Villeneuve Amélie Fournier Line Guénette Christine Hamel Élisabeth Hébert Francis Lachance Vincent Leclerc Thomas Lefebvre Louise Mallet Josianne Malo

Cette ca- ractéristique nous autorise à dire de notre revue qu’elle est « libre d’accès », comme la revue PLoS Medicine et. plus de 6000 revues