• Aucun résultat trouvé

Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological precipitates using virus-specific antibodies

N/A
N/A
Protected

Academic year: 2021

Partager "Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological precipitates using virus-specific antibodies"

Copied!
19
0
0

Texte intégral

(1)

HAL Id: hal-00532430

https://hal.archives-ouvertes.fr/hal-00532430

Submitted on 4 Nov 2010

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological

precipitates using virus-specific antibodies

Dirk Schaudien, Stephanie Schwab, Sonja Linke, Frank Seeliger, Georg Pauli, Wolfgang Baumgärtner, Christiane Herden

To cite this version:

Dirk Schaudien, Stephanie Schwab, Sonja Linke, Frank Seeliger, Georg Pauli, et al.. Lack of de- tectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological pre- cipitates using virus-specific antibodies. Veterinary Microbiology, Elsevier, 2008, 132 (1-2), pp.171.

�10.1016/j.vetmic.2008.05.007�. �hal-00532430�

(2)

Accepted Manuscript

Title: Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological precipitates using virus-specific antibodies

Authors: Dirk Schaudien, Stephanie Schwab, Sonja Linke, Frank Seeliger, Georg Pauli, Wolfgang Baumg¨artner, Christiane Herden

PII: S0378-1135(08)00187-9

DOI: doi:10.1016/j.vetmic.2008.05.007

Reference: VETMIC 4035

To appear in: VETMIC Received date: 28-12-2007 Revised date: 24-4-2008 Accepted date: 5-5-2008

Please cite this article as: Schaudien, D., Schwab, S., Linke, S., Seeliger, F., Pauli, G., Baumg¨artner, W., Herden, C., Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with immunohistological precipitates using virus-specific antibodies,Veterinary Microbiology(2007), doi:10.1016/j.vetmic.2008.05.007

This is a PDF file of an unedited manuscript that has been accepted for publication.

As a service to our customers we are providing this early version of the manuscript.

The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

(3)

Accepted Manuscript

Short communication 1

2

Lack of detectable West Nile virus RNA in brains and kidneys of dogs and cats with 3

immunohistological precipitates using virus-specific antibodies 4

5 6 7 8

Dirk Schaudiena, Stephanie Schwaba, Sonja Linkeb, Frank Seeligera, Georg Paulib, 9

Wolfgang Baumgärtnera*, Christiane Herdena 10

11 12

a Department of Pathology, University of Veterinary Medicine Hannover, Bünteweg 13

17, D-30559 Hannover, Germany 14

b Centre for Biological Safety (ZBS 1), Robert Koch-Institut, Nordufer 20, D-13353 15

Berlin, Germany 16

17 18 19

Keywords: immunohistology, molecular mimicry, RT-PCR, West Nile virus 20

21 22 23

*Corresponding author and reprint request 24

Wolfgang Baumgärtner 25

Department of Pathology 26

University of Veterinary Medicine Hanover 27

Bünteweg 17 28

D-30559 Hannover, Germany 29

Phone: ++49 (0)511 953 8620

30

Fax: ++49 (0)511 953 8675

31

E-mail: [email protected] 32

Manuscript

(4)

Accepted Manuscript

Abstract 33

Five dogs and four cats from Germany suffering from encephalitis revealed positive 34

immunoreactivity using two West Nile virus (WNV) specific monoclonal antibodies in 35

brain and in kidney. However, WNV infection could not be confirmed by additional 36

PCR analyses. This study indicated that positive immunoreactivity for WNV in dogs 37

and cats must be interpreted cautiously and should be confirmed by a second virus 38

specific technique.

39

(5)

Accepted Manuscript

1. Introduction 40

West Nile virus (WNV), a flavivirus originally isolated in the West Nile destrict of 41

Uganda (Schmithburn et al., 1940), has become an important cause of disease in 42

birds, humans and horses (Eidson et al., 2001; Komar, 2000; Ostlund et al., 2001) in 43

Africa, Asia and the USA (Cantile et al., 2001). In Europe, cases of WNV-infection 44

have been described in humans and/or animals in Spain, France, Italy, 45

Romania, the Czech Republic and recently in Hungary (Cernescu et al., 1997;

46

Cantile et al., 2000; Durand et al., 2002, Del Giudice et al., 2004; Bankonyi et al., 47

2005; Bankonyi et al., 2006; Kaptoul et al., 2007). Though no cases of WNV have 48

been reported in Germany so far (Müller et al., 2006), an increasing incidence of 49

other emerging diseases has been noticed in central Europe in recent years 50

including Leishmaniasis and blue tongue virus infections (Ferroglio et al., 2006;

51

Wilson et al., 2007). Though dogs displayed rarely clinical signs they are 52

commonly infected in West Nile Virus endemic and epidemic regions as shown 53

by serological investigations (Komar et al., 2001). Therefore, WNV-infection in 54

dogs and maybe in cats must be considered as a differential diagnosis in cases of 55

unknown etiology.

56

2. Materials and methods 57

Five dogs (no. 1 to 5) and four cats (no. 6 to 9), between one and nine years of 58

age, displayed neurological disorders due to a meningoencephalitis (Table 1).

59

Morphological and clinical findings have been described in detail recently 60

(Schwab et al., 2007). Formalin-fixed and paraffin-embedded brain and kidney 61

tissue of these animals were available for further investigations. Equally 62

treated brain tissue from a WNV-infected daw (no. 10; kindly provided by Arno 63

Wünschmann, University of Minnesota, USA) served as positive control.

64

(6)

Accepted Manuscript

Immunohistochemistry was performed using two different murine monoclonal 65

antibodies directed against the major envelope protein E (MEP-E; diluted 1 : 66

300; clone 3.67G; Millipore Corporation, Germany) and the non-structural 67

protein 1 (NSP-1; diluted 1 : 400; 3.1112G; Millipore Corporation) as described 68

(Hall, 2000; Schwab et al., 2007). Briefly, after pre-treatment with pronase E and 69

incubation with the primary antibody a biotin-conjugated goat-anti-mouse 70

antibody (Vector Laboratories Inc., Burlingame, USA) was applied. The antigen- 71

antibody complex was visualized using the avidin-biotin-complex (ABC) 72

method (Vector Laboratories Inc., Burlingame, USA). Tissue sections were 73

counterstained with Mayer´s hematoxylin.

74

Furthermore, two different RT-PCR techniques, a conventional PCR and a TaqMan 75

real-time RT-PCR assay, were performed. Briefly, RNA was extracted from 10 76

sections of 10 µm thickness of paraffin-embedded brain and kidney tissue of all 77

animals using Trizol® reagent as described (von Smolinski et al., 2005) and purified 78

using the RNeasy Minikit (Qiagen, Hilden, Germany) following the protocols of the 79

manufacturer. After a digestion step with DNase I (Qiagen, Hilden, Germany), RNA 80

was resuspended in 30µl of RNase-free water. For reverse transcription, the 81

Omniskript RT kit (Qiagen, Hilden, Germany) was used (Schaudien et al., 2007).

82

Polymerase chain reaction (PCR) was performed according to Lanciotti et al. (2000) 83

using WNV-specific primers (genebank accession nr.: AF196835; forward primer:

84

tcagcgatctctccaccaaag, position 1160-1180; reverse primer: gggtcagcacgtttgtcattg, 85

position 1209-1229) predominantly detecting the WNV-New York strain (WNV 86

lineage 1). As internal positive control for successful RNA extraction and reverse 87

transcription, the reference gene GAPDH was amplified with specific primers 88

(genebank accession nr.: AB038240; forward primer: gtcatcaacgggaagtccatctc, 89

position 196-218; reverse primer: aacatactcagcaccagcatcac, position 257-279; von 90

(7)

Accepted Manuscript

Smolinski et al., 2005). In addition, real-time RT-PCR was performed to detect WNV 91

lineage 1 and 2 as recently described (Linke et al., 2007a).

92

3. Results and Discussion 93

Histologically, a moderate to severe granulomatous, pyogranulomatous or 94

lymphohistiocytic meningoencephalitis with occasionally associated necrosis 95

affecting the grey and white matter was observed (for details see Table 1).

96

Immunohistochemically, WNV specific immunoreactivity was found in the cytoplasm 97

of various cell types including neurons, macrophages, astrocytes and microglia 98

(Table 1; Fig. 1). Additionally, two cats (no. 6 and 7) showed a strong 99

immunoreaction in neutrophils. In all investigated dogs and cats, an 100

immunohistochemical reaction was observed using the anti-MEP-E-antibody (Table 101

1). Surprisingly, after application of the anti-NSP-1-antibody, the brain of one dog 102

(no. 1) remained negative. In one dog (no. 5) and three cats (no. 7 – 9), few positive 103

proximal tubular epithelial cells, glomerular cells and macrophages were found in the 104

kidney using one or both antibodies (Fig. 2). A positive immunoreactivity was also 105

found with both antibodies in the brain and kidney of the WNV-infected daw (no. 10;

106

Table 1).

107

Both WNV RT-PCR assays revealed negative results for all brain and kidney 108

samples of all dogs and cats (Table 1). However, the reference gene GAPDH was 109

successfully amplified in brain and kidney samples of all dogs and cats. As 110

expected a positive WNV signal of 70bp was amplified from the avian brain 111

sample by conventional RT-PCR and 174.4 copy numbers of WNV/5µl cDNA 112

were measured in the real-time RT-PCR (Table 1).

113

In summary, the animals used in this study showed a positive immunoreactivity for 114

WNV using two different virus specific monoclonal antibodies in the brain and kidney.

115

However, these findings could not be substantiated using two different WNV specific 116

(8)

Accepted Manuscript

RT-PCR assays. Since it was possible to amply the housekeeping gene in all 117

brains and kidneys investigated it seems rather unlikely that the lack of WNV 118

RNA amplification is due to RNA decay in these samples. However, differential 119

decay of different RNA species and thereby causing a false negative result 120

cannot be excluded completely.

121

In WNV endemic regions, dogs and cats are occasionally infected without developing 122

clinical signs (Blackburn et al., 1989; Lichtensteiger et al., 2003). In Europe, only 123

time- and region-limited WNV outbreaks in Eastern and Southern Europe have been 124

noted so far (Cantile et al., 2000; Durand et al., 2000; Hubalek and Halouzka, 1999).

125

It is assumed that migrating birds are the responsible host for the introduction of 126

WNV to Europe (Rappole and Hubalek, 2003; Zeller and Schuffenecker, 2004). An 127

investigation of birds in Germany revealed a low number of serologically positive 128

avians (Linke et al., 2007b). Therefore, individual WNV-infections of other animals in 129

Germany might occasionally occur in principle. However, the risk for a WNV- 130

epidemic in Northern Europe remains low (Gould, 2003). Climatic changes leading to 131

different mosquito populations might nevertheless increase the risk of a WNV- 132

epidemic in these regions. Although it cannot be ruled out that the animals in this 133

report might represent the first cases of WNV-infection in Germany, findings must be 134

judged carefully and cautious interpretation is required due to the lack of WNV 135

specific RNA.

136

WNV RNA has been detected in other cases of WNV-infection in dogs using 137

formalin-fixed material (Lichtensteiger et al., 2003; Read et al., 2005). However, 138

surprisingly, WNV-antigen was not detected by immunohistochemistry in the brain by 139

applying a polyclonal WNV specific antibody in these reports. Polyclonal WNV- 140

specific antibodies often cross-react with other flaviviruses (Chvala et al., 2004;

141

Kelley et al., 2003; Steele et al., 2000), whereas the monoclonal antibodies specific 142

(9)

Accepted Manuscript

for the MEP-E and NSP-1 antigen used in this study showed cross reactivity with 143

Kunjin virus, a subtype of the WNV lineage 1 (Hall, 2000; Scherret et al., 2001).

144

Both antibodies used in the present study are frequently used for diagnostic 145

purposes including the epitope-blocking enzyme-linked immunosorbent assay in 146

different investigations (Blitvich et al., 2003). However, we are not aware of any 147

report that mentions the potential cross-reactivity with tissue antigens. Moreover, the 148

affected animals did not react positively for tick-borne encephalitis virus antigen using 149

a polyclonal antibody which cross-reacts with other flaviviruses (Schwab et al., 2007).

150

Therefore, we assume that the immunohistochemical precipitates obtained by the 151

WNV-specific antibodies were most likely due to molecular mimicry, a phenomenon 152

reported for various viruses including Japanese encephalitis virus, which belongs to 153

the Flaviviridae (Oldstone, 1998; Sheshberadaran and Norrby, 1984). In addition, the 154

inflammatory changes of the affected animals in this study consisted of 155

granulomatous and pyogranulomatous reactions. The latter have not been described 156

in context with West Nile virus infection. However, similar changes are reported in 157

the dog as an entity termed idiopathic granulomatous meningoencephalitis (GME;

158

Kipar et al., 1998). A disease complex of unknown etiology. Pathogenetically a 159

delayed type hypersensitivity reactions has been assumed. This further underlines 160

the assumption that the immunohistologically recognizable precipitates are not due to 161

a viral antigen-antibody specific reaction but rather a sequel of molecular mimicry of 162

host derived antigens. However, it remains to be investigated whether both 163

antibodies targeting different peptides of WNV can bind to similar or different 164

cellular antigens. This could explain both similarities and differences in the 165

immunoreactivity pattern of both antibodies (Table 1).

166

(10)

Accepted Manuscript

In conclusion, immunoreactivity obtained by WNV-specific monoclonal antibodies in 167

dogs and cats must be interpreted cautiously and needs to be substantiated by other 168

techniques such as RT-PCR.

169 170

References 171

Bakonyi, T., Hubálek, Z., Rudolf, I., Nowotny, N., 2005. Novel flavivirus or new 172

lineage of West Nile virus, central Europe. Emerg. Infect. Dis. 11, 225-231.

173

Bakonyi, T., Ivanics, E., Erdélyi, K., Ursu, K., Ferenczi, E., Weissenböck, H., 174

Nowotny, N., 2006. Lineage 1 and 2 strains of encephalitic West Nile virus, 175

central Europe. Emerg. Infect. Dis. 12, 618-623.

176

Blackburn, N.K., Reyers, F., Berry, W.L., Shepherd, A.J., 1989. Susceptibility of dogs 177

to West Nile virus: a survey and pathogenicity trial. J. Comp. Pathol. 100, 59-66.

178

Blitvich, B.J., Bowen, R.A., Marlenee, N.L., Hall, R.A., Bunning, M.L., Beaty, B.J., 179

2003. Epitope-blocking enzyme-linked immunosorbent assays for detection of West 180

Nile virus antibodies in domestic mammals. J. Clin. Microbiol. 41, 2676-2679.

181

Cantile, C., Di Guardo, G., Eleni, C., Arispici, M., 2000. Clinical and 182

neuropathological features of West Nile virus equine encephalomyelitis in Italy.

183

Equine Vet. J. 32, 31-35.

184

Cantile, C., Del Piero, F., Di Guardo, G., Arispici, M., 2001. Pathologic and 185

immunohistochemical findings in naturally occuring West Nile virus infection in 186

horses. Vet Pathol. 38, 414-421.

187

Cernescu, C., Ruţă, S.M., Tārdei, G., Grancea, C., Moldoveanu, L., Spulbăr, E., 188

Tsai, T., 1997. A high number of severe neurologic clinical forms during an 189

epidemic of West Nile virus infection. Rom. J. Virol. 48, 13-25.

190

(11)

Accepted Manuscript

Chvala, S., Kolodziejek, J., Nowotny, N., Weissenböck, H., 2004. Pathology and viral 191

distribution in fatal Usutu virus infections of birds from the 2001 and 2002 outbreaks 192

in Austria. J. Comp. Pathol. 131, 176-185.

193

Del Giudice, P., Schuffenecker, I., Vandenbos, F., Counillon, E., Zeller, H., 2004.

194

Human West Nile virus, France. Emerg. Infect. Dis. 10, 1885-1886.

195

Durand, B., Chevalier, V., Pouillot, R., Labie, J., Marendat, I., Murgue, B., Zeller, H., 196

Zientara, S., 2002. West Nile virus outbreak in horses, southern France, 2000:

197

results of a serosurvey. Emerg. Infect. Dis. 8, 777-782.

198

Eidson, M., Miller, J., Kramer, L., Cherry, B., Hagiwara, Y., 2001. Dead crow 199

densities and human cases of West Nile virus, New York State, 2000. Emerg.

200

Infect. Dis. 7, 662-664.

201

Ferroglio, E., Romano, A., Passera, S., D'Angelo, A., Guiso, P., Ghiggi, E., Bolla, C., 202

Trisciuoglio, A., Biglino, A., 2006. Dogs' parasite and zoonotic risk: from old to new 203

"emergencies" in the North-West of Italy. Parassitologia. 48, 115-116.

204

Gould, E.A., 2003. Implications for Northern Europe of the emergence of West Nile 205

virus in the USA. Epidemiol. Infect. 131, 583-589.

206

Hall, R.A., 2000. The emergence of West Nile virus: the Australian connection. Viral 207

Immunol. 13, 447-461.

208

Hubalek, Z., Halouzka., J., 1999. West Nile fever--a reemerging mosquito-borne viral 209

disease in Europe. Emerg. Infect. Dis. 5, 643-650.

210

Kaptoul, D., Viladrich, P.F., Domingo, C., Niubó, J., Martínez-Yélamos, S., De Ory, 211

F., Tenorio, A., 2007. West Nile virus in Spain: report of the first diagnosed case (in 212

Spain) in a human with aseptic meningitis. Scand. J. Infect. Dis. 39, 70-71.

213

Kelley, T.W., Prayson, R.A., Ruiz, A.I., Isada, C.M., Gordon, S.M., 2003. The 214

neuropathology of West Nile virus meningoencephalitis. A report of two cases and 215

review of the literature. Am. J. Clin. Pathol. 119, 749-753.

216

(12)

Accepted Manuscript

Kipar, A., Baumgärtner, W., Vogl, C., Gaedke, K., Wellman, M., 1998.

217

Immunohistochemical characterization of inflammatory cells in brains of dogs with 218

granulomatous meningoencephalitis. Vet. Pathol. 35, 43-52 219

Komar, N., 2000. West Nile viral encephalitis. Rev. Sci. Tech. 19, 166-176.

220

Komar, N., Panella, N.A., Boyce, E., 2001. Exposure of domestic mammals to 221

West Nile virus during an outbreak of human encephalitis, New York City, 1999.

222

Emerg. Infect. Dis. 7, 736-738.

223

Lanciotti, R.S., Kerst, A.J., Nasci, R.S., Godsey, M.S., Mitchell, C.J., Savage, H.M., 224

Komar, N., Panella, N.A., Allen, B.C., Volpe, K.E., Davis, B.S., Roehrig, J.T., 2000.

225

Rapid detection of West Nile virus from human clinical specimens, field-collected 226

mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J.

227

Clin. Microbiol. 38, 4066-4071.

228

Lichtensteiger, C.A., Heinz-Taheny, K., Osborne, T.S., Novak, R.J., Lewis, B.A., 229

Firth, M.L., 2003. West Nile virus encephalitis and myocarditis in wolf and dog.

230

Emerg. Infect. Dis. 9, 1303-1306.

231

Linke, S., Ellerbrok, H., Niedrig, M., Nitsche, A., Pauli, G., 2007a. Detection of West 232

Nile virus lineages 1 and 2 by real-time PCR. J. Virol. Methods 146, 355-358 233

Linke, S., Niedrig, M., Kaiser, A., Ellerbrok, H., Muller, K., Muller, T., Conraths, F.J., 234

Muhle, R.U., Schmidt, D., Koppen, U., Bairlein, F., Berthold, P., Pauli, G., 2007b.

235

Serologic evidence of West Nile virus infections in wild birds captured in Germany.

236

Am. J. Trop. Med. Hyg. 77, 358-364.

237

Müller, H., Johne, R., Schusser, G., Giese, M., Linke, S., Pauli, G., 2006. West Nile 238

virus--causative agent of a zoonosis with increasing significance? (in German) 239

Dtsch. Tierarztl. Wochenschr. 113, 435-439.

240

Oldstone, M.B., 1998. Molecular mimicry and immune-mediated diseases. FASEB J.

241

12, 1255-1265.

242

(13)

Accepted Manuscript

Ostlund, E.N., Crom, R.L., Pedersen, D.D., Johnson, D.J., Williams, W.O., Schmitt, 243

B.J., 2001. Equine West Nile encephalitis, United States. Emerg. Infect. Dis. 7, 665- 244

659.

245

Rappole, J.H., Hubalek, Z., 2003. Migratory birds and West Nile virus. J. Appl.

246

Microbiol. 94, 47-58.

247

Read, R.W., Rodriguez, D.B., Summers, B.A., 2005. West Nile virus encephalitis in a 248

dog. Vet. Pathol. 42, 219-222.

249

Schaudien, D., Baumgärtner, W., Herden, C., 2007. High preservation of DNA 250

standards diluted in 50% glycerol. Diagn. Mol. Pathol. 16, 153-157.

251

Scherret, J.H., Poidinger, M., Mackenzie, J.S., Broom, A.K., Deubel, V., Lipkin, W.I., 252

Briese, T., Gould, E.A., Hall, R.A., 2001. The relationships between West Nile and 253

Kunjin viruses. Emerg. Infect. Dis. 7, 697-705.

254

Schmithburn, K.C., Hughes, T.P., Burke, A.W., Paul, J.H., 1940. A neurotropic virus 255

isolated from the blood of a native of Uganda. Am. J. Trop. Med. Hyg. 20, 471-492.

256

Schwab, S., Herden, C., Seeliger, F., Papaioannou, N., Psalla, D., Polizopulou, Z., 257

Baumgärtner, W., 2007. Non-suppurative meningoencephalitis of unknown origin in 258

cats and dogs: an immunohistochemical study. J. Comp. Pathol. 136, 96-110.

259

Sheshberadaran, H., Norrby, E., 1984. Three monoclonal antibodies against measles 260

virus F protein cross-react with cellular stress proteins. J. Virol. 52, 995-999.

261

Steele, K.E., Linn, M.J., Schoepp, R.J., Komar, N., Geisbert, T.W., Manduca, R.M., 262

Calle, P.P., Raphael, B.L., Clippinger, T.L., Larsen, T., Smith, J., Lanciotti, R.S., 263

Panella, N.A., McNamara, T.S., 2000. Pathology of fatal West Nile virus infections 264

in native and exotic birds during the 1999 outbreak in New York City, New York.

265

Vet. Pathol. 37, 208-224.

266

von Smolinski, D., Leverkoehne, I., von Samson-Himmelstjerna, G., Gruber, A.D., 267

2005. Impact of formalin-fixation and paraffin-embedding on the ratio between 268

(14)

Accepted Manuscript

mRNA copy numbers of differently expressed genes. Histochem. Cell Biol. 124, 269

177-188.

270

Wilson A., Carpenter, S., Gloster, J., Mellor, P., 2007. Re-emergence of bluetongue 271

in northern Europe in. Vet. Rec. 161, 487-489.

272

Zeller, H.G., Schuffenecker, I., 2004. West Nile virus: an overview of its spread in 273

Europe and the Mediterranean basin in contrast to its spread in the Americas. Eur.

274

J. Clin. Microbiol. Infect. Dis. 23, 147-156.

275

(15)

Accepted Manuscript

Figure Legends:

276 277

Fig. 1. Immunhistochemical reaction of West Nile virus specific non-structural protein 278

1 antibody in the brain of a dog (animal no. 4).

279

Positive precipitates in the cytoplasm of neurons (arrows), avidin-biotin- 280

complex (ABC) method, NSP- 1 antibody 281

282

Fig. 2. Immunhistochemical reaction of West Nile virus specific major envelope 283

protein E antibody in the kidney of a cat (animal no. 7).

284

Positive precipitates in cells of renal glomerula, avidin-biotin-complex (ABC) 285

method, MEP- E antibody 286

(16)

Accepted Manuscript

Figure

(17)

Accepted Manuscript

Figure

(18)

Accepted Manuscript

Table 1: Summarized histological, immunohistological and RT-PCR findings in dogs and cats with immunoprecipitates in brain and kidneys after incubating with West-Nile specific antibodies

Immunohistochemistry RT-PCT

animal Histopathology MEP-E antibody NSP-1 antibody conventional real-time

no. species of brain brain kidney brain kidney brain kidney brain kidney

1 dog moderate, multifocal, lymphohistiocytic to granulomatous,

perivascular meningoencephalitis

cytoplasm of neurons and macrophages

/microglia

- - - - - - -

2 dog severe, multifocal, granulomatous to

necrotizing meningoencephalitis cytoplasm of

pyramidal cells - cytoplasm of pyramidal cells and macrophages

/microglia - - - - -

3 dog

severe, periventricular, granulomatous encephalitis and mild,

multifocal, lymphoplasmacytic chorioditis

cytoplasm of

pyramidal cells - cytoplasm of pyramidal cells and macrophages

/microglia - - - - -

4 dog severe, multifokal, granulomatous encephalitis in the brain stem with

mild, multifocal necrosis

cytoplasm of pyramidal cells

and macrophages

/microglia

- cytoplasm of

macrophages/microglia

and neurons - - - - -

5 dog severe, multifocal, perivascular, lymphohistiocytic encephalitis with

necrosis in the hippocampus

cytoplasm of

macrophages cytoplasm of tubular cells

cytoplasm of macrophages

/microglia and neurons - - - - -

Table

(19)

Accepted Manuscript

6 cat

moderate, pyogranulomatous chorioditis and moderate, multifocal

to coalescing pyogranulomatous, periventricular encephalitis

cytoplasm of macrophages

and neutrophilic granulocytes

-

cytoplasm of macrophages,

neutrophilic granulocytes, astrocytes, microglia

and neuron

- - - - -

7 cat

mild, focal, lymphocytic polioencephalitis and severe vacuolization of the white substance of the cerebrum and severe neuronal

necrosis

cytoplasm of macrophages

and neutrophilic granulocytes

glomerula

cytoplasm of macrophages,

neutrophilic granulocytes and

pyramidal cells

- - - - -

8 cat severe, fokal, fibrinous to neutrophilic meningitis and severe, neuronal

necrosis in the hippocampus

cytoplasm of astrocytes

cytoplasm of macrophages

and in glomerula

cytoplasm of astrocytes, macrophages/microglia

and neurons

cytoplasm of

macrophages - - - -

9 cat

moderate to severe, multifocal, pyogranulomatous encephalitis predominantly in the brain stem and

mild, pyogranulomatous meningitis

cytoplasm of neutrophilic granulocytes

cytoplasm of macrophages

and in glomerula

cytoplasm of neurons, astrocytes and

macrophages /microglia

cytoplasm of

macrophages - - - -

10 daw n.d. cytoplasm of

neurons

cytoplasm of tubular cells

and in glomerula

cytoplasm of neurons

cytoplasm of tubular cells

and in glomerula

+ nd 174 nd

No.: animal number; conventional RT-PCR was performed according to Lanciotti et al., 2000; real-time RT-PCR was performed according to Linke et al., 2007a; n.d.: not determined; -: negative result; +: positive result; 174: 174.4 copy numbers of WNV/5µl cDNA

Références

Documents relatifs

Glycosylation of the West Nile Virus Envelope Protein Increases In Vivo and In Vitro Viral Multiplication in Birds.. Viral

Evidence of circulation of West Nile virus in Culex pipiens mosquitoes and horses in Morocco.. Najlaa Assaid, Laurence Mousson, Sara Moutailler, Soukaina Arich, Khadija Akarid,

We conducted extensive surveillance for West Nile virus infection in equines and chickens in Guadeloupe in 2003–2004.. We showed a high seroprevalence in equines in 2003 related

The results of the survey undertaken in December 2002 to January 2003 in equine centers where positive animals were detected in July 2002 indicated a high rate of WNV seroconversion

West Nile virus- related disease in humans and horses is still being reported from the USA and lately confirmed human cases have been reported from France [56].. Further- more,

Similarly, 6 (8.2%) of the 73 horses that were annually immu- nized with the inactivated vaccine that were seropositive in April were seroneg- ative in November, 2005, and 2 (50%) of

Serological evidence of West Nile virus circulation in Portugal..

We analyzed different ecological and evolutionary factors related to West Nile virus neutralizing antibody prevalence in 72 bird species sampled in southern Spain.. Prevalence