HAL Id: hal-00532430
https://hal.archives-ouvertes.fr/hal-00532430
Submitted on 4 Nov 2010
HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological
precipitates using virus-specific antibodies
Dirk Schaudien, Stephanie Schwab, Sonja Linke, Frank Seeliger, Georg Pauli, Wolfgang Baumgärtner, Christiane Herden
To cite this version:
Dirk Schaudien, Stephanie Schwab, Sonja Linke, Frank Seeliger, Georg Pauli, et al.. Lack of de- tectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological pre- cipitates using virus-specific antibodies. Veterinary Microbiology, Elsevier, 2008, 132 (1-2), pp.171.
�10.1016/j.vetmic.2008.05.007�. �hal-00532430�
Accepted Manuscript
Title: Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological precipitates using virus-specific antibodies
Authors: Dirk Schaudien, Stephanie Schwab, Sonja Linke, Frank Seeliger, Georg Pauli, Wolfgang Baumg¨artner, Christiane Herden
PII: S0378-1135(08)00187-9
DOI: doi:10.1016/j.vetmic.2008.05.007
Reference: VETMIC 4035
To appear in: VETMIC Received date: 28-12-2007 Revised date: 24-4-2008 Accepted date: 5-5-2008
Please cite this article as: Schaudien, D., Schwab, S., Linke, S., Seeliger, F., Pauli, G., Baumg¨artner, W., Herden, C., Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological precipitates using virus-specific antibodies,Veterinary Microbiology(2007), doi:10.1016/j.vetmic.2008.05.007
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Accepted Manuscript
Short communication 1
2
Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with 3
immunohistological precipitates using virus-specific antibodies 4
5 6 7 8
Dirk Schaudiena, Stephanie Schwaba, Sonja Linkeb, Frank Seeligera, Georg Paulib, 9
Wolfgang Baumgärtnera*, Christiane Herdena 10
11 12
a Department of Pathology, University of Veterinary Medicine Hannover, Bünteweg 13
17, D-30559 Hannover, Germany 14
b Centre for Biological Safety (ZBS 1), Robert Koch-Institut, Nordufer 20, D-13353 15
Berlin, Germany 16
17 18 19
Keywords: immunohistology, molecular mimicry, RT-PCR, West Nile virus 20
21 22 23
*Corresponding author and reprint request 24
Wolfgang Baumgärtner 25
Department of Pathology 26
University of Veterinary Medicine Hanover 27
Bünteweg 17 28
D-30559 Hannover, Germany 29
Phone: ++49 (0)511 953 8620
30
Fax: ++49 (0)511 953 8675
31
E-mail: wolfgang.baumgaertner@tiho-hannover.de 32
Manuscript
Accepted Manuscript
Abstract 33
Five dogs and four cats from Germany suffering from encephalitis revealed positive 34
immunoreactivity using two West Nile virus (WNV) specific monoclonal antibodies in 35
brain and in kidney. However, WNV infection could not be confirmed by additional 36
PCR analyses. This study indicated that positive immunoreactivity for WNV in dogs 37
and cats must be interpreted cautiously and should be confirmed by a second virus 38
specific technique.
39
Accepted Manuscript
1. Introduction 40
West Nile virus (WNV), a flavivirus originally isolated in the West Nile destrict of 41
Uganda (Schmithburn et al., 1940), has become an important cause of disease in 42
birds, humans and horses (Eidson et al., 2001; Komar, 2000; Ostlund et al., 2001) in 43
Africa, Asia and the USA (Cantile et al., 2001). In Europe, cases of WNV-infection 44
have been described in humans and/or animals in Spain, France, Italy, 45
Romania, the Czech Republic and recently in Hungary (Cernescu et al., 1997;
46
Cantile et al., 2000; Durand et al., 2002, Del Giudice et al., 2004; Bankonyi et al., 47
2005; Bankonyi et al., 2006; Kaptoul et al., 2007). Though no cases of WNV have 48
been reported in Germany so far (Müller et al., 2006), an increasing incidence of 49
other emerging diseases has been noticed in central Europe in recent years 50
including Leishmaniasis and blue tongue virus infections (Ferroglio et al., 2006;
51
Wilson et al., 2007). Though dogs displayed rarely clinical signs they are 52
commonly infected in West Nile Virus endemic and epidemic regions as shown 53
by serological investigations (Komar et al., 2001). Therefore, WNV-infection in 54
dogs and maybe in cats must be considered as a differential diagnosis in cases of 55
unknown etiology.
56
2. Materials and methods 57
Five dogs (no. 1 to 5) and four cats (no. 6 to 9), between one and nine years of 58
age, displayed neurological disorders due to a meningoencephalitis (Table 1).
59
Morphological and clinical findings have been described in detail recently 60
(Schwab et al., 2007). Formalin-fixed and paraffin-embedded brain and kidney 61
tissue of these animals were available for further investigations. Equally 62
treated brain tissue from a WNV-infected daw (no. 10; kindly provided by Arno 63
Wünschmann, University of Minnesota, USA) served as positive control.
64
Accepted Manuscript
Immunohistochemistry was performed using two different murine monoclonal 65
antibodies directed against the major envelope protein E (MEP-E; diluted 1 : 66
300; clone 3.67G; Millipore Corporation, Germany) and the non-structural 67
protein 1 (NSP-1; diluted 1 : 400; 3.1112G; Millipore Corporation) as described 68
(Hall, 2000; Schwab et al., 2007). Briefly, after pre-treatment with pronase E and 69
incubation with the primary antibody a biotin-conjugated goat-anti-mouse 70
antibody (Vector Laboratories Inc., Burlingame, USA) was applied. The antigen- 71
antibody complex was visualized using the avidin-biotin-complex (ABC) 72
method (Vector Laboratories Inc., Burlingame, USA). Tissue sections were 73
counterstained with Mayer´s hematoxylin.
74
Furthermore, two different RT-PCR techniques, a conventional PCR and a TaqMan 75
real-time RT-PCR assay, were performed. Briefly, RNA was extracted from 10 76
sections of 10 µm thickness of paraffin-embedded brain and kidney tissue of all 77
animals using Trizol® reagent as described (von Smolinski et al., 2005) and purified 78
using the RNeasy Minikit (Qiagen, Hilden, Germany) following the protocols of the 79
manufacturer. After a digestion step with DNase I (Qiagen, Hilden, Germany), RNA 80
was resuspended in 30µl of RNase-free water. For reverse transcription, the 81
Omniskript RT kit (Qiagen, Hilden, Germany) was used (Schaudien et al., 2007).
82
Polymerase chain reaction (PCR) was performed according to Lanciotti et al. (2000) 83
using WNV-specific primers (genebank accession nr.: AF196835; forward primer:
84
tcagcgatctctccaccaaag, position 1160-1180; reverse primer: gggtcagcacgtttgtcattg, 85
position 1209-1229) predominantly detecting the WNV-New York strain (WNV 86
lineage 1). As internal positive control for successful RNA extraction and reverse 87
transcription, the reference gene GAPDH was amplified with specific primers 88
(genebank accession nr.: AB038240; forward primer: gtcatcaacgggaagtccatctc, 89
position 196-218; reverse primer: aacatactcagcaccagcatcac, position 257-279; von 90
Accepted Manuscript
Smolinski et al., 2005). In addition, real-time RT-PCR was performed to detect WNV 91
lineage 1 and 2 as recently described (Linke et al., 2007a).
92
3. Results and Discussion 93
Histologically, a moderate to severe granulomatous, pyogranulomatous or 94
lymphohistiocytic meningoencephalitis with occasionally associated necrosis 95
affecting the grey and white matter was observed (for details see Table 1).
96
Immunohistochemically, WNV specific immunoreactivity was found in the cytoplasm 97
of various cell types including neurons, macrophages, astrocytes and microglia 98
(Table 1; Fig. 1). Additionally, two cats (no. 6 and 7) showed a strong 99
immunoreaction in neutrophils. In all investigated dogs and cats, an 100
immunohistochemical reaction was observed using the anti-MEP-E-antibody (Table 101
1). Surprisingly, after application of the anti-NSP-1-antibody, the brain of one dog 102
(no. 1) remained negative. In one dog (no. 5) and three cats (no. 7 – 9), few positive 103
proximal tubular epithelial cells, glomerular cells and macrophages were found in the 104
kidney using one or both antibodies (Fig. 2). A positive immunoreactivity was also 105
found with both antibodies in the brain and kidney of the WNV-infected daw (no. 10;
106
Table 1).
107
Both WNV RT-PCR assays revealed negative results for all brain and kidney 108
samples of all dogs and cats (Table 1). However, the reference gene GAPDH was 109
successfully amplified in brain and kidney samples of all dogs and cats. As 110
expected a positive WNV signal of 70bp was amplified from the avian brain 111
sample by conventional RT-PCR and 174.4 copy numbers of WNV/5µl cDNA 112
were measured in the real-time RT-PCR (Table 1).
113
In summary, the animals used in this study showed a positive immunoreactivity for 114
WNV using two different virus specific monoclonal antibodies in the brain and kidney.
115
However, these findings could not be substantiated using two different WNV specific 116
Accepted Manuscript
RT-PCR assays. Since it was possible to amply the housekeeping gene in all 117
brains and kidneys investigated it seems rather unlikely that the lack of WNV 118
RNA amplification is due to RNA decay in these samples. However, differential 119
decay of different RNA species and thereby causing a false negative result 120
cannot be excluded completely.
121
In WNV endemic regions, dogs and cats are occasionally infected without developing 122
clinical signs (Blackburn et al., 1989; Lichtensteiger et al., 2003). In Europe, only 123
time- and region-limited WNV outbreaks in Eastern and Southern Europe have been 124
noted so far (Cantile et al., 2000; Durand et al., 2000; Hubalek and Halouzka, 1999).
125
It is assumed that migrating birds are the responsible host for the introduction of 126
WNV to Europe (Rappole and Hubalek, 2003; Zeller and Schuffenecker, 2004). An 127
investigation of birds in Germany revealed a low number of serologically positive 128
avians (Linke et al., 2007b). Therefore, individual WNV-infections of other animals in 129
Germany might occasionally occur in principle. However, the risk for a WNV- 130
epidemic in Northern Europe remains low (Gould, 2003). Climatic changes leading to 131
different mosquito populations might nevertheless increase the risk of a WNV- 132
epidemic in these regions. Although it cannot be ruled out that the animals in this 133
report might represent the first cases of WNV-infection in Germany, findings must be 134
judged carefully and cautious interpretation is required due to the lack of WNV 135
specific RNA.
136
WNV RNA has been detected in other cases of WNV-infection in dogs using 137
formalin-fixed material (Lichtensteiger et al., 2003; Read et al., 2005). However, 138
surprisingly, WNV-antigen was not detected by immunohistochemistry in the brain by 139
applying a polyclonal WNV specific antibody in these reports. Polyclonal WNV- 140
specific antibodies often cross-react with other flaviviruses (Chvala et al., 2004;
141
Kelley et al., 2003; Steele et al., 2000), whereas the monoclonal antibodies specific 142
Accepted Manuscript
for the MEP-E and NSP-1 antigen used in this study showed cross reactivity with 143
Kunjin virus, a subtype of the WNV lineage 1 (Hall, 2000; Scherret et al., 2001).
144
Both antibodies used in the present study are frequently used for diagnostic 145
purposes including the epitope-blocking enzyme-linked immunosorbent assay in 146
different investigations (Blitvich et al., 2003). However, we are not aware of any 147
report that mentions the potential cross-reactivity with tissue antigens. Moreover, the 148
affected animals did not react positively for tick-borne encephalitis virus antigen using 149
a polyclonal antibody which cross-reacts with other flaviviruses (Schwab et al., 2007).
150
Therefore, we assume that the immunohistochemical precipitates obtained by the 151
WNV-specific antibodies were most likely due to molecular mimicry, a phenomenon 152
reported for various viruses including Japanese encephalitis virus, which belongs to 153
the Flaviviridae (Oldstone, 1998; Sheshberadaran and Norrby, 1984). In addition, the 154
inflammatory changes of the affected animals in this study consisted of 155
granulomatous and pyogranulomatous reactions. The latter have not been described 156
in context with West Nile virus infection. However, similar changes are reported in 157
the dog as an entity termed idiopathic granulomatous meningoencephalitis (GME;
158
Kipar et al., 1998). A disease complex of unknown etiology. Pathogenetically a 159
delayed type hypersensitivity reactions has been assumed. This further underlines 160
the assumption that the immunohistologically recognizable precipitates are not due to 161
a viral antigen-antibody specific reaction but rather a sequel of molecular mimicry of 162
host derived antigens. However, it remains to be investigated whether both 163
antibodies targeting different peptides of WNV can bind to similar or different 164
cellular antigens. This could explain both similarities and differences in the 165
immunoreactivity pattern of both antibodies (Table 1).
166
Accepted Manuscript
In conclusion, immunoreactivity obtained by WNV-specific monoclonal antibodies in 167
dogs and cats must be interpreted cautiously and needs to be substantiated by other 168
techniques such as RT-PCR.
169 170
References 171
Bakonyi, T., Hubálek, Z., Rudolf, I., Nowotny, N., 2005. Novel flavivirus or new 172
lineage of West Nile virus, central Europe. Emerg. Infect. Dis. 11, 225-231.
173
Bakonyi, T., Ivanics, E., Erdélyi, K., Ursu, K., Ferenczi, E., Weissenböck, H., 174
Nowotny, N., 2006. Lineage 1 and 2 strains of encephalitic West Nile virus, 175
central Europe. Emerg. Infect. Dis. 12, 618-623.
176
Blackburn, N.K., Reyers, F., Berry, W.L., Shepherd, A.J., 1989. Susceptibility of dogs 177
to West Nile virus: a survey and pathogenicity trial. J. Comp. Pathol. 100, 59-66.
178
Blitvich, B.J., Bowen, R.A., Marlenee, N.L., Hall, R.A., Bunning, M.L., Beaty, B.J., 179
2003. Epitope-blocking enzyme-linked immunosorbent assays for detection of West 180
Nile virus antibodies in domestic mammals. J. Clin. Microbiol. 41, 2676-2679.
181
Cantile, C., Di Guardo, G., Eleni, C., Arispici, M., 2000. Clinical and 182
neuropathological features of West Nile virus equine encephalomyelitis in Italy.
183
Equine Vet. J. 32, 31-35.
184
Cantile, C., Del Piero, F., Di Guardo, G., Arispici, M., 2001. Pathologic and 185
immunohistochemical findings in naturally occuring West Nile virus infection in 186
horses. Vet Pathol. 38, 414-421.
187
Cernescu, C., Ruţă, S.M., Tārdei, G., Grancea, C., Moldoveanu, L., Spulbăr, E., 188
Tsai, T., 1997. A high number of severe neurologic clinical forms during an 189
epidemic of West Nile virus infection. Rom. J. Virol. 48, 13-25.
190
Accepted Manuscript
Chvala, S., Kolodziejek, J., Nowotny, N., Weissenböck, H., 2004. Pathology and viral 191
distribution in fatal Usutu virus infections of birds from the 2001 and 2002 outbreaks 192
in Austria. J. Comp. Pathol. 131, 176-185.
193
Del Giudice, P., Schuffenecker, I., Vandenbos, F., Counillon, E., Zeller, H., 2004.
194
Human West Nile virus, France. Emerg. Infect. Dis. 10, 1885-1886.
195
Durand, B., Chevalier, V., Pouillot, R., Labie, J., Marendat, I., Murgue, B., Zeller, H., 196
Zientara, S., 2002. West Nile virus outbreak in horses, southern France, 2000:
197
results of a serosurvey. Emerg. Infect. Dis. 8, 777-782.
198
Eidson, M., Miller, J., Kramer, L., Cherry, B., Hagiwara, Y., 2001. Dead crow 199
densities and human cases of West Nile virus, New York State, 2000. Emerg.
200
Infect. Dis. 7, 662-664.
201
Ferroglio, E., Romano, A., Passera, S., D'Angelo, A., Guiso, P., Ghiggi, E., Bolla, C., 202
Trisciuoglio, A., Biglino, A., 2006. Dogs' parasite and zoonotic risk: from old to new 203
"emergencies" in the North-West of Italy. Parassitologia. 48, 115-116.
204
Gould, E.A., 2003. Implications for Northern Europe of the emergence of West Nile 205
virus in the USA. Epidemiol. Infect. 131, 583-589.
206
Hall, R.A., 2000. The emergence of West Nile virus: the Australian connection. Viral 207
Immunol. 13, 447-461.
208
Hubalek, Z., Halouzka., J., 1999. West Nile fever--a reemerging mosquito-borne viral 209
disease in Europe. Emerg. Infect. Dis. 5, 643-650.
210
Kaptoul, D., Viladrich, P.F., Domingo, C., Niubó, J., Martínez-Yélamos, S., De Ory, 211
F., Tenorio, A., 2007. West Nile virus in Spain: report of the first diagnosed case (in 212
Spain) in a human with aseptic meningitis. Scand. J. Infect. Dis. 39, 70-71.
213
Kelley, T.W., Prayson, R.A., Ruiz, A.I., Isada, C.M., Gordon, S.M., 2003. The 214
neuropathology of West Nile virus meningoencephalitis. A report of two cases and 215
review of the literature. Am. J. Clin. Pathol. 119, 749-753.
216
Accepted Manuscript
Kipar, A., Baumgärtner, W., Vogl, C., Gaedke, K., Wellman, M., 1998.
217
Immunohistochemical characterization of inflammatory cells in brains of dogs with 218
granulomatous meningoencephalitis. Vet. Pathol. 35, 43-52 219
Komar, N., 2000. West Nile viral encephalitis. Rev. Sci. Tech. 19, 166-176.
220
Komar, N., Panella, N.A., Boyce, E., 2001. Exposure of domestic mammals to 221
West Nile virus during an outbreak of human encephalitis, New York City, 1999.
222
Emerg. Infect. Dis. 7, 736-738.
223
Lanciotti, R.S., Kerst, A.J., Nasci, R.S., Godsey, M.S., Mitchell, C.J., Savage, H.M., 224
Komar, N., Panella, N.A., Allen, B.C., Volpe, K.E., Davis, B.S., Roehrig, J.T., 2000.
225
Rapid detection of West Nile virus from human clinical specimens, field-collected 226
mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J.
227
Clin. Microbiol. 38, 4066-4071.
228
Lichtensteiger, C.A., Heinz-Taheny, K., Osborne, T.S., Novak, R.J., Lewis, B.A., 229
Firth, M.L., 2003. West Nile virus encephalitis and myocarditis in wolf and dog.
230
Emerg. Infect. Dis. 9, 1303-1306.
231
Linke, S., Ellerbrok, H., Niedrig, M., Nitsche, A., Pauli, G., 2007a. Detection of West 232
Nile virus lineages 1 and 2 by real-time PCR. J. Virol. Methods 146, 355-358 233
Linke, S., Niedrig, M., Kaiser, A., Ellerbrok, H., Muller, K., Muller, T., Conraths, F.J., 234
Muhle, R.U., Schmidt, D., Koppen, U., Bairlein, F., Berthold, P., Pauli, G., 2007b.
235
Serologic evidence of West Nile virus infections in wild birds captured in Germany.
236
Am. J. Trop. Med. Hyg. 77, 358-364.
237
Müller, H., Johne, R., Schusser, G., Giese, M., Linke, S., Pauli, G., 2006. West Nile 238
virus--causative agent of a zoonosis with increasing significance? (in German) 239
Dtsch. Tierarztl. Wochenschr. 113, 435-439.
240
Oldstone, M.B., 1998. Molecular mimicry and immune-mediated diseases. FASEB J.
241
12, 1255-1265.
242
Accepted Manuscript
Ostlund, E.N., Crom, R.L., Pedersen, D.D., Johnson, D.J., Williams, W.O., Schmitt, 243
B.J., 2001. Equine West Nile encephalitis, United States. Emerg. Infect. Dis. 7, 665- 244
659.
245
Rappole, J.H., Hubalek, Z., 2003. Migratory birds and West Nile virus. J. Appl.
246
Microbiol. 94, 47-58.
247
Read, R.W., Rodriguez, D.B., Summers, B.A., 2005. West Nile virus encephalitis in a 248
dog. Vet. Pathol. 42, 219-222.
249
Schaudien, D., Baumgärtner, W., Herden, C., 2007. High preservation of DNA 250
standards diluted in 50% glycerol. Diagn. Mol. Pathol. 16, 153-157.
251
Scherret, J.H., Poidinger, M., Mackenzie, J.S., Broom, A.K., Deubel, V., Lipkin, W.I., 252
Briese, T., Gould, E.A., Hall, R.A., 2001. The relationships between West Nile and 253
Kunjin viruses. Emerg. Infect. Dis. 7, 697-705.
254
Schmithburn, K.C., Hughes, T.P., Burke, A.W., Paul, J.H., 1940. A neurotropic virus 255
isolated from the blood of a native of Uganda. Am. J. Trop. Med. Hyg. 20, 471-492.
256
Schwab, S., Herden, C., Seeliger, F., Papaioannou, N., Psalla, D., Polizopulou, Z., 257
Baumgärtner, W., 2007. Non-suppurative meningoencephalitis of unknown origin in 258
cats and dogs: an immunohistochemical study. J. Comp. Pathol. 136, 96-110.
259
Sheshberadaran, H., Norrby, E., 1984. Three monoclonal antibodies against measles 260
virus F protein cross-react with cellular stress proteins. J. Virol. 52, 995-999.
261
Steele, K.E., Linn, M.J., Schoepp, R.J., Komar, N., Geisbert, T.W., Manduca, R.M., 262
Calle, P.P., Raphael, B.L., Clippinger, T.L., Larsen, T., Smith, J., Lanciotti, R.S., 263
Panella, N.A., McNamara, T.S., 2000. Pathology of fatal West Nile virus infections 264
in native and exotic birds during the 1999 outbreak in New York City, New York.
265
Vet. Pathol. 37, 208-224.
266
von Smolinski, D., Leverkoehne, I., von Samson-Himmelstjerna, G., Gruber, A.D., 267
2005. Impact of formalin-fixation and paraffin-embedding on the ratio between 268
Accepted Manuscript
mRNA copy numbers of differently expressed genes. Histochem. Cell Biol. 124, 269
177-188.
270
Wilson A., Carpenter, S., Gloster, J., Mellor, P., 2007. Re-emergence of bluetongue 271
in northern Europe in. Vet. Rec. 161, 487-489.
272
Zeller, H.G., Schuffenecker, I., 2004. West Nile virus: an overview of its spread in 273
Europe and the Mediterranean basin in contrast to its spread in the Americas. Eur.
274
J. Clin. Microbiol. Infect. Dis. 23, 147-156.
275
Accepted Manuscript
Figure Legends:
276 277
Fig. 1. Immunhistochemical reaction of West Nile virus specific non-structural protein 278
1 antibody in the brain of a dog (animal no. 4).
279
Positive precipitates in the cytoplasm of neurons (arrows), avidin-biotin- 280
complex (ABC) method, NSP- 1 antibody 281
282
Fig. 2. Immunhistochemical reaction of West Nile virus specific major envelope 283
protein E antibody in the kidney of a cat (animal no. 7).
284
Positive precipitates in cells of renal glomerula, avidin-biotin-complex (ABC) 285
method, MEP- E antibody 286
Accepted Manuscript
Figure
Accepted Manuscript
Figure
Accepted Manuscript
Table 1: Summarized histological, immunohistological and RT-PCR findings in dogs and cats with immunoprecipitates in brain and kidneys after incubating with West-Nile specific antibodies
Immunohistochemistry RT-PCT
animal Histopathology MEP-E antibody NSP-1 antibody conventional real-time
no. species of brain brain kidney brain kidney brain kidney brain kidney
1 dog moderate, multifocal, lymphohistiocytic to granulomatous,
perivascular meningoencephalitis
cytoplasm of neurons and macrophages
/microglia
- - - - - - -
2 dog severe, multifocal, granulomatous to
necrotizing meningoencephalitis cytoplasm of
pyramidal cells - cytoplasm of pyramidal cells and macrophages
/microglia - - - - -
3 dog
severe, periventricular, granulomatous encephalitis and mild,
multifocal, lymphoplasmacytic chorioditis
cytoplasm of
pyramidal cells - cytoplasm of pyramidal cells and macrophages
/microglia - - - - -
4 dog severe, multifokal, granulomatous encephalitis in the brain stem with
mild, multifocal necrosis
cytoplasm of pyramidal cells
and macrophages
/microglia
- cytoplasm of
macrophages/microglia
and neurons - - - - -
5 dog severe, multifocal, perivascular, lymphohistiocytic encephalitis with
necrosis in the hippocampus
cytoplasm of
macrophages cytoplasm of tubular cells
cytoplasm of macrophages
/microglia and neurons - - - - -
Table
Accepted Manuscript
6 cat
moderate, pyogranulomatous chorioditis and moderate, multifocal
to coalescing pyogranulomatous, periventricular encephalitis
cytoplasm of macrophages
and neutrophilic granulocytes
-
cytoplasm of macrophages,
neutrophilic granulocytes, astrocytes, microglia
and neuron
- - - - -
7 cat
mild, focal, lymphocytic polioencephalitis and severe vacuolization of the white substance of the cerebrum and severe neuronal
necrosis
cytoplasm of macrophages
and neutrophilic granulocytes
glomerula
cytoplasm of macrophages,
neutrophilic granulocytes and
pyramidal cells
- - - - -
8 cat severe, fokal, fibrinous to neutrophilic meningitis and severe, neuronal
necrosis in the hippocampus
cytoplasm of astrocytes
cytoplasm of macrophages
and in glomerula
cytoplasm of astrocytes, macrophages/microglia
and neurons
cytoplasm of
macrophages - - - -
9 cat
moderate to severe, multifocal, pyogranulomatous encephalitis predominantly in the brain stem and
mild, pyogranulomatous meningitis
cytoplasm of neutrophilic granulocytes
cytoplasm of macrophages
and in glomerula
cytoplasm of neurons, astrocytes and
macrophages /microglia
cytoplasm of
macrophages - - - -
10 daw n.d. cytoplasm of
neurons
cytoplasm of tubular cells
and in glomerula
cytoplasm of neurons
cytoplasm of tubular cells
and in glomerula
+ nd 174 nd
No.: animal number; conventional RT-PCR was performed according to Lanciotti et al., 2000; real-time RT-PCR was performed according to Linke et al., 2007a; n.d.: not determined; -: negative result; +: positive result; 174: 174.4 copy numbers of WNV/5µl cDNA
